ID: 1152223405

View in Genome Browser
Species Human (GRCh38)
Location 17:79081707-79081729
Sequence GCCCTGTCCCTCTGGGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152223394_1152223405 28 Left 1152223394 17:79081656-79081678 CCTCTGAGATCTAGGAGGGGAAA 0: 1
1: 0
2: 3
3: 24
4: 258
Right 1152223405 17:79081707-79081729 GCCCTGTCCCTCTGGGCTCTAGG 0: 1
1: 0
2: 4
3: 48
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152223405 Original CRISPR GCCCTGTCCCTCTGGGCTCT AGG Intronic
900387339 1:2416626-2416648 GCCCTCCCCATCTTGGCTCTGGG - Intergenic
900399218 1:2466191-2466213 GCCCCCTCCCTCTGGGCCCCAGG - Intronic
900548571 1:3242118-3242140 GCCAGGCCCCTGTGGGCTCTGGG + Intronic
901513436 1:9729876-9729898 GGCCTCTCCCTCTGGGGTCTGGG + Exonic
901919387 1:12525560-12525582 GCCTTGTCCCTGGCGGCTCTGGG + Intergenic
902490619 1:16778225-16778247 GCAGGGTCCTTCTGGGCTCTAGG + Intronic
902753872 1:18536641-18536663 GCTCTGACCCCCTGGGATCTAGG + Intergenic
903006178 1:20300428-20300450 ACGGGGTCCCTCTGGGCTCTGGG - Intronic
903288739 1:22293856-22293878 GCCCTATCCCCCAGAGCTCTGGG + Intergenic
903350508 1:22713692-22713714 GCCATGTGGCTCTGGGTTCTGGG - Intronic
903557660 1:24205477-24205499 AGCCTGTCCCTCTGTGCCCTAGG + Intergenic
903958266 1:27040062-27040084 GAGCAGTCACTCTGGGCTCTGGG - Intergenic
904883280 1:33716505-33716527 AACCTGACCCTCTGGTCTCTTGG - Intronic
904948186 1:34214562-34214584 GTGCTGTGACTCTGGGCTCTGGG + Intronic
905827487 1:41037125-41037147 TCCCTGTCCCTTTTGGGTCTAGG + Intronic
905936321 1:41827107-41827129 CCCCTGGTCCCCTGGGCTCTGGG - Intronic
906293498 1:44635053-44635075 GAGCTGTACCTCAGGGCTCTTGG + Intronic
906707130 1:47903094-47903116 CTCCTGTCCCTCAGAGCTCTTGG + Intronic
907055569 1:51364575-51364597 GCCTTGAACCCCTGGGCTCTAGG + Intronic
907556944 1:55352428-55352450 GCCCTGTGACTCTGGGCTGGAGG + Intergenic
908196272 1:61748739-61748761 GCCCTGACCCCCTGGGCACAAGG + Intronic
908362360 1:63381560-63381582 GCCTTGACCTTCTGGGCTCAAGG - Intronic
910905587 1:92174271-92174293 GCCCTGACCTTCTGGGCTCAAGG + Intronic
911464349 1:98233214-98233236 CACCTCTCCCTCTGGGATCTCGG - Intergenic
912430159 1:109624620-109624642 GCCCTGTCCCCCAGGGCCCCAGG - Intronic
915097660 1:153474899-153474921 GCCCTGACCCTCCAGGCTGTTGG - Intergenic
915555097 1:156656884-156656906 GACCTGGCCCTCTGGGTTTTGGG + Intronic
916246207 1:162690804-162690826 GCGCTGGCCCTCTGAGCCCTGGG + Intronic
920387388 1:205578624-205578646 CCCCTGACCCCCTTGGCTCTTGG - Intronic
920807201 1:209246010-209246032 TCCCTGTTCCTCGGGGCTCCTGG - Intergenic
921055397 1:211538927-211538949 GCCCAGTCCCTATGGGCACTTGG - Intergenic
923529824 1:234804310-234804332 GCAGGGTCCTTCTGGGCTCTAGG - Intergenic
923663613 1:235979732-235979754 GCCCTTCCCATCTGGCCTCTTGG - Intronic
1062911419 10:1214906-1214928 GCCCTTTCCTTCCTGGCTCTGGG - Intronic
1063201741 10:3790855-3790877 GCCCTGTGCCTTTGGGCTTTCGG + Intergenic
1064282943 10:13967960-13967982 GCCCCGACCTCCTGGGCTCTGGG - Intronic
1067293572 10:44961469-44961491 GCCCTGGGCCCCTGGGGTCTGGG + Intronic
1067523771 10:47026568-47026590 GCCCTGGGCCCTTGGGCTCTGGG + Intergenic
1067825281 10:49567577-49567599 GGTTTGACCCTCTGGGCTCTTGG + Intergenic
1067919073 10:50434538-50434560 GCCCTGTCCCTTTATGCTTTGGG - Intronic
1070589266 10:77789969-77789991 GCCCTGTCCCTATGGACACAAGG + Intergenic
1070781184 10:79138236-79138258 GCTCTGACCCTGTGGGCTCCTGG - Intronic
1071526792 10:86363902-86363924 GCCGTGTCCCAGTGGGCCCTGGG + Intronic
1071601585 10:86961163-86961185 GCCCTACTCCTCTTGGCTCTGGG + Intronic
1072575965 10:96700673-96700695 GCCTTGTGCCTGTGGGCTGTTGG - Intronic
1074120178 10:110488205-110488227 GGCATGTCTCTCTGGACTCTAGG - Intergenic
1074358446 10:112806158-112806180 TCCCAGTCCCTCAGGTCTCTCGG + Intronic
1074536891 10:114334541-114334563 CTCCTGTTCCTCTTGGCTCTCGG - Intronic
1074708206 10:116154863-116154885 TCTCTGTGCCTCTGTGCTCTTGG + Intronic
1076120694 10:127934729-127934751 GCTCTGTGCCTGGGGGCTCTGGG + Intronic
1076244893 10:128939151-128939173 GTCCTGTCCCTGTGGGACCTTGG - Intergenic
1076324919 10:129613738-129613760 GTCCTGTCCCTCTGTGCCTTGGG + Intronic
1076652331 10:131998516-131998538 GCCCTGACCTCCTGGGCTCAAGG + Intergenic
1076676576 10:132150091-132150113 GCCCAGCCCCTCTGGGGTCCAGG + Intronic
1077033224 11:479633-479655 ACCCCGTCCCTCTTGGCGCTGGG - Intronic
1077401987 11:2363458-2363480 GCCCAGTCCCTCCAGCCTCTGGG + Intergenic
1077523202 11:3048609-3048631 ACCCTCTCCCTCTGGGTGCTGGG + Intronic
1077538784 11:3136753-3136775 GCCCTGTCACTCTGGGCTGTGGG - Intronic
1077601877 11:3580297-3580319 GCGCTGTCCCTGTGAGCTCCCGG - Intergenic
1077842483 11:5990780-5990802 GCACTGTCCTTCTGGTCTCTGGG + Intergenic
1078860137 11:15239187-15239209 GCCCTGTCTCTGGGGGCTCAGGG + Intronic
1079136411 11:17778251-17778273 GCTCTGTCTCTCTGCGATCTCGG - Intronic
1080283381 11:30584389-30584411 GCCCTGCCCTTCTAGGCTCACGG + Intronic
1081867450 11:46367423-46367445 TCCCAGACCCTCTGGGCTCTTGG + Intronic
1082179219 11:49098537-49098559 GCCCTTTTCCTGTGGTCTCTAGG - Intergenic
1082783808 11:57305609-57305631 TCCCTGTCTCTCTGGGGTCAAGG - Intronic
1083264845 11:61541976-61541998 CCCCTGCCCCTCAGTGCTCTAGG - Intronic
1084319800 11:68366976-68366998 GCGCTCGCACTCTGGGCTCTGGG + Intronic
1084445965 11:69203965-69203987 GCCTTTTCTCTCTGGGCTCCCGG + Intergenic
1084450611 11:69234589-69234611 GCCCTGGACCTCTGGCCTCTAGG + Intergenic
1084557003 11:69881328-69881350 GCCATGGCCCTCTTGGCTGTGGG + Intergenic
1084731338 11:71075579-71075601 ATCCTGCACCTCTGGGCTCTAGG - Intronic
1084814974 11:71640394-71640416 GCGCTGTCCCTGTGAGCTCCCGG + Intergenic
1085515594 11:77110014-77110036 TCCCTGTCACTCTGTGCGCTTGG + Intronic
1085679127 11:78554200-78554222 GCCTTGGCTATCTGGGCTCTTGG + Intronic
1086686068 11:89734383-89734405 GCCCTTTTCCTGTGGTCTCTAGG + Intergenic
1088796874 11:113272521-113272543 GCCCAGTTCCTCTGGGACCTGGG + Intronic
1089305242 11:117522334-117522356 TCCCTTTCCCTCTGGACTGTGGG + Intronic
1089329600 11:117680349-117680371 GCCATGTCCCTCAGGGCTACAGG - Intronic
1089655431 11:119943738-119943760 GCACTGGCCCTGTGGCCTCTGGG + Intergenic
1090400833 11:126447293-126447315 GCCCTGGAAATCTGGGCTCTTGG + Intronic
1091104182 11:132902972-132902994 GCAAAGTTCCTCTGGGCTCTGGG - Intronic
1091302314 11:134515370-134515392 GCCTTCTCCCTCAGGGCCCTTGG - Intergenic
1091779355 12:3204270-3204292 GCCCCGTGCCTCTGAGCGCTTGG + Intronic
1092125513 12:6072432-6072454 GAGCTGTCCCTCTGGGGTCAAGG + Exonic
1092428022 12:8389640-8389662 GCACTGTCCCTGTGAGCTCCCGG - Intergenic
1092860001 12:12712181-12712203 GCCCTGTCCTCCTGGGCTCAGGG + Intergenic
1094497059 12:30995109-30995131 GCCTTAGCCCTTTGGGCTCTTGG - Exonic
1096197373 12:49657319-49657341 ACCCTGTCCCTCTTGGCTGTTGG - Intronic
1096479055 12:51925974-51925996 GCCCTGACCCTCTGTGATCAAGG - Intergenic
1102144210 12:110642681-110642703 GCCCTGACCTCCTGGGCTCAAGG + Intronic
1102693670 12:114781390-114781412 GACCTGTCCCTCTGGCCTGGGGG - Intergenic
1102797424 12:115700816-115700838 TCCCTGGCGCTCTGGCCTCTGGG - Intergenic
1102938226 12:116915171-116915193 GCCTTAGCCCTGTGGGCTCTGGG - Intronic
1103363231 12:120366369-120366391 GCCAAGTCCCACTGGGCTCCAGG + Intronic
1103475921 12:121218591-121218613 GCCTTGTCCCGGTGAGCTCTGGG + Intronic
1103598435 12:122038601-122038623 CCCCTTTCCCTCTGGGGACTGGG + Intronic
1103844341 12:123891085-123891107 GCCCGTTCCTTCTGAGCTCTGGG + Intronic
1103895123 12:124268029-124268051 GCCCAGCCCCTCTGGGCACCAGG + Intronic
1104161313 12:126183476-126183498 GTCCTGTGGTTCTGGGCTCTGGG + Intergenic
1104905388 12:132210631-132210653 GCCCCGTCCTCCTGGGCTGTGGG + Intronic
1104915725 12:132263495-132263517 CCCCCCTCCCCCTGGGCTCTGGG - Intronic
1105750542 13:23419169-23419191 GGCCCGTCCCTCTGGGGTCATGG + Intronic
1106370384 13:29127022-29127044 GCCCTCTCCGTCTGGGCTCCTGG + Intronic
1106792116 13:33166417-33166439 GGCCTGTCCCTTTGGGCTCATGG + Intronic
1112285089 13:98096932-98096954 AGCCAGTCCCACTGGGCTCTCGG + Intergenic
1113906937 13:113823717-113823739 CCCCGGTGCCTCTGGGCTCCGGG - Intronic
1114079870 14:19194587-19194609 GTCCTCTCCGTCTGGGGTCTTGG + Intergenic
1114581804 14:23767721-23767743 GCCCTATTCATCAGGGCTCTGGG - Intergenic
1117620541 14:57581835-57581857 TCCCTTTCCCTCCGGGTTCTAGG - Intronic
1121784939 14:96650189-96650211 TCCCTCTCCCTCTGTGCCCTGGG + Intergenic
1121981467 14:98458043-98458065 GCCCTGGCCCTCTGGGCCTGGGG - Intergenic
1122653368 14:103239829-103239851 GCCTTGAACCTCTGGGCTCAAGG + Intergenic
1122783371 14:104153145-104153167 GCCCTTGCCTTCTGGGCTTTCGG + Intronic
1122917902 14:104867224-104867246 GCCCTGTCCCTCTGCCCTGGTGG + Intronic
1123092012 14:105746135-105746157 GCCCTGGCTCTCTGAGCTCCAGG + Intergenic
1123472938 15:20568335-20568357 GCCCTTTCCCCCTGTGCTTTGGG + Intergenic
1123645067 15:22432018-22432040 GCCCTTTCCCCCTGTGCTTTGGG - Intergenic
1123733241 15:23163327-23163349 GCCCTTTCCCCCTGTGCTTTGGG + Intergenic
1123751374 15:23360702-23360724 GCCCTTTCCCCCTGTGCTTTGGG + Intronic
1124283744 15:28384620-28384642 GCCCTTTCCCCCTGTGCTTTGGG + Intronic
1124298953 15:28526993-28527015 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1124372071 15:29109691-29109713 CCCCTGTCCCTCTTCGTTCTGGG - Intronic
1124521243 15:30407996-30408018 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1124563832 15:30797709-30797731 GCCCTTTCCCCCTGTGCTTTGGG + Intergenic
1124806286 15:32886690-32886712 GCCCATTCCCTCTTGTCTCTTGG - Intronic
1124959428 15:34383532-34383554 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1124976054 15:34529753-34529775 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1125044253 15:35228509-35228531 GCCTTGACCCTCTGGGCTCAAGG + Intronic
1125721696 15:41848184-41848206 GCCATGTCATTCTAGGCTCTTGG + Exonic
1125762409 15:42105544-42105566 GCCTTGTCCCTCTGTCCTCCTGG - Intergenic
1125891082 15:43267687-43267709 ACCCTGTCTTTCTGTGCTCTGGG + Intergenic
1126660194 15:51025681-51025703 GCCCTCCACCTTTGGGCTCTGGG - Intergenic
1127773284 15:62247116-62247138 GCCCTTTCCCCCTGTGCTTTGGG - Intergenic
1127774599 15:62255128-62255150 GCCCTTTCCCCCTGTGCTTTGGG - Intergenic
1128315125 15:66655157-66655179 GGCCGGTCCCTCTGGGCTCCTGG + Intronic
1128547330 15:68577305-68577327 GCTCTGTCACTGTGTGCTCTTGG + Intergenic
1129108650 15:73324923-73324945 GCCCTGTCCCCCAGGGCCCAGGG + Intronic
1129162216 15:73753158-73753180 GCCCTGCCCCGCCGGGCTCCCGG + Intergenic
1129754438 15:78088616-78088638 TCCCTGTACCTCTGGGCCCCAGG + Intronic
1129761599 15:78131842-78131864 GCCCTGTCCCTCTGGGGAGAAGG + Intronic
1132041074 15:98525007-98525029 GACCTGTCCCTGTGGCCTCTTGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132605952 16:793806-793828 GCCCTGACCCTCTGGGGTTAGGG - Intronic
1132688433 16:1171865-1171887 GCCCTGACCCTCTCGTCTGTGGG - Intronic
1132980812 16:2737958-2737980 GCCCTGTCCCACCGAGCTCAAGG + Intergenic
1133278231 16:4650674-4650696 CCCCTGGCCATCTGGCCTCTAGG - Intronic
1133331373 16:4976700-4976722 GCCCTGCAGCTGTGGGCTCTGGG + Intronic
1133370214 16:5240727-5240749 GCGCTGTCCCTGTGAGCTCCCGG + Intergenic
1133612043 16:7442457-7442479 GCCCTGTGTCTCAGGGCTCAAGG + Intronic
1133947128 16:10357942-10357964 GCCCTCTCCTTCTGGAATCTGGG + Intronic
1136078997 16:27839182-27839204 GCCCTGTCCCTGTGGAATATAGG - Intronic
1136376513 16:29868728-29868750 GCCTTGCCCCTCTGAGCTTTGGG + Intergenic
1136689728 16:32020505-32020527 GCTCTGTCACTCTGAGCTCAGGG + Intergenic
1136790315 16:32964063-32964085 GCTCTGTCACTCTGAGCTCAGGG + Intergenic
1136879498 16:33889865-33889887 GCTCTGTCACTCTGAGCTCAGGG - Intergenic
1137446762 16:48536653-48536675 GCCCTAAGCCTCTGGGCTTTTGG + Intergenic
1137595762 16:49722489-49722511 GCAGGGACCCTCTGGGCTCTAGG - Intronic
1137732160 16:50697161-50697183 GTCCTGTGCCACTGGGCTTTTGG + Exonic
1137758396 16:50920454-50920476 ACGCTTTCCCTCTCGGCTCTGGG - Intergenic
1138590083 16:57995067-57995089 TCCCTGCCCCTCAGGGCCCTTGG + Exonic
1139922927 16:70471023-70471045 GCCCTGTCCAGCTGGGTCCTGGG + Exonic
1140401731 16:74677432-74677454 GCCTTGACCTCCTGGGCTCTAGG + Intronic
1140481324 16:75264392-75264414 GCCCTGCTCCTGTGGGCACTGGG - Exonic
1140639201 16:76952084-76952106 GTCATGTCCCTCTGGACACTTGG - Intergenic
1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG + Intronic
1141829409 16:86501325-86501347 CACCTTCCCCTCTGGGCTCTGGG - Intergenic
1141950470 16:87336073-87336095 GCCCTGTCCCGGTGGGTGCTGGG - Intronic
1203092519 16_KI270728v1_random:1225514-1225536 GCTCTGTCACTCTGAGCTCAGGG + Intergenic
1142782866 17:2194951-2194973 GCTCCCTCCCTCTTGGCTCTGGG + Intronic
1143116469 17:4584405-4584427 GCACCGTCCCGCTGGGCTCCAGG + Intronic
1143236880 17:5409951-5409973 GCCCTGGCTCTCTGGGCTCCAGG - Intronic
1143524178 17:7462822-7462844 GGCACGTCCCGCTGGGCTCTCGG + Exonic
1143782511 17:9236700-9236722 GCTCTATCCCTCTGGACTCCCGG + Intronic
1145266990 17:21384489-21384511 CCCCAGACCCTCTGAGCTCTGGG - Intronic
1146787820 17:35733925-35733947 TGCCAGGCCCTCTGGGCTCTAGG + Intronic
1147152583 17:38526654-38526676 GCTCTGTCACTCTGAGCTCAGGG + Intergenic
1147402754 17:40190936-40190958 GCCCTGAGCCACTGTGCTCTGGG - Intronic
1147988450 17:44319598-44319620 TGCCTGTCCCTCTGGGGCCTGGG - Intergenic
1148023147 17:44566846-44566868 GCAGTGTCTCTCTGGCCTCTGGG - Intergenic
1148063867 17:44854608-44854630 GCCCGTTCCATCTGGGCTTTTGG - Exonic
1148450818 17:47777036-47777058 GCCCTGTCCCCCAGGACACTGGG + Intergenic
1148622135 17:49042757-49042779 GCCTTGACCCCCTGGGCTCAAGG + Intronic
1148645596 17:49218165-49218187 GCCCTGCCCCTGTGGGCACCGGG + Intronic
1148700161 17:49582285-49582307 GACCTGGCCCTTTGGGGTCTGGG - Intronic
1149496722 17:57122987-57123009 GTACTGCCCCTCTGGTCTCTGGG + Intergenic
1149570317 17:57667618-57667640 GCCCAGTCCCTCAGGGCCCTTGG + Intronic
1149598142 17:57875982-57876004 GCCCTGCCTCTCTGTGCCCTAGG + Intronic
1150633788 17:66898656-66898678 GCCATGTCACTCTGGGCTACTGG + Intergenic
1151335664 17:73438197-73438219 GCCCTGCCTCTCAGGCCTCTGGG - Intronic
1151362592 17:73597526-73597548 GTCCTGTCTCTCAGGGCTCATGG + Intronic
1151654297 17:75488625-75488647 GCCCTGTCCCAGTGGACTCTGGG + Intronic
1151702535 17:75750969-75750991 GCCCTGGCTCGCTGGGCACTAGG - Exonic
1152121975 17:78424339-78424361 ACCCCGTCCCGCTGGGCTCAAGG + Exonic
1152223405 17:79081707-79081729 GCCCTGTCCCTCTGGGCTCTAGG + Intronic
1152770710 17:82166831-82166853 GCCTTGACCCCCTGGGCTCAAGG - Intronic
1155158524 18:23177669-23177691 GTCCTGTCCTGTTGGGCTCTGGG + Intronic
1155469691 18:26178133-26178155 GCCTTGGCCTTCTGGGCTCAAGG - Intronic
1157194813 18:45612230-45612252 GCTCTTTCCCACTGAGCTCTGGG - Intronic
1157265028 18:46211289-46211311 GCCCTGACCCCCTGGGCTCAAGG + Intronic
1157362999 18:47035608-47035630 GCCCTGACCCTCTTAGCTCTTGG + Exonic
1159005173 18:63004670-63004692 GGCCTCTCCCTCCTGGCTCTGGG - Intergenic
1159458380 18:68692848-68692870 ACCCAGGCCCTCTGGGTTCTAGG + Intronic
1159596020 18:70383613-70383635 GCCCTGGCCATCTAGGCTCGAGG - Intergenic
1159603685 18:70452778-70452800 GCCCCGCCCCTGTGGTCTCTGGG + Intergenic
1160130860 18:76223699-76223721 GCCATGTCCCTGTGGCCTCCAGG + Intergenic
1160341477 18:78092865-78092887 GCCATGTGACTTTGGGCTCTAGG + Intergenic
1160725157 19:614602-614624 TCCCTGGCTCTCTGGACTCTAGG - Intronic
1160776536 19:859206-859228 TCTCTGTCCCTGTGGCCTCTGGG - Intergenic
1160794152 19:936459-936481 GCCTTGTCCTCCTGGGCTCAAGG - Intronic
1161021000 19:2011471-2011493 GCCCAGCCCCTCTGGGCTCTGGG + Intronic
1161153353 19:2720827-2720849 GCACTGTGCCTCTGCGCCCTCGG - Intronic
1161263478 19:3351129-3351151 GCCTTGTCCTCCTGGGCTCAAGG - Intergenic
1161321776 19:3644725-3644747 GCTCGGTCTCTCTGGGCCCTGGG + Intronic
1161468419 19:4444728-4444750 ACCCTGTCCCTCTGGCCACAGGG + Intronic
1161826058 19:6566538-6566560 GCCCCTTCCCTCTAGGCTCAGGG + Intergenic
1162847019 19:13400814-13400836 GCCATGGCCCCCTGGGTTCTAGG - Intronic
1163033967 19:14561164-14561186 GCCCGGTCTCCCTGGGCTCTGGG + Intronic
1163697813 19:18772801-18772823 GCACTGGCTCTCTGAGCTCTCGG + Intronic
1163716127 19:18873362-18873384 GCTCTGTCTCTCTGGCCTCCTGG - Intronic
1165063402 19:33215880-33215902 GCCCTGTTCGTCTGGGTCCTGGG - Exonic
1165163103 19:33829826-33829848 GCCTTGACCTTCTGGGCTCAAGG - Intergenic
1165718847 19:38064323-38064345 CCCTTGTTCCTCTGGGCTCAGGG - Intronic
1165870007 19:38964961-38964983 GTCCTTTCCCACTGGCCTCTTGG - Intronic
1166745104 19:45138182-45138204 GTCCTGTCCTCCTGGGCTCCCGG + Intronic
1166881574 19:45933604-45933626 CCCCTTTCCCCCAGGGCTCTGGG - Intergenic
1166976337 19:46607213-46607235 GCCCTGAGCCTCTGGGCCCTGGG - Intronic
1167756840 19:51417917-51417939 GGGCTCTCCCTCTGGGCCCTGGG + Intergenic
1168357340 19:55710255-55710277 GGCCTGTCCCTATGGGGACTGGG + Intronic
1168715009 19:58521832-58521854 GCCGAGTCCCTCTGTCCTCTGGG - Intronic
925085218 2:1102390-1102412 GCCCTGCCCTTCTGGGATTTTGG + Intronic
926336752 2:11869006-11869028 GCCCTTTCCCTCGGTGCTGTGGG - Intergenic
927917464 2:26946183-26946205 GCCCTGCAGCTCTGGGGTCTTGG - Intronic
928335599 2:30395380-30395402 GCTCTGTCCCTCTGGGTTCAGGG - Intergenic
931348685 2:61470392-61470414 GCCCGGGCGCTCTGGGCTCTCGG - Intronic
932126965 2:69153304-69153326 GCTCTGTCTCTCTGTGGTCTTGG - Intronic
933639829 2:84747516-84747538 GCCCTGTCCCCATGGCCTTTTGG + Intronic
936047942 2:109201333-109201355 GCCATGTACCTGTGGGTTCTAGG - Intronic
937336360 2:121064717-121064739 GCCCAGCCGCTCTGGGCTTTGGG + Intergenic
938140226 2:128789407-128789429 GACTTGTCCCCCTGGGCTCTGGG - Intergenic
938382354 2:130843738-130843760 GTTCTCTCCCTCTGGGCTGTCGG + Intronic
938663663 2:133511877-133511899 GCCCTGTGCCCCTGGCCACTGGG - Intronic
939535187 2:143418825-143418847 GCTCTTTCCCTCTGCACTCTTGG - Intronic
940755074 2:157672633-157672655 GATCTTTCACTCTGGGCTCTGGG - Intergenic
945985823 2:216352649-216352671 GCCCAGCCCCTCTGTGCTTTTGG + Intronic
946246432 2:218390455-218390477 TCCCTGACTCTCTGGGATCTGGG + Intronic
946432393 2:219632591-219632613 GCCCTGCCCCTCGGGGCTCACGG - Intronic
946472139 2:219971069-219971091 GCCCTGACCTCCTGGGCTCAAGG + Intergenic
947499893 2:230664286-230664308 GCTCTGCCCCTCTCAGCTCTGGG - Intergenic
948515184 2:238499073-238499095 GCCCCTTCCCACTGGGCTCTGGG + Intergenic
948559173 2:238839327-238839349 CCCCTGTCACTCTGGGCTGCTGG - Intergenic
948728185 2:239947321-239947343 GCTCTGTCCCTGGGGGCTCTGGG - Intronic
1169559699 20:6786845-6786867 GTCCTTTCCCTCTTGGTTCTGGG - Intergenic
1169772652 20:9218546-9218568 GATCTGTTCCTCTGGGCTGTTGG + Intronic
1169789651 20:9395887-9395909 GCCTTGAACCTCTGGGCTCAAGG - Intronic
1170122619 20:12926962-12926984 GTCCAGTAGCTCTGGGCTCTGGG + Intergenic
1170549129 20:17461013-17461035 TGCCTGTTCCACTGGGCTCTCGG + Intronic
1172578160 20:36025415-36025437 GCCTTGACCTTCTGGGCTCAAGG + Intronic
1172605396 20:36210282-36210304 GGCTTGTCTCTCTGGGGTCTGGG + Intronic
1172916996 20:38450668-38450690 GCCCTGTGGCTCTGGGGACTTGG + Intergenic
1173226963 20:41167796-41167818 GCTTTCTACCTCTGGGCTCTGGG + Intronic
1173236626 20:41252152-41252174 GCCCTGTGCCTCTGGTCTTTTGG - Intronic
1173812931 20:45967552-45967574 TCCCTCTTCCTCTTGGCTCTTGG + Exonic
1173888123 20:46479703-46479725 GCCCAGTCTTTCTGGGATCTAGG + Intergenic
1174458970 20:50669583-50669605 GCACTGACCCTCTGGGGGCTTGG + Intronic
1174508167 20:51030523-51030545 GCCCTGTGCTTCTGGGATCCAGG - Intergenic
1175161580 20:57011788-57011810 GGCCAGTCCCCCTGGGCTCCAGG + Intergenic
1175519107 20:59588399-59588421 GCCCCGTCCCCCTGGTCCCTGGG + Intronic
1175693200 20:61081272-61081294 TTCCTGTCCCACTGGACTCTTGG + Intergenic
1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG + Intronic
1175861068 20:62150733-62150755 GCCTTGTCCTCCTGGGCTCAAGG + Intronic
1176096116 20:63345371-63345393 GCCCCGCCCCTCTGGGCCCTTGG + Exonic
1176385885 21:6138391-6138413 GCCCTGTGCCTCTGGGGGCCGGG + Intergenic
1177792573 21:25735805-25735827 GCCCGGTCCCCCCGGGCTCCAGG - Intronic
1178942270 21:36915875-36915897 GGCCTGTCCCTGGGGTCTCTGGG + Intronic
1179737588 21:43399861-43399883 GCCCTGTGCCTCTGGGGGCCGGG - Intergenic
1179921246 21:44508846-44508868 CACCTGTCCCTCTGGGGCCTCGG + Intronic
1180128321 21:45806806-45806828 GCCCAGTGCCTCAGTGCTCTGGG - Intronic
1180230665 21:46425116-46425138 GCGCTGAGCCTCTGGGCTCTGGG + Intronic
1180355809 22:11838559-11838581 GCCGTGACCTCCTGGGCTCTGGG - Intergenic
1180500900 22:15928113-15928135 GTCCTCTCCGTCTGGGGTCTTGG - Intergenic
1180619381 22:17150025-17150047 GCCTTGACCCACTGGGCTCAAGG + Intronic
1180836850 22:18934235-18934257 TCCCTCACCCTCTGGGCTGTGGG - Intronic
1180972459 22:19822598-19822620 GGCCTTTCCCACTGGGCTCTGGG + Intronic
1181053227 22:20247397-20247419 GCCCTGACCCTCTGTGGTGTGGG - Intronic
1181427839 22:22855788-22855810 GCCCTGTCCCTCCTGCCTTTTGG - Intronic
1181600097 22:23946284-23946306 AGTCTGTCCCTCCGGGCTCTGGG - Intergenic
1181608407 22:23995029-23995051 AGTCTGTCCCTCTGGGCTCTGGG + Intergenic
1183579100 22:38712697-38712719 ACCTTGTCCATCAGGGCTCTCGG - Intronic
1183682796 22:39343470-39343492 GCCCCAACCTTCTGGGCTCTAGG - Intergenic
1183747884 22:39702702-39702724 GCCCTCTCACTCTTGCCTCTTGG - Intergenic
1183962189 22:41418194-41418216 TCCCTGTCCCTCTGGGCCTCGGG + Intergenic
1184072062 22:42152602-42152624 GCCCTGTCCAGCTGGGCACAGGG + Intergenic
1184171772 22:42764325-42764347 GCCCTGTGTCTCTGGGGTGTAGG - Intergenic
1184424865 22:44403419-44403441 TACCAGTCCCTCTGAGCTCTGGG - Intergenic
1203286943 22_KI270734v1_random:159534-159556 TCCCTCACCCTCTGGGCTGTGGG - Intergenic
950459972 3:13115379-13115401 GCTGTGTCCCTCTGGGGTCTGGG + Intergenic
950577049 3:13838225-13838247 CCCACGTCCCTCTGGGCCCTGGG - Intronic
951447196 3:22796535-22796557 CTCCTGTCACTCTGGGTTCTAGG + Intergenic
952818680 3:37467419-37467441 TCCCTGTCAGTCTTGGCTCTAGG + Intronic
953537265 3:43786022-43786044 ATCCTGTCACTCTGGGCTCTGGG - Intergenic
953854377 3:46489550-46489572 GCCCTGTGCCCCTGGGCTGGTGG + Intergenic
954328298 3:49875600-49875622 GCCATGACCCTGTGGGCTCACGG - Intergenic
955411666 3:58659428-58659450 TCTCTGTCCATCTTGGCTCTGGG - Intronic
957072720 3:75579331-75579353 GCGCTGTCCCTGTGAGCTCCCGG - Intergenic
958196246 3:90245524-90245546 GCCCTGTAGCTCTGGGCTCTTGG + Intergenic
958419436 3:93914166-93914188 GCCCTATAGTTCTGGGCTCTCGG + Intronic
960902166 3:122564214-122564236 GTCCGGTGCCTCTGGGCCCTCGG - Intronic
961281353 3:125767420-125767442 GCGCTGTCCCTGTGAGCTCCCGG + Intergenic
961666165 3:128494118-128494140 GCACTTTCCCTCTGGGCTCAAGG - Intergenic
961748824 3:129083434-129083456 ACCCTGTGCATCTGGGCTCCAGG - Intergenic
961777745 3:129301778-129301800 GCCCTGTCACCCTGTGCTCAGGG + Intronic
961873016 3:130002159-130002181 GCGCTGTCCCTGTGAGCTCCCGG - Intergenic
964771596 3:160229428-160229450 GCCTTGACCTTCTGGGCTCAAGG + Intronic
966373086 3:179268642-179268664 GCACTGTACCTCTGGTCTCCTGG + Intergenic
967089350 3:186122029-186122051 GTCCTGTTCCTCTGAGCTTTGGG - Intronic
967109462 3:186280823-186280845 GCCCTGTCCCTCTTCCCACTGGG - Intronic
968548658 4:1211253-1211275 GGCCTGTCCCTCTGCCCACTGGG - Intergenic
968556128 4:1247424-1247446 GCCACCTCCCTCTGGGGTCTGGG - Intronic
968886397 4:3336147-3336169 GTCCTGTCCCTCGGTGGTCTGGG + Intronic
969016327 4:4106641-4106663 GCGCTGTCCCTATGAGCTCCCGG - Intergenic
969296224 4:6271799-6271821 GCCACTTCCCTCTGGGCTATCGG + Intronic
969737628 4:9001683-9001705 GCGCTGTCCCTGTGAGCTCCCGG + Intergenic
969796826 4:9533244-9533266 GCGCTGTCCCTGTGAGCTCCCGG + Intergenic
971327338 4:25655309-25655331 GCCCTGGGAGTCTGGGCTCTAGG - Intronic
972162645 4:36244723-36244745 CCCCTGTCGCTCTGGGCTCCAGG - Intergenic
979351685 4:119650824-119650846 TCCCTTTCCCCCTGGTCTCTGGG + Intergenic
979888530 4:126061889-126061911 AACCTGTACCTCTGGCCTCTTGG - Intergenic
980533698 4:134087808-134087830 GCCTTTTCCCTCTGGCCTCTCGG + Intergenic
980818502 4:137980803-137980825 GGAATGTCCCTCTGGGCTCAAGG + Intergenic
984741055 4:183163386-183163408 CCCCTGTGGCTATGGGCTCTGGG - Intronic
984904038 4:184610452-184610474 GCCTTGTCCCTCTGTAGTCTGGG + Intergenic
984980218 4:185273353-185273375 GCCTTGACCTTCTGGGCTCAAGG + Intronic
985520310 5:371055-371077 CCCCTGGCCCTCAGGCCTCTGGG - Intronic
985565260 5:612258-612280 GCCCCGTCCCGCCAGGCTCTCGG + Exonic
986589694 5:9355655-9355677 GCCCAGCCCCTCTGAGCTCCAGG - Intronic
987438518 5:17927451-17927473 CCCCAGTCCCTCTGAACTCTTGG + Intergenic
987836158 5:23165384-23165406 GCCTTGACTCTCTGGGCTCAAGG - Intergenic
990416608 5:55593052-55593074 GCCTTGTCCTTATGAGCTCTTGG - Intergenic
990504591 5:56431835-56431857 GCCTTGACCTTCTGGGCTCAAGG + Intergenic
990998917 5:61763090-61763112 GCCATTTCCTTCTGGCCTCTCGG + Intergenic
991489220 5:67166421-67166443 GCCCTTTCCCTCTGGCCTCAGGG - Exonic
994185026 5:96807549-96807571 TCCCTGTCCCTCCGGGCGCGTGG - Intronic
996815213 5:127566635-127566657 ACCATGTTCCTCTGGGCTCTGGG - Intergenic
997976511 5:138444629-138444651 GCCAAGTCACTTTGGGCTCTGGG - Intronic
998353617 5:141516656-141516678 GCCCTTTCCTTCTGGCCTCCAGG + Exonic
999284727 5:150387605-150387627 TCCCTTTCCCTCTGGGCTTGTGG + Intronic
999693769 5:154170617-154170639 GCCCTGTCTCTCAGGACTCCAGG - Intronic
1001216980 5:169865455-169865477 GCCCCGGCTCTCTGGGTTCTGGG - Intronic
1001217876 5:169872793-169872815 GCCCTGGCTCCCTGGGATCTTGG + Intronic
1001481380 5:172091493-172091515 GCCCACTGCCTCTGGCCTCTTGG + Intronic
1002210405 5:177595607-177595629 GCCCTCTCTCTCTGGCCTCTGGG + Exonic
1002210621 5:177596813-177596835 CCCCCCTCCCTCTGGCCTCTGGG + Intergenic
1002938507 6:1695720-1695742 GCCCTGTCACTCTGAGGTCCTGG + Intronic
1004325468 6:14670445-14670467 GACCTGTCCCTGTGGGTTGTTGG - Intergenic
1004703703 6:18103039-18103061 GCCTTCTCCTTCTGTGCTCTTGG - Intergenic
1004991753 6:21146358-21146380 ACCCTTTCCTCCTGGGCTCTGGG - Intronic
1005623082 6:27637850-27637872 GCCTTGACCTTCTGGGCTCGAGG - Intergenic
1005925812 6:30444565-30444587 GTCCTCTCTCTCCGGGCTCTTGG - Intergenic
1006135823 6:31896311-31896333 GGGCTGTCCCTCTGGGCTCGTGG + Exonic
1006227708 6:32554411-32554433 ACCCGGTCTCCCTGGGCTCTAGG - Intronic
1006576836 6:35052812-35052834 TCCCTGTGCCTCTGGGCTGCTGG + Intronic
1007227454 6:40325124-40325146 TCACTGTCCCACTTGGCTCTTGG - Intergenic
1007242539 6:40437418-40437440 GCTCTGTGCCTCTGAGCTCCAGG - Intronic
1010244677 6:73652192-73652214 GCCCTGTCCTTCCTGGCTTTAGG - Intronic
1011549195 6:88513892-88513914 GGCTTCACCCTCTGGGCTCTTGG + Intergenic
1013288170 6:108698275-108698297 GCCCTGTCCCCCTCAGCCCTCGG + Intergenic
1013446789 6:110237212-110237234 GCCCTCTCCCTCTTTGCTGTAGG + Intronic
1015638397 6:135303839-135303861 GCCCTATTCCTCAGGGATCTGGG - Intronic
1015974606 6:138776734-138776756 GCCTTGAACCTCTGGGCTCAAGG + Intronic
1017769248 6:157632178-157632200 GCCAGGTCCCTCTGTGCTGTGGG - Intronic
1017969998 6:159303981-159304003 CCCCTGACCATCTGGGCCCTGGG + Intergenic
1018390909 6:163341416-163341438 GCCCTGCCCCCCTGTGCTCCAGG + Intergenic
1019491594 7:1316324-1316346 GTCCTCTCCCTGTGGGCCCTGGG + Intergenic
1019531105 7:1503964-1503986 GCCCCGTCCCTCGCGGCTCCCGG + Exonic
1019542374 7:1557332-1557354 GCCCTGTTGCTCAGGGCTGTGGG - Intronic
1019569634 7:1704857-1704879 GCCCTGTCCACCAGGGCTCGAGG + Intronic
1019622987 7:2001661-2001683 GCACTGTCCCACTGGGGACTCGG + Intronic
1020548171 7:9561249-9561271 GCCTTGACCTTCTGGGCTCAAGG + Intergenic
1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG + Intronic
1022251177 7:28610118-28610140 GTTCTGTCCTTCTGGGCCCTGGG + Intronic
1023010114 7:35918477-35918499 TCCCTGTCTCTCTGGGCACCAGG + Intergenic
1024080711 7:45853102-45853124 TCCCTGTCTCTCTGGGCACCAGG - Intergenic
1025123744 7:56328578-56328600 TCCCTGTCTCTCTGGGCACCAGG + Intergenic
1026766673 7:73164485-73164507 GCCCCATCCCTCTGGGCTGGAGG + Intergenic
1027043151 7:74974184-74974206 GCCCCATCCCTCTGGGCTGGAGG + Intronic
1027080496 7:75228175-75228197 GCCCCATCCCTCTGGGCTGGAGG - Intergenic
1028168280 7:87564456-87564478 GCCCAGTGTCTCTGGGCGCTGGG + Intronic
1029151595 7:98484194-98484216 TCCCTGTCTCTCAGGGGTCTAGG + Intergenic
1029389700 7:100266791-100266813 GCCCCATCCCTCTGGGCTGAAGG - Intronic
1029600204 7:101558872-101558894 GCCTGGTCCCTCTGGGCCCTGGG + Exonic
1030336351 7:108331316-108331338 GCCTTGACCTTCTGGGCTCAAGG - Intronic
1031766254 7:125781348-125781370 GCCCTGTCCTGCTGGGCTTCAGG - Intergenic
1033170947 7:139083771-139083793 GGCCTTTACCTCTGGGCCCTGGG + Exonic
1033335513 7:140448818-140448840 GCCTTGACCCCCTGGGCTCAGGG - Intergenic
1034354442 7:150441948-150441970 GTCCTGGCCCACTGGCCTCTTGG + Intergenic
1034395460 7:150821079-150821101 GCCCTGTAACTCTGGGGCCTGGG - Intergenic
1034469472 7:151247788-151247810 CCCCTGTCCCTTCGGTCTCTAGG + Intronic
1034562234 7:151888355-151888377 TCCCTTTCTCTCTGGACTCTTGG + Intergenic
1035293531 7:157854831-157854853 GCCATGTCCCTCGGGGCCTTGGG + Intronic
1035792215 8:2317366-2317388 GCCCTGTTCCTCCGGGTTCCAGG - Intergenic
1035800590 8:2404339-2404361 GCCCTGTTCCTCCGGGTTCCAGG + Intergenic
1036242722 8:7092943-7092965 GCGCTGTCCCTATGAGCTCCCGG + Intergenic
1036258082 8:7221085-7221107 GCGCTGTCCCTGTGAGCTCCCGG - Intergenic
1036310132 8:7679681-7679703 GCGCTGTCCCTGTGAGCTCCCGG - Intergenic
1036359404 8:8066421-8066443 GCGCTGTCCCTGTGAGCTCCTGG + Intergenic
1036774508 8:11601113-11601135 ACCCTGGGCCTCTGGGCTCAAGG - Intergenic
1036830007 8:12014201-12014223 GCGCTGTCCCTGTGAGCTCCCGG - Intronic
1036891552 8:12600531-12600553 GCGCTGTCCCTGTGAGCTCCCGG - Intergenic
1036899095 8:12658495-12658517 GCGCTGTCCCTATGAGCTCCCGG - Intergenic
1038818400 8:30930246-30930268 GCCCTGACCTCCTGGGCTCAAGG + Intergenic
1039886067 8:41654402-41654424 GCCCAGCCCCTGTGGCCTCTTGG - Intronic
1041465346 8:58152700-58152722 GCCCTTGGCCTCAGGGCTCTGGG + Intronic
1043577701 8:81676909-81676931 GCCTTGACCTTCTGGGCTCAAGG - Intronic
1047457794 8:125031940-125031962 GCCCTGTTCCTCTGCACTCTTGG - Intronic
1048542060 8:135351353-135351375 GCCCTCTCTCTCTGGGCTTCAGG - Intergenic
1049090722 8:140511690-140511712 GCCCCGCCCCGCCGGGCTCTGGG + Intronic
1049684496 8:143933895-143933917 GGGCTGTCCCCCTGGGCTCCTGG - Intronic
1049695572 8:143982899-143982921 GCCCTGTCTCTCTGGCCTCATGG - Intronic
1049700405 8:144008655-144008677 GTCCTGCCCTTCTGAGCTCTTGG - Intronic
1049800796 8:144516680-144516702 GCCCTGTACCTGGGGGCTTTGGG + Exonic
1049845744 8:144800084-144800106 GCCCTGTTCCTCGGGGACCTGGG - Intronic
1050545374 9:6704686-6704708 GCCCTGTCCCTCAGCCCTCAGGG + Intergenic
1051837972 9:21362380-21362402 GCCATGTCTCTCTGGGCACTGGG + Intergenic
1051845755 9:21449413-21449435 GCCATGTCTCTCTGGGCACCAGG - Intergenic
1052995138 9:34547875-34547897 GTCCTGTGGCTCTGGGCTGTGGG + Intergenic
1054905751 9:70412824-70412846 GCCCTCTCCCCCGGAGCTCTGGG - Intronic
1054913136 9:70472422-70472444 TCCCTGTCCTCCTGGGCTCCTGG - Intergenic
1055287028 9:74739680-74739702 GACTTGTCCCTCTGGGCTATGGG + Intronic
1057353654 9:94319047-94319069 GCCCTGTCCCTGAGGGTCCTGGG + Exonic
1057654097 9:96938545-96938567 GCCCTGTCCCTGAGGGTCCTGGG - Exonic
1059623646 9:116036610-116036632 GCCATTTCCCTCTGGGGGCTGGG - Intergenic
1059669175 9:116477074-116477096 GCCCTGTCCCTCTGGAACCCTGG + Intronic
1060194373 9:121613947-121613969 GCCCTGTCCCTCATGGCTCTAGG + Intronic
1060881108 9:127118716-127118738 GCCCAGTCCTGCTGGGCTGTGGG + Intronic
1061052579 9:128204988-128205010 GCCCTCTCCCTCTCACCTCTAGG - Intronic
1061127629 9:128686896-128686918 GCCTTGACCTCCTGGGCTCTGGG - Intronic
1061186072 9:129054373-129054395 GCCTTGACCTTCTGGGCTCAAGG - Intronic
1061375681 9:130223032-130223054 GCCCTGGCACTCTGGGCTTTGGG - Intronic
1061725828 9:132581407-132581429 GTCCTGTCTCTCTGGCCTCTTGG - Intergenic
1061857132 9:133448556-133448578 AGCCTGTCCCTTGGGGCTCTGGG + Intronic
1061862736 9:133476236-133476258 TCCCTGTCCCTCTACGCCCTTGG - Exonic
1061877980 9:133554457-133554479 GCCCTGGCTCTCAGCGCTCTCGG - Exonic
1061958434 9:133975696-133975718 GCACTGTGCCTCTGTGTTCTTGG - Intronic
1062444657 9:136588542-136588564 GCCCTGCCCCTCTGGGTTTGAGG - Intergenic
1062568614 9:137174285-137174307 GCCCAGTCCCTCTGGCCACCAGG + Intergenic
1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG + Intronic
1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG + Intergenic
1188739823 X:33764300-33764322 CCCCAGTGCCTCTGGGCTCCTGG + Intergenic
1189555796 X:42144112-42144134 GCCCTGTTCCGGTGGGCTGTGGG + Intergenic
1190001970 X:46697787-46697809 GCTCTGTTCCTCCGGGCTCACGG - Intronic
1192962293 X:76143823-76143845 TCCCCATCCCTCTGGGCTCCTGG + Intergenic
1192963240 X:76151264-76151286 TCCCCATCCCTCTGGGCTCCTGG - Intergenic
1193371428 X:80701968-80701990 GGCCAGTCCCTCTGTGCTCATGG - Intronic
1194309737 X:92290982-92291004 GCACTGACCTTCTGGGCTCAAGG + Intronic
1194459886 X:94153176-94153198 GCCTTGAACTTCTGGGCTCTAGG + Intergenic
1195848041 X:109249358-109249380 TCCTTATCCCTCTGGGCCCTAGG - Intergenic
1197735295 X:129846002-129846024 GCTCTGTCCCTCCCTGCTCTGGG + Intergenic
1198511377 X:137355033-137355055 GCCCTTTCCAGCTGGGCACTGGG + Intergenic
1200045778 X:153400589-153400611 GCCCTGCCTCTGTGGGCTATGGG - Intergenic
1200618030 Y:5405259-5405281 GCACTGACCTTCTGGGCTCAAGG + Intronic