ID: 1152221905

View in Genome Browser
Species Human (GRCh38)
Location 17:79073524-79073546
Sequence GTTCAGGGGTGCACCGGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152221905_1152221915 -2 Left 1152221905 17:79073524-79073546 CCACGTCCGGTGCACCCCTGAAC No data
Right 1152221915 17:79073545-79073567 ACACAGCAGGAGGGAACTTGGGG No data
1152221905_1152221913 -4 Left 1152221905 17:79073524-79073546 CCACGTCCGGTGCACCCCTGAAC No data
Right 1152221913 17:79073543-79073565 GAACACAGCAGGAGGGAACTTGG No data
1152221905_1152221914 -3 Left 1152221905 17:79073524-79073546 CCACGTCCGGTGCACCCCTGAAC No data
Right 1152221914 17:79073544-79073566 AACACAGCAGGAGGGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152221905 Original CRISPR GTTCAGGGGTGCACCGGACG TGG (reversed) Intergenic
No off target data available for this crispr