ID: 1152217011

View in Genome Browser
Species Human (GRCh38)
Location 17:79039209-79039231
Sequence ACAAAAAATGTCTCCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 1, 1: 1, 2: 38, 3: 104, 4: 543}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152217011_1152217019 29 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217019 17:79039261-79039283 GCATCTGGTGGGGACAGTCCAGG 0: 1
1: 0
2: 9
3: 107
4: 663
1152217011_1152217018 19 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217018 17:79039251-79039273 GGTGCTAATGGCATCTGGTGGGG 0: 1
1: 1
2: 17
3: 49
4: 215
1152217011_1152217012 -8 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217012 17:79039224-79039246 TTTTTTGTTGTCATAACTAGAGG 0: 1
1: 5
2: 59
3: 293
4: 981
1152217011_1152217013 -2 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217013 17:79039230-79039252 GTTGTCATAACTAGAGGTAGTGG 0: 1
1: 0
2: 1
3: 33
4: 158
1152217011_1152217014 7 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217014 17:79039239-79039261 ACTAGAGGTAGTGGTGCTAATGG 0: 1
1: 0
2: 1
3: 7
4: 115
1152217011_1152217016 17 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217016 17:79039249-79039271 GTGGTGCTAATGGCATCTGGTGG 0: 1
1: 3
2: 42
3: 275
4: 825
1152217011_1152217020 30 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217020 17:79039262-79039284 CATCTGGTGGGGACAGTCCAGGG 0: 1
1: 0
2: 10
3: 102
4: 698
1152217011_1152217015 14 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217015 17:79039246-79039268 GTAGTGGTGCTAATGGCATCTGG 0: 1
1: 2
2: 1
3: 25
4: 158
1152217011_1152217017 18 Left 1152217011 17:79039209-79039231 CCATGTTTGGAGACATTTTTTGT 0: 1
1: 1
2: 38
3: 104
4: 543
Right 1152217017 17:79039250-79039272 TGGTGCTAATGGCATCTGGTGGG 0: 1
1: 5
2: 62
3: 374
4: 977

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152217011 Original CRISPR ACAAAAAATGTCTCCAAACA TGG (reversed) Intronic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901183950 1:7360182-7360204 TTAAAGACTGTCTCCAAACAAGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901832971 1:11905339-11905361 AAAAAAAAGATTTCCAAACAGGG - Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902356989 1:15910821-15910843 ACAAAAAAGCTCTAAAAACACGG - Intronic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904537947 1:31213284-31213306 GCAAAGAATTTCTCCAAAGAAGG + Intronic
905081596 1:35326843-35326865 AAAAAAAATGACTCCAAGCCAGG - Intronic
905506280 1:38482109-38482131 ATACAGGATGTCTCCAAACAGGG - Intergenic
905711502 1:40108288-40108310 ACAACAAATGTCTTCAAAATTGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
905778718 1:40688835-40688857 ACAGAATCTCTCTCCAAACAGGG + Intergenic
906052284 1:42885592-42885614 ACAAAAAAAATCTCCACAAAAGG - Intergenic
907402893 1:54235921-54235943 TCAAAAAATGTCACCAGAAAAGG - Intronic
907869640 1:58431765-58431787 TCAACAAATGTGTCCAAAGAAGG - Intronic
908076088 1:60519636-60519658 ACAATAAATATCACCAAAGAGGG - Intergenic
908304700 1:62800500-62800522 ATTAAAAATGTCTCCTAAAATGG - Intronic
908628224 1:66071716-66071738 ACAAAAAATCTGTCATAACAGGG - Intronic
909080389 1:71103941-71103963 AAAAAAAATGTCTAGAAATAAGG - Intergenic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
909519239 1:76547960-76547982 ACAAAGAATGGCTCAAAGCAAGG - Intronic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914698288 1:150106325-150106347 ACAAATAATGCCTCCAACAAAGG + Intronic
915000282 1:152583168-152583190 AAAAAGAATGTCTCCAAATTAGG + Intronic
915035117 1:152915862-152915884 AGAAAAAACAGCTCCAAACATGG - Intergenic
915075313 1:153303788-153303810 CCCAAACATGACTCCAAACATGG + Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
915824031 1:159056615-159056637 AGAAAACATGTATCTAAACAAGG + Intergenic
916235262 1:162581210-162581232 ACAAAGATTGTTTCCAAACTAGG - Intronic
916246746 1:162696239-162696261 ACTAAAAGTTTCACCAAACAAGG + Intronic
917156665 1:172007700-172007722 AGAAAAAATCTCTGCAAACTTGG - Intronic
917246905 1:173013275-173013297 ACAACAAATACCTACAAACATGG + Intergenic
917547620 1:175987937-175987959 ACACATAATGTCTCCAAAATTGG + Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918351917 1:183665055-183665077 ACAAAAACTCTCTGCAAACTAGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
919143664 1:193605960-193605982 ACAAAAACTGTCTTCCAAAATGG - Intergenic
919249742 1:195038143-195038165 ACAATAAATCTCTGCAACCAAGG + Intergenic
919644056 1:200074824-200074846 AAAAAAAACTTCTCCAAATATGG + Intronic
919842368 1:201618793-201618815 AGAAACAATGTCTCAATACAAGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921425378 1:214995283-214995305 AAAAAAAATGTATCCAACCTTGG + Intergenic
921584184 1:216928525-216928547 ATAAAAAATGTCCACGAACATGG - Intronic
922576598 1:226665042-226665064 AAAAAAAATGTAGCCAAACAAGG - Intronic
923794509 1:237141333-237141355 ATAAAAATTCTCACCAAACAAGG - Intronic
924286435 1:242492782-242492804 ACAACAGATGTCTGCAAACCAGG - Intronic
1063102050 10:2958858-2958880 CCAAAAAATGTGCCCACACAGGG + Intergenic
1063770053 10:9186751-9186773 AGAAAAAATGTCTACATACTTGG - Intergenic
1064554142 10:16531837-16531859 ATAAACTATGTGTCCAAACAGGG + Intergenic
1064746602 10:18484535-18484557 ACAAAAGATGTAGCCAACCAAGG + Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065103876 10:22359785-22359807 ACAAAAAGTTTCTGCAAACTGGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065609388 10:27456856-27456878 ACAAAAAATGTCCCACAATAAGG + Intergenic
1065679813 10:28217590-28217612 ACAAAAAAAGTCACAAAAAAAGG + Intronic
1066177208 10:32920825-32920847 AAAAAAAATTTATCCAAGCATGG + Intronic
1066454140 10:35558576-35558598 AAAAAATATATCTCCAAATATGG - Intronic
1067191628 10:44074626-44074648 ACAAAAACTGTCACAAAATAGGG - Intergenic
1067442669 10:46318823-46318845 ACAAAACATGATTCCAAATAGGG + Intronic
1068125587 10:52838642-52838664 ACAAAAAATGTTTATAAGCATGG - Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069093779 10:64233420-64233442 ACAAAATATGTATAAAAACAAGG - Intergenic
1069128280 10:64666194-64666216 ACAAGAAATGGCAACAAACATGG - Intergenic
1070038852 10:72754878-72754900 GCAAAAAATGTCTGCAAACTGGG - Intronic
1070204862 10:74247701-74247723 TCAAAAAATGTCTAGAAAAAGGG + Intronic
1070233579 10:74598388-74598410 ACAAAATATGTCTTCTCACAGGG + Intronic
1070415016 10:76181169-76181191 AGAAGAAATGTCTGCAAAAAGGG - Intronic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1070950243 10:80425439-80425461 ACAGAAAATGTCACCAAACAGGG + Intronic
1071031204 10:81183468-81183490 ATAAAAAATGACTGCAAAAAAGG + Intergenic
1071146609 10:82581910-82581932 AAAAAAAGTGTATCTAAACACGG - Intronic
1072643257 10:97230532-97230554 AAAAAAAATTTCTCCAAAGATGG - Intronic
1072849796 10:98877045-98877067 ACAAAAAATGTTTTTGAACATGG - Intronic
1073990671 10:109258785-109258807 ACATGAAATATCTCCAATCAAGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074424689 10:113340692-113340714 ACATAAAATGTCTGAAAAGAGGG + Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076269799 10:129141824-129141846 ACCAAAACTGTTTCAAAACAGGG + Intergenic
1076508859 10:130998246-130998268 ACAAAAACTGTCAGCAAAAACGG + Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078137660 11:8665212-8665234 CTAAAAACTCTCTCCAAACATGG + Intronic
1078422399 11:11223336-11223358 ACAAAAAAATTAGCCAAACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079595003 11:22233440-22233462 ACAAAAAATGTCTGGAACCTGGG - Intronic
1079649245 11:22906246-22906268 ACACAAAATCTGTACAAACATGG - Intergenic
1079919497 11:26414813-26414835 ACAAAAAAAATCTCAAATCAAGG - Intronic
1081346356 11:41991900-41991922 AAAAAAAATGGCTACCAACAGGG + Intergenic
1081373359 11:42330947-42330969 ATAAAAAATGTCTTTAAATATGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1081868157 11:46371095-46371117 ACAAAAAATGTGTTCAAAGCTGG + Intronic
1082900893 11:58250721-58250743 ACAAACCATGGCACCAAACAAGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083055976 11:59820201-59820223 AAAAATACTGTCTCCAAATAAGG + Intergenic
1083244674 11:61417220-61417242 ACAAAACATGTCTCCAATCTGGG + Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084141315 11:67231902-67231924 ACAAGAAATGTGTCCCCACAGGG + Exonic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087377589 11:97364389-97364411 ACAGAAAAAGGCTCAAAACAAGG + Intergenic
1087740346 11:101880180-101880202 ACACAAAATGACACCTAACAGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088425803 11:109700614-109700636 AAATAAAAGGTATCCAAACAGGG + Intergenic
1088644806 11:111909388-111909410 AAAAAAAATGACTCCATCCAAGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090064600 11:123492011-123492033 ACCTACAATATCTCCAAACATGG - Intergenic
1091911746 12:4236987-4237009 ACAAAACATCTCCCCAAAAAAGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093291427 12:17328110-17328132 ACAAAAAATCTCTACAATGAAGG - Intergenic
1093513989 12:19963981-19964003 AAAGAAAATGTTTCAAAACAAGG - Intergenic
1093616144 12:21227564-21227586 ACAGAAAATGTCTCACAAAATGG + Intronic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095589090 12:43883779-43883801 ACAAAAAAAAACCCCAAACAAGG + Intronic
1095608123 12:44095009-44095031 ACAAAAAATGTTGACCAACATGG - Intronic
1097841297 12:64324078-64324100 ACATAAACTCTGTCCAAACATGG + Intronic
1097966723 12:65589722-65589744 ACAAACAATGCTTCCAAAAATGG + Intergenic
1098045515 12:66396564-66396586 TAAAAAAATGTCTCCAAATAAGG - Intronic
1098454356 12:70655522-70655544 ACAAAATATGTGTCCTAAAATGG + Intronic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1099245816 12:80192115-80192137 CAAAACAATGTATCCAAACATGG - Intergenic
1099478246 12:83134648-83134670 TCAAAAAATGTCTCCGCTCAGGG + Exonic
1100735750 12:97528374-97528396 GGAAACAATGTCTCCAAAGAAGG - Intergenic
1101004040 12:100384445-100384467 ACAAAAAATTTGGCCAGACATGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1102625187 12:114229082-114229104 AAAAAACAATTCTCCAAACATGG - Intergenic
1102795176 12:115683083-115683105 TTAAAAAATGTCTCCAAGCTGGG - Intergenic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1104201877 12:126597729-126597751 AGAAAAAATATCTCCGAACTGGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106173740 13:27310441-27310463 ACACAAAATATCTCCTAATAGGG - Intergenic
1106385144 13:29277176-29277198 AAAACAAGTGTCTCCAAAGAGGG - Intronic
1106712596 13:32354036-32354058 TCAAAAAAAGTCTCCAAAACTGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109416659 13:62049707-62049729 ACAAAAAATGTAGCCAGGCATGG + Intergenic
1109611005 13:64764451-64764473 AAAGAAAATGTCTCCACTCAGGG - Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1110354221 13:74548238-74548260 ACAAAAGAATTCTCCAAATAGGG + Intergenic
1110366171 13:74688237-74688259 ACAAACTATGCCTCGAAACAAGG - Intergenic
1110676446 13:78252018-78252040 ACAAAATATGTATACATACATGG - Intergenic
1110761957 13:79240675-79240697 AAAAAAAATGTAGCCAAATAGGG + Intergenic
1110987779 13:81993843-81993865 TTAAATAATGTCTCCAAAAAGGG - Intergenic
1111018519 13:82414452-82414474 ACAATTAATTTCTCCAAGCATGG + Intergenic
1111291588 13:86178206-86178228 CCAAAATATGTTTCCAGACATGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112727434 13:102320550-102320572 ACAAAATAAGTCTCCAAAACAGG - Intronic
1112999724 13:105620099-105620121 ACAAAAAATGTATCCTAATATGG + Intergenic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115218277 14:31034138-31034160 CCAAAGAATGACACCAAACATGG + Intronic
1115325809 14:32136885-32136907 AAAAAAAATTTCTCCAAAGAAGG - Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116140939 14:40993729-40993751 ACAAAAAATTTAGCCAGACATGG + Intergenic
1116230090 14:42204836-42204858 ACAAAAAATGTAGCCAAGTATGG - Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116429708 14:44831626-44831648 ATAAAAAATGCCCCCAAACCTGG - Intergenic
1116548970 14:46209782-46209804 ACAATAACTGTTTCCAAAGAAGG - Intergenic
1116832610 14:49737137-49737159 ACAAAAAATGCCCTCATACATGG - Intronic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1118899863 14:69977539-69977561 ACTGAATATGGCTCCAAACATGG + Intronic
1118972324 14:70647513-70647535 ACTAGAAATGGCTTCAAACATGG - Intronic
1119603656 14:75995676-75995698 AAGAAAAATGTCACCAAAAAGGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120281846 14:82449018-82449040 ACATAAAATATCTACAAATATGG + Intergenic
1120287585 14:82523818-82523840 ACAAAAGATGTTTCCAGAAATGG - Intergenic
1120290751 14:82567481-82567503 ATAAAAAAAATTTCCAAACAAGG - Intergenic
1120383527 14:83813730-83813752 ACAGCAACTGCCTCCAAACAGGG + Intergenic
1121206776 14:92175911-92175933 ACAAAAAATGTTTATAAACATGG - Intergenic
1122303033 14:100742532-100742554 ATGAAAAATGTCTCCAAGGATGG - Intergenic
1123068942 14:105631792-105631814 GCAAAGACTGTTTCCAAACAAGG + Intergenic
1123077306 14:105674522-105674544 ACAATAAATGTCTTTTAACATGG - Intergenic
1123093019 14:105750520-105750542 GCAAAGACTGTTTCCAAACAAGG + Intergenic
1123098492 14:105777617-105777639 GCAAAGACTGTTTCCAAACAAGG + Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1123829093 15:24115534-24115556 ACAGAAAATGCCTGAAAACAGGG - Intergenic
1123931183 15:25172414-25172436 AGAAGACATGTGTCCAAACATGG - Intergenic
1124101692 15:26701067-26701089 ACAAAAAAACTCTGCAAACGAGG + Intronic
1124783927 15:32661322-32661344 ACAGAAAATGTCTCCAGGCCAGG + Intronic
1124856945 15:33398573-33398595 ACAAGAAATTTCTCCACGCATGG + Intronic
1125250876 15:37701757-37701779 ACATAAAATGTGTACATACAGGG + Intergenic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1127511916 15:59650931-59650953 ACAAAAGATGTCTTCAAGCTTGG - Intronic
1129060605 15:72857594-72857616 ACAGAAAATGCCTCAAAAGAGGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131141314 15:89978872-89978894 AAAAAAAATGGCTGGAAACATGG - Intergenic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131410492 15:92203320-92203342 ACAAAAAATCTCGCTAAAAATGG - Intergenic
1131530206 15:93184362-93184384 AAAAAAAAAGTCTCTAAATATGG + Intergenic
1131841963 15:96447033-96447055 AAATAGAATGTCTCCAAACGAGG + Intergenic
1132017070 15:98327511-98327533 AAAAAAAATCCCACCAAACACGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133521607 16:6563687-6563709 ACAAAAAAAGTAGCCAAGCATGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134263560 16:12673693-12673715 ACAGAAAATGTGACCAAACGAGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136242860 16:28955216-28955238 ACAAAAAATACCCCCAAACCTGG + Intronic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1138934587 16:61703475-61703497 ACAATATATGTTTCAAAACATGG + Intronic
1139038078 16:62972197-62972219 ATAAAAAATTACTCCAAACTTGG + Intergenic
1139212256 16:65090882-65090904 ACTTAAAATATCTCCAAACCTGG - Intronic
1140061882 16:71577627-71577649 AAAAAAAATGTTGCCAAACAAGG - Intergenic
1140395432 16:74622321-74622343 ACAAAAGACGTCTTCAAATAGGG + Exonic
1140533288 16:75685089-75685111 AGAAAAAAATTCACCAAACAAGG - Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141051054 16:80764059-80764081 ACAAAAAAAGTCTTTAAAGATGG + Intronic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141253638 16:82381259-82381281 ACAAAGACTGTTTCCAAATAAGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141743017 16:85906777-85906799 CCAAAAAAGGTCTCCAAACATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1142559336 17:800731-800753 CCAAACAGAGTCTCCAAACACGG + Exonic
1142974298 17:3634414-3634436 ACAAAAAAATTCTCCAAGCATGG + Intronic
1143737067 17:8918963-8918985 ATATAGAATGTCTCCAAACTGGG - Intronic
1143764483 17:9128577-9128599 AGAAAAAATGAGTCCAAAAATGG - Intronic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144856098 17:18268728-18268750 AAAAAAAAGGACTCCAAAAATGG + Intergenic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1145211757 17:21018554-21018576 ACACAAAAATTATCCAAACATGG + Intronic
1146051534 17:29557943-29557965 AGAGAAAAGGTCTCAAAACAAGG - Intergenic
1146129379 17:30258121-30258143 ACAAAATAGCTCGCCAAACATGG - Intronic
1146207900 17:30920642-30920664 ACAAAGAAACCCTCCAAACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147224751 17:38967813-38967835 TCAAAAATTGTCTCAAAACTAGG - Intergenic
1147637679 17:41973990-41974012 AAAAAAAATGTCACAAAACAAGG - Exonic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1149043043 17:52212829-52212851 ACAGAACCTGTCTCCAAATAAGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150801962 17:68290259-68290281 ATATAAAATGTCACCAAACATGG - Intronic
1150896870 17:69221861-69221883 ACAAAAAATTTCACCATGCATGG + Exonic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151369200 17:73637093-73637115 ATAAAATAAGCCTCCAAACAAGG + Intronic
1151860551 17:76758019-76758041 ACAAAAAATGTTCTCAAAGAAGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153036630 18:769599-769621 ATAAAAACTGTCAGCAAACAAGG - Intronic
1153070973 18:1104139-1104161 AAAAAAAAGGTCTCCATTCAAGG + Intergenic
1153288824 18:3480731-3480753 ACAAAAAAATTCACCAAACATGG - Intergenic
1153908362 18:9684262-9684284 AAAAAAAAAGTTTCAAAACATGG - Intergenic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1155751583 18:29429423-29429445 ACAAAGAATGTTACTAAACAAGG + Intergenic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156756135 18:40528758-40528780 ACAAAAAGTGAATCCTAACATGG - Intergenic
1156852576 18:41745565-41745587 TCAAATAATGACTGCAAACAAGG + Intergenic
1157747130 18:50145752-50145774 AGAAAAGATTTCTGCAAACAAGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159338549 18:67102860-67102882 AAAAAAATTTTCTCAAAACATGG + Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164042941 19:21509740-21509762 CTAAAAACTGTCTCAAAACAAGG - Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1166654353 19:44599332-44599354 ACAATAAATGGCTCCCACCAAGG + Intergenic
1167975637 19:53223763-53223785 ACAGAAAATGTCTTCCAACTGGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168678401 19:58295715-58295737 ACAAAATATGTCGCTAAAGAGGG - Exonic
1202677825 1_KI270711v1_random:23772-23794 AAAAAAAATGTCTCTGACCAGGG - Intergenic
927664597 2:25021798-25021820 ACTAAAAATATGTACAAACATGG - Intergenic
927890843 2:26747835-26747857 ACAAAAAATCAATACAAACAAGG - Intergenic
927923781 2:26995047-26995069 ACAAAAAATGTCTGCCATCTTGG - Intronic
928539476 2:32270774-32270796 ACAAAAAAAGTATTCAAAAAAGG - Intergenic
928554334 2:32407776-32407798 ACAAAAAAAATCACCAAATAAGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
931112867 2:59131943-59131965 AGAGAAAATGTATCCACACAAGG + Intergenic
932101299 2:68901407-68901429 ACAAAGAATGAATACAAACAAGG + Intergenic
932146425 2:69322822-69322844 ACACAATATGCCCCCAAACATGG + Exonic
932996868 2:76865544-76865566 AAAACAAATGTCTCCAAATTAGG - Intronic
934074315 2:88414732-88414754 ACAAAAAAATTATCCAAGCATGG + Intergenic
934124576 2:88874978-88875000 AAAAAATATATATCCAAACAGGG - Intergenic
934157759 2:89219081-89219103 ACAAAACTTCTCTCCAATCAGGG - Intergenic
934209505 2:89963345-89963367 ACAAAACTTCTCTCCAATCAGGG + Intergenic
934478307 2:94608605-94608627 ATAAAATATGTCTCCCACCATGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937409704 2:121663054-121663076 ACAGATAATATCTCCAAAAATGG + Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937819967 2:126299088-126299110 AAAAAGAATGTTTCCATACATGG - Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939280734 2:140061207-140061229 ACAAAAACTGTCAGCAAACTAGG - Intergenic
939674614 2:145056485-145056507 AAAAAAATTATCTCCAAACATGG - Intergenic
939693618 2:145296641-145296663 AAATAACATTTCTCCAAACATGG - Intergenic
939824891 2:147002100-147002122 AGATAAAATGCCTCCATACATGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941581035 2:167294749-167294771 ACAAAAATTGGCTCAATACAGGG + Intergenic
941748087 2:169108478-169108500 ACATAAAATGTATCCAACAAAGG - Intergenic
941813110 2:169773975-169773997 ACAAAAAAATTATCCAAACATGG + Intronic
942124198 2:172807027-172807049 AAAAAAAATGTTTCCAATGATGG - Intronic
943002811 2:182350459-182350481 ACAAAGAATGGCTACATACAAGG + Intronic
943105256 2:183538459-183538481 TCAAAAAATGGCTCCAAAGAAGG - Intergenic
943198497 2:184787754-184787776 ACAAATTATGTCTCCAATAAAGG - Intronic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
943757725 2:191574516-191574538 ACAACAAATTACTCCAAACATGG + Intergenic
943879383 2:193120262-193120284 ACAGCAAATGTCACCAAACCAGG - Intergenic
944425922 2:199582979-199583001 AAAAAAAATCACTCCAAAAATGG + Intergenic
944507999 2:200434231-200434253 ACAAAAACTGTCAGCAAAGAAGG + Intronic
945338218 2:208618020-208618042 ACTAAAAATATCTACAACCAAGG - Intronic
945373648 2:209052512-209052534 ACAAAGACTCTCTCCAACCAAGG + Intergenic
945885674 2:215373216-215373238 ACAAGAAATGCATCAAAACATGG + Intronic
946341472 2:219072012-219072034 ACAAAAAAAGTCTCAGAAGATGG + Intergenic
946503111 2:220270825-220270847 ACAATACCTGTCTCCAATCATGG + Intergenic
946980221 2:225205112-225205134 ACAAAAAATTTAGCCAGACATGG - Intergenic
947131361 2:226929460-226929482 ATAAAAAATGTCAACAAACTAGG + Intronic
947146614 2:227072856-227072878 ACAAAAAATCTCAACAAACAAGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947826829 2:233111905-233111927 ACAAAAAATTTAGCCAAACGTGG + Intronic
948203879 2:236150950-236150972 AAAAAAAAAGTCTACAAATAGGG - Intergenic
948583611 2:239004583-239004605 ATAAAAAATGACCCCAAACTGGG - Intergenic
1169241073 20:3981489-3981511 AAAAAAAGTGACTCCAAAAAAGG - Intronic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1169732613 20:8802509-8802531 AAAAAAAATGTTTCCAAAGTGGG - Intronic
1169849075 20:10031133-10031155 ACCAACTTTGTCTCCAAACATGG + Intronic
1170189044 20:13626269-13626291 ACAAAAAAAGTAGCCAAGCATGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174645627 20:52082968-52082990 ACAAAAAATGCCTTCTAAAAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175370738 20:58488450-58488472 ACAAAAACTGTCCCCATACTAGG + Intronic
1175842295 20:62036754-62036776 ACAAAAATTCTCACCAAACTAGG + Intronic
1177398877 21:20575533-20575555 CATAAAAATGTCTCAAAACATGG + Intergenic
1177775914 21:25565913-25565935 ACAAATAATGGTTCCAAGCATGG + Intergenic
1178029693 21:28510201-28510223 ACTAAAAATGTCTCCCATCGTGG + Intergenic
1178227556 21:30740792-30740814 AGAACACATGTGTCCAAACAGGG + Intergenic
1178454621 21:32736892-32736914 ACAAAAAATCTCCCCAAATTGGG + Intronic
1178641255 21:34346039-34346061 GCAGCAAATGTCTCCTAACAGGG + Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179956016 21:44739062-44739084 AGAAAAAAGGTCTTCAACCAGGG + Intergenic
1180210033 21:46290072-46290094 ACAAAAACTGTCACTAAAGATGG - Intronic
1180289231 22:10781746-10781768 ACAAAAAATTTTTCCAAATATGG - Intergenic
1180896366 22:19336596-19336618 ACTAAACATATCTACAAACAAGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182480532 22:30606135-30606157 AAAAAAAATCTCTGCAAACAGGG - Intronic
1182853842 22:33499927-33499949 ATACAAAATGTAGCCAAACATGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184811437 22:46835684-46835706 ACAAAAAATGTCTTAAATCTGGG + Intronic
1184848329 22:47102695-47102717 TCACAAGATGTCTCCAACCAGGG - Intronic
1184907986 22:47503570-47503592 ACAAAAACTGTCAACAAACTAGG + Intergenic
1184962172 22:47938674-47938696 ACAAAAAATTTAGCCAAGCATGG + Intergenic
1185286693 22:50003685-50003707 AGAAAAAATATCAGCAAACAGGG + Intronic
949295528 3:2517840-2517862 ACAAATCATGTGTTCAAACATGG + Intronic
950849239 3:16046814-16046836 ACAAAAAAGGTCAGCAAACCTGG - Intergenic
950951774 3:17007978-17008000 ATAATAAAGGTCTCCATACAAGG + Intronic
951072199 3:18343452-18343474 AGAAAAAAAATCTCTAAACAGGG - Intronic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952087483 3:29843552-29843574 ACAAAAAATGTATCGAGCCACGG + Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
954122287 3:48506406-48506428 ACAGAAAATGCCTGCACACATGG - Intergenic
955465517 3:59233031-59233053 ACAAAAATTGTGTCCTCACATGG - Intergenic
955521982 3:59783911-59783933 AGAAATAATGTCTGCAAACCAGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957137100 3:76302943-76302965 ATAATAAATTTATCCAAACATGG - Intronic
957139283 3:76332161-76332183 TCTCAAAATGTCTCCAATCATGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957656037 3:83077043-83077065 ACTAGATATTTCTCCAAACAAGG + Intergenic
958584848 3:96073770-96073792 ACAAAATATTTCTCCCAATAGGG + Intergenic
959594152 3:108110919-108110941 ACAAAATCTGTGTCAAAACAGGG - Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
959971463 3:112414446-112414468 ACAAAAAATCACTACATACATGG - Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961967561 3:130921629-130921651 ATAAAAACTCTCTACAAACAAGG - Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963208696 3:142663794-142663816 ACGAATAATGTCTACAAAAAAGG - Intronic
963749901 3:149165826-149165848 ACTCAAAAGGTCTCCCAACATGG - Intronic
963914752 3:150848722-150848744 TTAAAAAATTTCTCCAAACTGGG + Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964482149 3:157150940-157150962 ACAAAAAAGGTATGTAAACAAGG - Intronic
966283330 3:178262002-178262024 ACAAAAAAAAGCCCCAAACAAGG - Intergenic
967224843 3:187281451-187281473 AGGAAAAATGCCTCAAAACAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967750987 3:193116074-193116096 ACAAAAGATGTGTCCTCACATGG - Intergenic
967795053 3:193590937-193590959 ACAAAAAATGTCTCGGAACCAGG - Intronic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249676 4:5958794-5958816 ACAAAAAATCTTTTAAAACATGG + Exonic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
971196284 4:24473334-24473356 AAAAAAAAAATCTTCAAACAGGG - Intergenic
971262771 4:25071934-25071956 ACACAACATGGCACCAAACATGG + Intergenic
971580611 4:28334744-28334766 ACAAAAAAGGTCTCTAAGGAAGG + Intergenic
971774643 4:30946863-30946885 ACAAAAAAATTATCCAAGCATGG - Intronic
972364720 4:38363626-38363648 ACAAAATATGTCTCGAAAAAGGG - Intergenic
973228527 4:47814959-47814981 ACAAAATATGTATCCTATCAAGG + Intronic
973345327 4:49048750-49048772 AGAAGATATGTCTCCAAATATGG + Intronic
974443605 4:61950875-61950897 ACAAAACATGGCTCCAAGAATGG - Intronic
974444979 4:61968228-61968250 TCAAAAAATGTCACCAGAAAAGG - Intronic
974455504 4:62124985-62125007 ACAAATGATGTGTGCAAACATGG + Intergenic
974847716 4:67371073-67371095 ACAAAAAGTGCTTCCAAAAAAGG + Intergenic
975031945 4:69631917-69631939 ACAGAAAATATCTAGAAACATGG + Intronic
975164503 4:71162902-71162924 AAAAAGAATGTTCCCAAACATGG - Intergenic
976289969 4:83408046-83408068 AAAAAAAGTATTTCCAAACATGG + Intronic
976320006 4:83703169-83703191 ACACAAAATCTTTCAAAACATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977315089 4:95436523-95436545 TCAAAAAAAGTGCCCAAACAAGG - Intronic
977335386 4:95691911-95691933 AGAGAAAATATCTCCAAACACGG - Intergenic
977376894 4:96216967-96216989 GTAAAAAATGTCTCCAAACGTGG + Intergenic
978262511 4:106777734-106777756 ACAAAAAATAAATCCAAACATGG + Intergenic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
978422031 4:108543130-108543152 AAAAAAAATTTATCAAAACAAGG + Intergenic
978631666 4:110754165-110754187 ACAAAAAATCTCTCCCCTCATGG + Intergenic
978729105 4:112004019-112004041 ACAAAAAATGAGTGCAAATAAGG + Intergenic
979128973 4:117015467-117015489 ACAAAAAATGTTTCTAAAGGGGG + Intergenic
981207829 4:142065533-142065555 ATAAAAAATGTCTGACAACATGG + Intronic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
982659742 4:158192524-158192546 ACAAAAAATATTTCTAAACCTGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983754427 4:171317169-171317191 AAAAAAAATGTTTTTAAACAAGG + Intergenic
984006674 4:174319096-174319118 ACTAAAAATGTGGCCAAGCATGG - Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984138302 4:175969761-175969783 ACAACAAATGTATCGCAACAGGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984906067 4:184626828-184626850 ACAGAATATGTCACCAAACTGGG + Intergenic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
985632021 5:1018743-1018765 ACACAAGATGCCTCCAAGCAAGG - Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987388105 5:17349368-17349390 ACAAGAAATCTCTCCAAGAAAGG - Intergenic
987439332 5:17936702-17936724 ACAAAAACTCTCAACAAACAAGG + Intergenic
987739988 5:21895260-21895282 ACAAATAATACCTCTAAACATGG - Intronic
987746701 5:21983064-21983086 AGAAAAAGTGTTTCCAAACCAGG - Intronic
987892932 5:23905180-23905202 AAAAAAAATGTTTCCAACCGGGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989826532 5:45863442-45863464 ATAATATATGGCTCCAAACAAGG + Intergenic
990438469 5:55819735-55819757 ACAAAAAAACACTACAAACAGGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991766873 5:69992824-69992846 AGAAAAAGTGTTTCCAAACCAGG - Intergenic
991846105 5:70867901-70867923 AGAAAAAGTGTTTCCAAACCAGG - Intergenic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993341797 5:86733281-86733303 AAAAAAACTGTCAACAAACAAGG - Intergenic
993682744 5:90899701-90899723 ACTAAAAATATATTCAAACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994127847 5:96189696-96189718 ATAAAAAGTGTCTCAGAACATGG - Intergenic
994411547 5:99412647-99412669 AAAAAAAAAATCCCCAAACAGGG + Intergenic
994912311 5:105927354-105927376 ACAAAAAAAGTCATAAAACAAGG - Intergenic
994930088 5:106171485-106171507 ACAAAAGCTGTCTCCAATCCTGG - Intergenic
995415029 5:111900763-111900785 ATAAAAAAAGTCTCCTAACAAGG + Intronic
995918382 5:117279054-117279076 CCAAAAAATGTGTTAAAACATGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997909126 5:137851679-137851701 ACAAAAAAATTCACCAAGCATGG + Intergenic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999005693 5:147975023-147975045 ACAATAACTGTGTCCAAGCAAGG + Intergenic
999121832 5:149215715-149215737 GCAAAATATTTCTTCAAACAAGG + Intronic
999915412 5:156253420-156253442 TCAGAATAGGTCTCCAAACATGG + Intronic
1000098011 5:157987807-157987829 TCATAAAATGGCTCCACACAGGG + Intergenic
1000102733 5:158032189-158032211 ACTGAAAATGTCTTCAAATATGG + Intergenic
1000221854 5:159222148-159222170 TTAAAAAATGTGTCCAAACACGG + Intergenic
1000764546 5:165270638-165270660 ATAAAAAAGGTCTGCTAACATGG + Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001730183 5:173948004-173948026 ACAAAAATTGTCCCAAATCAGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1003737215 6:8890244-8890266 ACACAAAATACCTCCAAAAATGG - Intergenic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1003889173 6:10548751-10548773 AAAAAAAAGGTCTCCAAATATGG - Intronic
1004330283 6:14714757-14714779 ACAGAAAAATTCTCCAAAGAGGG - Intergenic
1004383273 6:15150488-15150510 TCAAAACATGTTTCCAAAAAAGG + Intergenic
1004390466 6:15205366-15205388 ACAAATAAATTATCCAAACATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005027555 6:21478016-21478038 ACAAAAAAAACCTCCAACCAGGG + Intergenic
1005091840 6:22064811-22064833 ACAAAAAATTTCCCCCAAAATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007048698 6:38803747-38803769 AAAAAAAAAGTCTTAAAACATGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007937581 6:45747053-45747075 ACAAAGAAGGACTCCAAACTGGG + Intergenic
1008059102 6:46978074-46978096 ACAAAAAATTTAGCCAGACATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009256303 6:61406725-61406747 GAAAAAATTGTCTCCAAAGAAGG - Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010327462 6:74581562-74581584 AGAAAAAATGGCTTCAAAGATGG + Intergenic
1010508137 6:76685841-76685863 ACAAAAAATGTGTGCATTCAAGG - Intergenic
1011471563 6:87712991-87713013 ACAAAACATGTCTCCTACAAAGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012870241 6:104664432-104664454 ACAAACTATGCATCCAAACAAGG + Intergenic
1013145186 6:107382999-107383021 ACAAAAATTAACTCAAAACAGGG + Intronic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015355058 6:132268222-132268244 ACTAAGAAAGTCTCCAAAAAAGG - Intergenic
1016176945 6:141090767-141090789 ACAAAAAATTTATGCAAACAAGG - Intergenic
1016390429 6:143569074-143569096 ACGAAACATCTCTCCAAATATGG - Intronic
1017292321 6:152753591-152753613 TCAAAGAATGTCTCCATAGATGG - Intronic
1019811451 7:3168198-3168220 ACACCAAAAGTCTTCAAACAAGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023217386 7:37878145-37878167 ATAAAAATTCTCTCCAAACTAGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024503639 7:50141634-50141656 AAAAAAAATGCCACCAAGCAAGG + Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025970659 7:66321260-66321282 ACACAAAATGTTTCCAATCAAGG + Intronic
1026003960 7:66585839-66585861 ACAATAAATATCTGCAAAGATGG - Intergenic
1026310430 7:69178965-69178987 ACAAAAAATTTAGCCAGACATGG - Intergenic
1026656886 7:72264388-72264410 ACAAAATATATCTTCAAAAAAGG + Intronic
1027239989 7:76320800-76320822 ACAAAAAAAGTACCCCAACAAGG + Intergenic
1027502847 7:78976386-78976408 ACAAAAACTCTCACCAAACCAGG + Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028736031 7:94213432-94213454 ACAAAATATTCCCCCAAACATGG + Intergenic
1028996225 7:97103429-97103451 ACAAAAGAAGTGTCAAAACAAGG - Intergenic
1029657765 7:101938415-101938437 CCAAAAACAGGCTCCAAACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030289163 7:107855283-107855305 ACAAGCACTGTCTCCCAACAAGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030653330 7:112139283-112139305 ACAAAAAATACCCCCAAAAAGGG + Intronic
1030654513 7:112151374-112151396 ACAAAAAAATACTCCAAATATGG + Intronic
1030742200 7:113123152-113123174 ACAATAAATGTCTACATAAAAGG - Intergenic
1031360264 7:120841180-120841202 ACATAATGTGTCTCCCAACATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032629312 7:133630080-133630102 ACAAAATTTGTCTGCAAACCTGG + Exonic
1032712656 7:134474289-134474311 ACAAAAAACCTCTCAAAAAATGG - Intergenic
1032773599 7:135086497-135086519 ACAAAAACTCTCACCAAATAAGG - Intronic
1033873813 7:145789733-145789755 ACAAAAAAGGTTTTAAAACAAGG - Intergenic
1034107860 7:148506254-148506276 GCAAAAACTGTATCCAAATAAGG + Intergenic
1035052669 7:156010446-156010468 ACTAATAAAGTCTCCAACCACGG + Intergenic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037279729 8:17225360-17225382 ACAAAAAATTCCTCCATACCAGG + Intergenic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1041742715 8:61174141-61174163 ACAAAAAATATCACTCAACATGG + Intronic
1041811851 8:61920314-61920336 ATGAAAAAAGTCCCCAAACAAGG - Intergenic
1042213993 8:66410750-66410772 AAAAAAAATCTCTGCAAACTAGG + Intergenic
1042493809 8:69433669-69433691 AAAAAAAATTTCTCCAATCTGGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043710250 8:83407483-83407505 AGGAAAAATGTCTCCAATTATGG - Intergenic
1044255950 8:90061445-90061467 AAAAATAATATCTGCAAACAGGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046133577 8:109997705-109997727 ACAAAAAAAGACTACAAATAGGG - Intergenic
1046181830 8:110659465-110659487 AAAAAAAATCTCACCAAACTAGG + Intergenic
1046183952 8:110689230-110689252 AAAAAAAAACTCTCCAATCAAGG + Intergenic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046568184 8:115928022-115928044 ACAAAAAATGTAAACAAGCACGG - Intergenic
1047451269 8:124967034-124967056 ATAAAAAATGTCTGAAAAGATGG - Intergenic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048823526 8:138400841-138400863 AGAAATAGTGTCTCCAAATAAGG + Intronic
1049635720 8:143687838-143687860 ACAAAAACTCTCAGCAAACAAGG - Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050247615 9:3707484-3707506 ACAAAAAAAGTAGCCAAGCATGG + Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050919000 9:11175353-11175375 AAAAAAAATGTTACCAAACATGG + Intergenic
1051632544 9:19153515-19153537 AAAAAATATGCCTCCAAATAAGG - Intergenic
1052252713 9:26418400-26418422 ACACCATATGTCTCCAAACAGGG - Intergenic
1052294959 9:26887246-26887268 ACAAAAAATTGCTACAAAGAAGG + Intronic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1052541901 9:29822396-29822418 ACAAAAAATAACTACAAAGAAGG + Intergenic
1052651101 9:31302353-31302375 ACAAACAATGTATCCAATGAAGG + Intergenic
1052848552 9:33360149-33360171 ACACAGAAGGTCTCCAAACATGG + Intronic
1053043009 9:34890678-34890700 CCAAAGAATATCTCCACACAGGG - Intergenic
1053251586 9:36578636-36578658 ATAAACAATGTTTCCATACAAGG - Intronic
1053679748 9:40477479-40477501 ATAAAATATGTCTCCCACCATGG + Intergenic
1053929741 9:43105811-43105833 ATAAAATATGTCTCCCACCATGG + Intergenic
1054283973 9:63147461-63147483 ATAAAATATGTCTCCCACCATGG - Intergenic
1054292829 9:63313015-63313037 ATAAAATATGTCTCCCACCATGG + Intergenic
1054390846 9:64617495-64617517 ATAAAATATGTCTCCCACCATGG + Intergenic
1054504874 9:65898819-65898841 ATAAAATATGTCTCCCACCATGG - Intergenic
1055330714 9:75180365-75180387 ACAAAAAAAATCTCCATAAATGG - Intergenic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1057454291 9:95193542-95193564 ACTAAAAATGTCTCTAAATGGGG + Intronic
1057871897 9:98724483-98724505 ACAAAACAGGTTTCCAAACCAGG + Intergenic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1058647638 9:107145462-107145484 AGAAAAAATGTGGCCAAACGAGG + Intergenic
1059759143 9:117321875-117321897 ACCAAAACTGGCTCCAAATATGG + Intronic
1059948032 9:119432728-119432750 AAAAAAAAAATCTCCAAACAGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060078780 9:120621039-120621061 AAAAAAAATGTTTCCAAGGAAGG + Intronic
1060233373 9:121841847-121841869 ACTAAAAATGTCTCAAATCGTGG + Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061619630 9:131803476-131803498 ACAAAGAATGGCTCCATCCAAGG - Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062714460 9:137999983-138000005 ACAAAAAATGTAACCCAAAAGGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185680528 X:1885126-1885148 AAAAAAATTGTTTCCAAACAGGG + Intergenic
1185744696 X:2563361-2563383 ACAAAAAATGTAGCCAGGCATGG - Intergenic
1185765712 X:2724352-2724374 AAAAACACTGGCTCCAAACATGG - Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187043127 X:15617702-15617724 ACAAGAAATGGCTTCAATCAAGG + Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187464938 X:19518762-19518784 ACAAAAAATGTCTTAGAACAAGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189550506 X:42087645-42087667 ACCAATCATGTCACCAAACAAGG - Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1193103705 X:77644093-77644115 ACAAAAAATTTAGCCAGACATGG - Intronic
1193180784 X:78453984-78454006 ACAAAAAAATTAGCCAAACATGG + Intergenic
1193763844 X:85500929-85500951 ATAAAAAATGTTTCCTAAAATGG - Intergenic
1193967016 X:88000310-88000332 ACAAAACAAGTCTCAAAAAAAGG - Intergenic
1194191920 X:90848167-90848189 ACTAAACATGTCTACAACCAAGG - Intergenic
1194322551 X:92468874-92468896 ACAAAATATTTCTAAAAACATGG + Intronic
1194428181 X:93765357-93765379 ACAAAAAAGCTATCCAAAGACGG - Intergenic
1194742937 X:97596827-97596849 AAAAAACATGACTCCAAACGTGG + Intronic
1195323450 X:103739562-103739584 ACACAATATTTCCCCAAACAGGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195704752 X:107730726-107730748 AAACAAAATGTCACCAATCACGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195888106 X:109662584-109662606 TCAAAAAATGACTCCAAAATGGG - Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197149229 X:123202380-123202402 ACTAAAAATGCCTTCCAACAAGG + Intronic
1198717768 X:139579043-139579065 ACAAAAACTATCAGCAAACAAGG - Intergenic
1199043930 X:143146883-143146905 ACAAAAAAATTAGCCAAACATGG - Intergenic
1199121875 X:144064288-144064310 AAAAAAATTGTCACCAAAAAAGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199181650 X:144863210-144863232 ACAAATAATGTATCCATCCACGG + Intergenic
1200538558 Y:4430602-4430624 ACTAAACATGTCTACAACCAAGG - Intergenic
1200630706 Y:5582350-5582372 ACAAAATATTTCTAAAAACATGG + Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201323508 Y:12728891-12728913 ACAAAAAATAACTACAAAAAGGG - Intronic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic