ID: 1152214129

View in Genome Browser
Species Human (GRCh38)
Location 17:79022732-79022754
Sequence GCGGAGGCTGCATCTCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152214124_1152214129 -4 Left 1152214124 17:79022713-79022735 CCCTGATCTTCTAAGCCTAGCGG No data
Right 1152214129 17:79022732-79022754 GCGGAGGCTGCATCTCTAGTTGG No data
1152214123_1152214129 -3 Left 1152214123 17:79022712-79022734 CCCCTGATCTTCTAAGCCTAGCG No data
Right 1152214129 17:79022732-79022754 GCGGAGGCTGCATCTCTAGTTGG No data
1152214126_1152214129 -5 Left 1152214126 17:79022714-79022736 CCTGATCTTCTAAGCCTAGCGGA No data
Right 1152214129 17:79022732-79022754 GCGGAGGCTGCATCTCTAGTTGG No data
1152214122_1152214129 13 Left 1152214122 17:79022696-79022718 CCAAGAACACAAGCAACCCCTGA No data
Right 1152214129 17:79022732-79022754 GCGGAGGCTGCATCTCTAGTTGG No data
1152214121_1152214129 28 Left 1152214121 17:79022681-79022703 CCTCAGACACGTATGCCAAGAAC No data
Right 1152214129 17:79022732-79022754 GCGGAGGCTGCATCTCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152214129 Original CRISPR GCGGAGGCTGCATCTCTAGT TGG Intergenic
No off target data available for this crispr