ID: 1152220671

View in Genome Browser
Species Human (GRCh38)
Location 17:79063452-79063474
Sequence TACCCACCGCTTCCCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152220671_1152220674 -2 Left 1152220671 17:79063452-79063474 CCAGCCCAGGGAAGCGGTGGGTA No data
Right 1152220674 17:79063473-79063495 TAACAGACTTCACCATGTCATGG No data
1152220671_1152220675 -1 Left 1152220671 17:79063452-79063474 CCAGCCCAGGGAAGCGGTGGGTA No data
Right 1152220675 17:79063474-79063496 AACAGACTTCACCATGTCATGGG No data
1152220671_1152220676 2 Left 1152220671 17:79063452-79063474 CCAGCCCAGGGAAGCGGTGGGTA No data
Right 1152220676 17:79063477-79063499 AGACTTCACCATGTCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152220671 Original CRISPR TACCCACCGCTTCCCTGGGC TGG (reversed) Intergenic
No off target data available for this crispr