ID: 1152223588

View in Genome Browser
Species Human (GRCh38)
Location 17:79082433-79082455
Sequence CTGCGGCTCAGGGGCGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152223580_1152223588 13 Left 1152223580 17:79082397-79082419 CCTGCGGGGACGCACAGGGGCCT 0: 1
1: 0
2: 0
3: 3
4: 132
Right 1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 282
1152223575_1152223588 26 Left 1152223575 17:79082384-79082406 CCCGTGAGGGAAGCCTGCGGGGA 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 282
1152223582_1152223588 -7 Left 1152223582 17:79082417-79082439 CCTGCAGCGCCTCTCACTGCGGC 0: 1
1: 0
2: 0
3: 6
4: 165
Right 1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 282
1152223573_1152223588 27 Left 1152223573 17:79082383-79082405 CCCCGTGAGGGAAGCCTGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 282
1152223576_1152223588 25 Left 1152223576 17:79082385-79082407 CCGTGAGGGAAGCCTGCGGGGAC 0: 1
1: 0
2: 2
3: 22
4: 143
Right 1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152223588 Original CRISPR CTGCGGCTCAGGGGCGAGGA CGG Intronic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900485601 1:2921226-2921248 GTGCGGCTCAGGGCAGAGGTGGG - Intergenic
901752121 1:11416730-11416752 CTGCGGCTGACGGGCCAGCAGGG - Intergenic
903673178 1:25048272-25048294 CGGAGACTCAGGGGCCAGGAAGG - Intergenic
904181484 1:28669199-28669221 ACTCGGCTCAGGGGCCAGGAGGG + Intronic
904344028 1:29856477-29856499 CTGGGGCTCAGAGGCGGAGATGG - Intergenic
905398332 1:37682873-37682895 CTGAGGCTCAGGGAAGTGGATGG - Exonic
905880407 1:41459729-41459751 CTGGGGCTCAGAGGCAAGGATGG - Intergenic
906787727 1:48630511-48630533 CTGTGGCTGATGGGAGAGGAAGG - Intronic
910108354 1:83655520-83655542 AAGAGGCTGAGGGGCGAGGATGG - Intergenic
911335173 1:96573444-96573466 CTGAGGCTCAGTGACTAGGAAGG - Intergenic
913323357 1:117605980-117606002 GGGCGGCTCAGGGGCGGGGACGG + Exonic
914803058 1:150974475-150974497 CCGCGGGGCCGGGGCGAGGAGGG - Intronic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
916567543 1:165994338-165994360 CTGCTGCTCAGGGCAGATGACGG + Intergenic
920174990 1:204095100-204095122 GTACGGCTCAGGGCCGTGGAAGG - Intronic
920333259 1:205227722-205227744 CTGCAGTTCAGGGGCGGGGGCGG - Intergenic
920666143 1:207964049-207964071 CGGCGGCCCAGGGGAGAGGGAGG + Intergenic
923044474 1:230345434-230345456 CTGCAGATGAGGGGAGAGGAGGG + Intronic
924330325 1:242935044-242935066 CTTCCACTCAGGGGTGAGGAAGG - Intergenic
924422713 1:243924430-243924452 CTGCAGCTCACAGGAGAGGAAGG - Intergenic
924947137 1:248854153-248854175 CTGGGGCACAGGGGCCAGGAAGG - Intronic
1063661194 10:8036016-8036038 CTGCGCCCCGGGGGCGCGGAAGG + Intergenic
1064619584 10:17201631-17201653 CGGCGGCTGAGGCGCGGGGATGG - Exonic
1065122453 10:22542928-22542950 CTTGGGCTCAGGGTCCAGGAAGG + Intronic
1067405516 10:46019940-46019962 CTGCGCCACAGGGAGGAGGAGGG - Intronic
1067743575 10:48915304-48915326 CTGAGGCTCAGAAGTGAGGAAGG + Intronic
1072667927 10:97407879-97407901 CTGAGGCTCAGGGAAGAGTAAGG - Intronic
1072987027 10:100149823-100149845 CTGTGGCAGAGGGGCAAGGAGGG - Intergenic
1074145812 10:110716316-110716338 CTGAGGCTCTGGGGTGAGGGTGG - Intronic
1074187148 10:111107137-111107159 CTGCCTCACAGGGCCGAGGAAGG + Intergenic
1076110257 10:127854803-127854825 CTGAGGCTCAGCGTAGAGGAGGG + Intergenic
1076615854 10:131754291-131754313 CTGCAGCGCAGGGGAGAGGTGGG + Intergenic
1076615905 10:131754501-131754523 CTGCAGCACAGGGGAGAGGTGGG + Intergenic
1076615915 10:131754543-131754565 CTGCAGCGCAGGGGAGAGGTGGG + Intergenic
1076615925 10:131754585-131754607 CTGCAGCGCAGGGGAGAGGTGGG + Intergenic
1076615981 10:131754795-131754817 CTGCGTCACAGGGGAGAGGTGGG + Intergenic
1076615993 10:131754837-131754859 CTGCGTCACAGGGGAGAGGTGGG + Intergenic
1076722558 10:132399056-132399078 CTCAGGCTCAGGGGAGATGAGGG - Intronic
1077018475 11:407183-407205 CGGCGGCGCAGGGGCGGGGGCGG + Intronic
1077043697 11:535360-535382 CTGCCGCCTGGGGGCGAGGAGGG + Intronic
1077365413 11:2159572-2159594 CTGTGGCTCAGGGTCCAGTATGG - Intronic
1077532203 11:3102659-3102681 CTGAGGCTCAGGTGAAAGGATGG - Intronic
1080606711 11:33869875-33869897 CGGCGGCCTAGGGGCGGGGAGGG + Exonic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081643107 11:44771022-44771044 CTGGGGTTCAGGGGTGAGGGTGG + Intronic
1082183795 11:49154370-49154392 CTGTGGCCCAGGTTCGAGGAGGG - Exonic
1083048596 11:59757145-59757167 CTGCTGCTCACGGGGTAGGAGGG + Intronic
1086112675 11:83216928-83216950 CTGCTGGTTAGGGGCGAAGAAGG + Intronic
1086120901 11:83303780-83303802 CTTCTGCTCAGGGGAAAGGAGGG + Intergenic
1086682564 11:89690982-89691004 CTGTGGCCCAGGTTCGAGGAGGG + Intergenic
1086993485 11:93330797-93330819 GTGAGGGTCAGGGGCGAGGCGGG - Intronic
1088250994 11:107860762-107860784 CTGCGGCTCAGGGTCAGGGTGGG - Intronic
1089292201 11:117444112-117444134 CCGGGGCTCAGAGGAGAGGATGG + Intronic
1089540956 11:119188682-119188704 CTGCTGCCCCGGGGCGAGGCGGG - Exonic
1091636528 12:2201249-2201271 CTGCGGCTAAGTTGCGGGGAAGG - Intronic
1091837397 12:3595353-3595375 CTGCAGCCCAGGGGCAGGGAGGG - Intergenic
1093711367 12:22333797-22333819 CTGGGGATCAGGGGTGGGGAAGG + Intronic
1097193984 12:57233781-57233803 CTGCGGCCCAAGGGCCTGGATGG + Exonic
1097195392 12:57240041-57240063 CTGCGGCTGTGGGACGTGGAGGG + Intronic
1097277562 12:57823774-57823796 CTAGGGCTCTGGGGCGAGGGAGG - Intronic
1097777758 12:63668298-63668320 CTCCGGCTCCCGGGCGAGGGAGG + Exonic
1102781908 12:115572830-115572852 CTGCGGCACGGGGAAGAGGAGGG - Intergenic
1103534736 12:121626755-121626777 CTGCGGCTCGGGGGCGGGGCGGG - Exonic
1103944707 12:124519548-124519570 CCGGGGCGCAGGGGCGAGGCGGG + Intronic
1103984903 12:124760667-124760689 CTGGGGCTCAGGGGCCAGAACGG + Intergenic
1104645281 12:130493030-130493052 CTGGGGCTCAGGCAGGAGGATGG + Intronic
1105596826 13:21846857-21846879 CTGCTGCTCTGGGGAGGGGAGGG + Intergenic
1112207328 13:97337588-97337610 CTGGGGCTCAGAGGAGAGGTTGG - Intronic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113789729 13:113021992-113022014 CAGCTGCCCAGGGGAGAGGATGG - Intronic
1114674506 14:24431376-24431398 CTGGAGCTCAGGAGCGAGCAAGG + Intronic
1115548459 14:34484118-34484140 CTGAAGCTCAGGGGCTAGCACGG - Intergenic
1117352552 14:54895825-54895847 CTGTAGCTCATGGGCTAGGAGGG - Intronic
1120509801 14:85399372-85399394 GTGGGGCTCTGGGGAGAGGAGGG + Intergenic
1121325741 14:93018668-93018690 CTGGGGCTCTTGGGTGAGGAAGG + Intronic
1121357852 14:93230609-93230631 GGGCGGCTCAGGTGAGAGGAGGG + Intergenic
1122097216 14:99380909-99380931 CTGCGGCTCAGGTGCTGGCATGG - Intergenic
1122410552 14:101523621-101523643 CTGAGGCTCAGGGATGAGTAGGG - Intergenic
1123067693 14:105626758-105626780 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123071712 14:105645483-105645505 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123091376 14:105743759-105743781 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123097147 14:105772100-105772122 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1124983350 15:34583549-34583571 CGGCGGCTGCGGGGCGAGGACGG - Intronic
1125444243 15:39736606-39736628 CTGTGGCCCACGGGGGAGGAGGG - Intronic
1125598225 15:40900919-40900941 CTGCGGCTCTGCGCCGAGCATGG + Exonic
1125760917 15:42094806-42094828 CTGAGGCTGAGGGCAGAGGATGG + Intergenic
1126949595 15:53866597-53866619 CTGCGGGTCAGGGGCAAGCTGGG - Intergenic
1127328414 15:57916842-57916864 CCGCGGCTCAGGGATGATGATGG - Intergenic
1127721303 15:61702704-61702726 CTGCACCTCTGGGGCCAGGATGG - Intergenic
1128016975 15:64356183-64356205 CTGCGACTCCGGGACGAGGGCGG - Exonic
1128744532 15:70104073-70104095 CTGTGGCTCAGAGGGGAGGAAGG + Intergenic
1129896151 15:79107543-79107565 CTGCAAGTCAGGGGTGAGGAGGG - Intergenic
1132460932 16:54150-54172 CTGCGGCCCAAGGCTGAGGAAGG + Intronic
1132463874 16:68685-68707 ATGAGGCTGAGGGACGAGGAGGG + Intronic
1132671399 16:1103518-1103540 CTGCAGGTCAGGGGCGGGGCTGG + Intergenic
1136135634 16:28255404-28255426 GTCTGGCTCAGGGGCCAGGAGGG + Intergenic
1136620847 16:31427706-31427728 CTGCGGCTCTGTGGGGAGGGCGG - Intergenic
1137720429 16:50624621-50624643 CTGGGGCGCAGGTGCGAGGAAGG + Intronic
1138318079 16:56087512-56087534 CTGCAGCTCAGGGGAGAGTCAGG + Intergenic
1141033881 16:80611744-80611766 CTGCCTCACAGGGGCGTGGACGG + Intronic
1141574412 16:84954862-84954884 CTGCCTCTCAGGGGAGAGGCTGG + Intergenic
1141695113 16:85615406-85615428 CTGCGGGCCGGGTGCGAGGATGG + Intronic
1141750928 16:85957374-85957396 CTGAGGCTCAGAGGGGTGGAGGG + Intergenic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142378762 16:89720612-89720634 CCGCGGTTCCCGGGCGAGGACGG - Intronic
1142485682 17:246429-246451 CTGCGGCTCAGAGAAGAGGAGGG - Intronic
1142967973 17:3592678-3592700 CTGAGGCCCAGAGACGAGGAGGG - Intronic
1143614625 17:8042506-8042528 CTGAGGCCCAGGGGCAGGGAAGG - Intronic
1144870047 17:18363627-18363649 CTGCGGCGCAGCGGCGGGCAGGG + Intergenic
1146807160 17:35873848-35873870 CTGTGGCTCAGGGGAGTTGAGGG + Intronic
1147228947 17:39003186-39003208 CTGTGGCTCGAGGGGGAGGAGGG - Intergenic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1149661869 17:58338296-58338318 CTGCGGCTCTGGGGAGGGGGAGG + Intergenic
1150120190 17:62594727-62594749 CAGCAGCTCAGGGGCAAGGTGGG + Intronic
1150682843 17:67297083-67297105 CTGCGTCTCATGGGCTTGGAGGG - Intergenic
1151696950 17:75722601-75722623 CTGCCTCTCTGGGGCGAGGAAGG + Intronic
1151828625 17:76537333-76537355 CAGCGGCTCCGGGCAGAGGAGGG - Intronic
1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG + Intronic
1152475349 17:80514207-80514229 CTGCGGTTCCTGGGAGAGGAGGG - Intergenic
1152578757 17:81156855-81156877 CTGGCGATCAGGGCCGAGGAGGG - Intronic
1153719281 18:7885110-7885132 CTGGGGTTCAGGGCCAAGGATGG - Intronic
1158648537 18:59267801-59267823 CGCCGGCTCTAGGGCGAGGAAGG - Exonic
1158887305 18:61840425-61840447 CTGTGGCACAGGGCAGAGGATGG + Intronic
1160230465 18:77044584-77044606 CTGCGTCCCAGGTGCGAGGAGGG - Intronic
1160698271 19:494855-494877 CTGAGGCCCAGGGGCGGGGCTGG - Intronic
1160698297 19:494933-494955 CTGAGGCCCAGGGGCGGGGCTGG - Intronic
1161512413 19:4679098-4679120 CAGCGCCTCAGCGGTGAGGAGGG - Intronic
1161643362 19:5437285-5437307 CTGCGGATGAAGGGTGAGGAGGG + Intergenic
1162312234 19:9914137-9914159 CCGCGGCTCAGGCTCGAAGAGGG - Intronic
1164638950 19:29811437-29811459 CGGCGTCTCGGGGGCGGGGAGGG + Intergenic
1165050663 19:33139403-33139425 CTGGGACTCATGGGAGAGGACGG + Intronic
1165246256 19:34500138-34500160 CTGCAGCTGAGCGGGGAGGAGGG + Exonic
1165924930 19:39320908-39320930 CTGCGGCTCGGGAGGGAGGGCGG - Intergenic
1166014885 19:39972192-39972214 CTCAGGCTCAGGGCCCAGGAAGG - Exonic
1166532917 19:43553252-43553274 CTGGGTCTCAGGGTGGAGGAAGG - Intronic
1167257966 19:48442577-48442599 CTGCGGGTCCGGGGACAGGACGG - Intronic
1167661816 19:50799727-50799749 CTGCTGCTGGGGGGCGGGGAGGG - Intronic
1168243079 19:55096863-55096885 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168243087 19:55096893-55096915 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168243189 19:55097345-55097367 CTGCGGGGAAGGGGCGAAGACGG - Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
926744702 2:16141408-16141430 CTGAGGCTCAGGGAGGTGGAGGG - Intergenic
927130209 2:20052135-20052157 TTCCGCCACAGGGGCGAGGATGG - Intergenic
927476796 2:23419931-23419953 CTGTGGCTCAGTGGGGAGAAGGG - Intronic
927503296 2:23596404-23596426 CTGCATCCCAGGGGAGAGGAAGG + Intronic
928328292 2:30337372-30337394 CTGCAGCTCAGGGGCACTGAGGG - Intergenic
930762290 2:55049986-55050008 CTGCCGCTCCGGGGCGACGGGGG + Exonic
932058051 2:68467108-68467130 CTGCGGCTCCAGGCCGCGGAGGG + Intronic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
934575928 2:95401652-95401674 CAGCGGGTCTGGGGAGAGGATGG - Intergenic
942462630 2:176178708-176178730 CTGTGGCTCAGGGGCGGGTGTGG - Intergenic
946334134 2:219026229-219026251 CTGCAGCACAAGGGCAAGGAGGG - Intronic
946392644 2:219425862-219425884 CTGCGGCCCTGGGGTGGGGATGG + Intronic
946405578 2:219490363-219490385 CACCGGCTCAGAGGAGAGGAGGG - Intronic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
947670058 2:231930166-231930188 CTGCAGCCCTGGGGCCAGGAGGG - Intergenic
948674479 2:239588940-239588962 CTGAGACTCAGGTGGGAGGAGGG - Intergenic
948774543 2:240277022-240277044 CTGCTGCTCAGGGTTGGGGAAGG - Intergenic
948899500 2:240949253-240949275 CTGCTCCTCATGGGCGAGGGTGG - Intronic
949014748 2:241702643-241702665 CTGCGGCGCGGAGGCGGGGAGGG + Intronic
1168960890 20:1868905-1868927 CTGCTGTTCAGGGGTGTGGAGGG - Intergenic
1168965451 20:1895422-1895444 CCGCGGCTGCGGAGCGAGGAGGG - Exonic
1169216046 20:3795545-3795567 CCGCGGCTGGGGGTCGAGGAGGG - Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1170897233 20:20426560-20426582 CTTCTGCTTAGGGGTGAGGAAGG + Intronic
1171173610 20:23035502-23035524 CTGCCCCCCGGGGGCGAGGAAGG + Exonic
1172370997 20:34391106-34391128 CTGGCGCTCAGGGGAGAGGATGG + Intronic
1172705457 20:36879167-36879189 CTGGTGCTCAGGGACCAGGACGG + Exonic
1174053794 20:47785059-47785081 CCGCGGGTCAGGGGCGCGGCGGG + Intronic
1174610997 20:51798890-51798912 CTTGGGCTCTGGGGCGAGGCAGG + Intronic
1175312233 20:58019905-58019927 CTGAGGCTCAGAGGGGTGGAAGG - Intergenic
1175905973 20:62379641-62379663 CTGAGGCTCAGGGAGGAGAAGGG + Intergenic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1176143209 20:63554089-63554111 CTGCGGCCCGGGGGCGGGGCGGG - Exonic
1181824376 22:25502598-25502620 CAGAGGCTCAGGTGGGAGGATGG - Intergenic
1182016843 22:27047558-27047580 CTGAGGCTCAGGGAGGATGAGGG - Intergenic
1182446060 22:30390306-30390328 CTGCTGCTTTGGGGTGAGGAGGG + Intronic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183732690 22:39627567-39627589 CTGCTGAAGAGGGGCGAGGAAGG + Intronic
1183770607 22:39922457-39922479 CTGAGGCACAGGGTCAAGGAAGG + Intronic
1184387026 22:44182179-44182201 CTGAGGCCCTGGGGCCAGGAAGG + Intronic
1184667395 22:45996280-45996302 CTGAGTCTGAGAGGCGAGGAGGG + Intergenic
1184684917 22:46091906-46091928 CTGAGGCTCAGAGCCGGGGAGGG - Intronic
1184688829 22:46108377-46108399 CTGGTGCTCAGGGAGGAGGAGGG + Intronic
1185083491 22:48723048-48723070 CTGGGGCTCAGGGGACAGGCTGG - Intronic
949518651 3:4829860-4829882 CTGAGGCTCAGGGGGAGGGAGGG - Intronic
950190162 3:10970976-10970998 CTGAGGCTCAGGGAGGAGCAGGG + Intergenic
952365494 3:32671274-32671296 CTGTGTCTCAGGGGATAGGAAGG + Intergenic
952925482 3:38316606-38316628 CTCCGGCAGAGGGGCGGGGATGG - Intronic
953462789 3:43095051-43095073 CTGCTGAGCAGGGGCAAGGAAGG - Intronic
954231530 3:49221578-49221600 CTGCTGGTTAGGGGCGAAGAAGG + Intronic
954747836 3:52797033-52797055 CTGGGGCCGAGGGCCGAGGAAGG + Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955513189 3:59701315-59701337 CTGGGGCTCAGGTGCGAGGTAGG - Intergenic
957445830 3:80311944-80311966 CTGCTGATTAGGGGCGAAGAAGG - Intergenic
957810077 3:85210644-85210666 CCGAGGCTCAGGTGGGAGGATGG - Intronic
957916295 3:86692317-86692339 CTGCTGGTTAGGGGCGAAGAAGG + Intergenic
958017933 3:87964451-87964473 TTGTGGCTCAGGGAGGAGGAGGG - Intergenic
960586338 3:119323846-119323868 CTGCGACTGAGATGCGAGGAGGG - Intronic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
964223612 3:154372053-154372075 CTGCTGATGAGGGGCGAAGAAGG - Intronic
964614192 3:158644660-158644682 TCGCGGCTCTGGGGCGCGGAAGG + Exonic
967904079 3:194486718-194486740 CTGCGGCTCAGGGTGAGGGAAGG + Intronic
968051245 3:195656443-195656465 CTGCGGCTGAGGGGCTGGTACGG + Intergenic
969659383 4:8517685-8517707 CTGTGGCTCAGGGGAGGGTAGGG + Intergenic
971202563 4:24524727-24524749 CTGTGGCTCAGGGCTGAGAAGGG - Intronic
973770119 4:54198552-54198574 AAGGGGCTCAGGGGTGAGGAAGG + Intronic
975440454 4:74404431-74404453 CAGCAGCTCAGGGGCAAGGCAGG - Intergenic
976114460 4:81712036-81712058 CTGCGGCTCAGGGCAGAAGGTGG - Intronic
984064219 4:175028246-175028268 TTGCGGCTCAGGGGCCATCATGG - Intergenic
984200200 4:176710263-176710285 CTTCTGCTCAGGGCTGAGGAAGG + Intronic
985718224 5:1474760-1474782 CGATGGCTCAGGGGAGAGGAGGG + Intronic
985806385 5:2047239-2047261 CTGCAGCACAGGGGCTAGCAGGG - Intergenic
985886781 5:2686304-2686326 CCGGTGCTCAGGGGCCAGGAAGG - Intergenic
989173642 5:38498441-38498463 CTGGAGCTCAGGGGAGAGGTTGG - Intronic
991921108 5:71657854-71657876 CTGCAGCTCAGGGGAGAGCTGGG - Exonic
992416023 5:76552036-76552058 TTCAGGCCCAGGGGCGAGGAAGG - Intronic
992554011 5:77885621-77885643 CTGTGGCTCAGGACCTAGGAGGG - Intergenic
994535765 5:101027252-101027274 CTGGAGCTCTGGGGCCAGGATGG + Intergenic
995903328 5:117094308-117094330 CTGCCGCTCACGCGCCAGGAAGG + Intergenic
996329404 5:122312244-122312266 CGGCGGCTCAGGAGCGCGAAGGG - Exonic
997232659 5:132255806-132255828 CAGAGACTCAGGGGCCAGGAAGG + Intronic
997304977 5:132830319-132830341 GCGCGGCTCAGGGGCGCGGCTGG - Intronic
997976997 5:138446513-138446535 CTGAGGCTCAGAGCCTAGGATGG - Exonic
999016105 5:148107204-148107226 CTGAGACTCAGGGGCGATCATGG - Intronic
1003175899 6:3751980-3752002 CTGCGGCTCCGGGGCCGCGAGGG - Exonic
1004260630 6:14104520-14104542 CTGGGGCTCAGGAGCAAGGTGGG - Intergenic
1005165739 6:22918273-22918295 CTGGAGCTCAGGGGTAAGGAAGG - Intergenic
1005622317 6:27631336-27631358 CTGCCGCTCCGGCGCGAGGCCGG + Intergenic
1006659817 6:35631407-35631429 CTGGGGCTCAGGGTCCAGGAAGG + Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006719721 6:36142460-36142482 CTGCAGCCCAGGGGGGATGATGG - Intronic
1006778671 6:36616929-36616951 CTGAGGCCCAGGGAGGAGGAGGG + Intergenic
1007116203 6:39345082-39345104 CAGAGGCACAGGGGTGAGGATGG - Intronic
1011249868 6:85359762-85359784 CTGGGACTCAGGGAGGAGGATGG + Intergenic
1011633806 6:89352506-89352528 CTGGGGCCCCTGGGCGAGGAGGG - Intronic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1013759159 6:113496321-113496343 CTGCAGGTCAGGGGTGATGAAGG + Intergenic
1014203126 6:118626015-118626037 CTGCTGGTTAGGGGCGACGATGG - Intronic
1017964743 6:159254393-159254415 TTGGGGCTCAGAGGAGAGGATGG - Intronic
1018911325 6:168102021-168102043 CTGGGGCACAGTGGCGGGGAGGG + Intergenic
1019358367 7:592557-592579 CGGGGGCTGAGGGGCGGGGAGGG + Intronic
1019471488 7:1223837-1223859 CTACTGCTCATGGGAGAGGAAGG - Intergenic
1019475264 7:1241348-1241370 CTGCGACTCCGGGGCGGGGGTGG + Intergenic
1019729028 7:2620192-2620214 CTGAGGCTGAGGGGTGAAGAAGG - Intergenic
1019768708 7:2870151-2870173 CTACAGCTCAGAGGCGAGGCGGG + Intergenic
1023867335 7:44244458-44244480 CTGCTGGTCAGGGACAAGGAAGG - Intronic
1023995403 7:45156533-45156555 CTACGGCTCAGAGGAGTGGAGGG + Intergenic
1026737596 7:72959057-72959079 CTGCTGCGCAAGGGTGAGGACGG + Intergenic
1026737959 7:72960815-72960837 CTGCCGCGCAAGGGTGAGGAGGG + Intronic
1026788629 7:73317856-73317878 CTGCTGCGCAAGGGTGAGGAGGG + Intronic
1026788992 7:73319610-73319632 CTGCCGCGCAAGGGTGAGGAGGG + Intronic
1027105775 7:75404253-75404275 CTGCCGCGCAAGGGTGAGGAGGG - Intronic
1027106137 7:75406011-75406033 CTGCTGCGCAAGGGTGAGGACGG - Intronic
1029487427 7:100852262-100852284 CAGCGGGTGAGGGGCGAGGCTGG + Intronic
1032193165 7:129775810-129775832 CGGAGGCTCAGGAGCGAGGGAGG + Intergenic
1033112497 7:138593678-138593700 CTGAGTCTCAGGGGATAGGAAGG + Intergenic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033476982 7:141701595-141701617 CTGGGACTCAGAGGAGAGGAGGG + Intronic
1034413965 7:150955442-150955464 CTGCGGCCCAGGGCCCAGAAAGG - Intronic
1035171485 7:157019622-157019644 CCCTGGCTCAGGGGCGGGGAAGG + Intergenic
1035253689 7:157613132-157613154 CTGCGGCTGAGGCGGGAGGCGGG - Intronic
1035965849 8:4190935-4190957 CTGCGGCTCAGTGGAGAGTGGGG + Intronic
1036686240 8:10913625-10913647 CTGCAGCTCAGGGATGGGGAGGG + Intronic
1036815777 8:11902047-11902069 CCGAGGCTCAGGTGGGAGGATGG - Intergenic
1038774931 8:30520455-30520477 CTGATGCTCAGGGGCAGGGAAGG + Intronic
1039503002 8:38031459-38031481 CTGGGGCTCCGGGGCTGGGAGGG - Intronic
1040844486 8:51822696-51822718 CTGGAGCTCAGGGGCAAGGTCGG + Intronic
1041210490 8:55545552-55545574 TTGCGGCTCAGGGGGGATCATGG + Intergenic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1043888500 8:85630389-85630411 CAGAGGCTCAGGTGGGAGGACGG + Intergenic
1045649617 8:104329738-104329760 CTGCGGGTCAGGGGCTGGGTGGG + Intergenic
1046944888 8:119965257-119965279 CTGCAGCCCAGGGAGGAGGAAGG + Exonic
1049569747 8:143363751-143363773 CTCCAGCTCAGGGGCCAGGCTGG - Intergenic
1049657452 8:143805083-143805105 CTGGGGCCCAGGGCCGGGGAGGG - Intronic
1058415035 9:104778552-104778574 CTGAAGCTCAGGGGCAATGATGG - Intergenic
1060429889 9:123541862-123541884 CTGCGGTTCAGGGAGGAGGGAGG + Intronic
1061062028 9:128255271-128255293 CTGGAGCTCAGGGGAGGGGAAGG + Intergenic
1061866283 9:133493296-133493318 CTGCTGCGGAGGGGAGAGGAAGG - Intergenic
1061961276 9:133990537-133990559 CTGGGGCTCAGGGCAGAGGCAGG - Intronic
1062028739 9:134352483-134352505 CTGCTGGGCAGGGGCGAGGCAGG - Intronic
1186267004 X:7843444-7843466 CTCCGGTTTAGGGACGAGGATGG - Intronic
1186324693 X:8465691-8465713 CTCCGGTTTAGGGACGAGGATGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1189315590 X:40053876-40053898 CTGTGGCTCAGGGGTGAGCATGG - Exonic
1189407100 X:40735304-40735326 CGGCGGCTCCCGGGGGAGGAGGG + Exonic
1190432270 X:50389723-50389745 CTGAGGCGTAGGGGCCAGGAAGG - Intronic
1190938124 X:55014856-55014878 CGGCTGCTCAAGGGAGAGGAGGG - Exonic
1192214650 X:69150135-69150157 CTGCAGCTCCGGGGGCAGGAAGG + Intergenic
1192224931 X:69221628-69221650 CTGCAGCTCTGGGGGCAGGATGG - Intergenic
1192502660 X:71664009-71664031 CTGCAGCCCAGTGGCGAGGTGGG + Intergenic
1192509862 X:71715377-71715399 CTGCAGCCCAGTGGCGAGGTGGG + Intronic
1192516835 X:71766176-71766198 CTGCAGCCCAGTGGCGAGGTGGG - Intronic
1195615095 X:106905836-106905858 CTGCTGCTCAGGGGAGTGAAGGG - Intronic
1196763635 X:119223188-119223210 CTGCGGCTGGAGGGCGAGGCGGG + Intergenic
1199673055 X:150162489-150162511 CTGGGGCTCAGGGCAGAGGGAGG + Intergenic
1201227688 Y:11834179-11834201 CTTCCACTCAGGGGTGAGGAAGG - Intergenic