ID: 1152214123

View in Genome Browser
Species Human (GRCh38)
Location 17:79022712-79022734
Sequence CGCTAGGCTTAGAAGATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152214123_1152214129 -3 Left 1152214123 17:79022712-79022734 CCCCTGATCTTCTAAGCCTAGCG No data
Right 1152214129 17:79022732-79022754 GCGGAGGCTGCATCTCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152214123 Original CRISPR CGCTAGGCTTAGAAGATCAG GGG (reversed) Intergenic
No off target data available for this crispr