ID: 1152223608

View in Genome Browser
Species Human (GRCh38)
Location 17:79082520-79082542
Sequence GGTCACACCAGCACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152223608 Original CRISPR GGTCACACCAGCACAGAGGA AGG Intronic
900192728 1:1358328-1358350 GGTCCCACCAGGGAAGAGGACGG - Intronic
900564307 1:3324848-3324870 TGTCACATCAGCACAAGGGAGGG - Intronic
900805248 1:4763292-4763314 GGTCACAACAACACAGTGAAGGG - Intronic
900879662 1:5371708-5371730 CCTCACAGCAGCACTGAGGAAGG + Intergenic
902257553 1:15199842-15199864 GGGCACAACAGCTCACAGGAGGG - Intronic
902301850 1:15507550-15507572 GGTGGCCCCAGCACAGAGCATGG + Intronic
902678112 1:18023142-18023164 GGCAGCTCCAGCACAGAGGACGG - Intergenic
902750745 1:18508605-18508627 GATAACACCAGCACAAAAGATGG - Intergenic
905646859 1:39630944-39630966 GTTCTCACCAGCATAAAGGAAGG + Intronic
907196097 1:52688158-52688180 GGTCAGACCACCTGAGAGGAAGG + Exonic
912670046 1:111617133-111617155 GGTCACATCAGCCTGGAGGAAGG - Intronic
913957595 1:143319179-143319201 GGTAGCACCAGGGCAGAGGAGGG + Intergenic
914051906 1:144144543-144144565 GGTAGCACCAGGGCAGAGGAGGG + Intergenic
914127291 1:144821998-144822020 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
920730876 1:208483124-208483146 AGTCACACTAGCAGATAGGAAGG + Intergenic
921353019 1:214256859-214256881 GGGTACACCAGCACAGCTGAGGG - Intergenic
922892763 1:229074285-229074307 GGGCACCCCAGCCCACAGGAGGG + Intergenic
923057253 1:230436183-230436205 GCTCACACCAGCACTTTGGAAGG + Intergenic
923370046 1:233300807-233300829 GGGCACACCAAGACAGAGGCTGG - Intergenic
923509983 1:234642533-234642555 AGTCACAATAGCAAAGAGGATGG + Intergenic
924373533 1:243382361-243382383 GGTCACACAAAAACAGATGATGG - Intronic
1062952456 10:1515229-1515251 GGCCACAGCAGCACAGAGCAGGG + Intronic
1063035262 10:2280513-2280535 GGTCTGACCAGCTCTGAGGAAGG + Intergenic
1067294246 10:44965722-44965744 GGGCACACCATCCCAGGGGAGGG - Intronic
1068502620 10:57859242-57859264 GGTTGCAGAAGCACAGAGGAGGG - Intergenic
1069652493 10:70059867-70059889 GGTTACACCCACAGAGAGGATGG + Intronic
1070655419 10:78267791-78267813 GGTCATTGCAGCTCAGAGGAGGG + Intergenic
1070685437 10:78477024-78477046 AGTCTCACTAGCACAGTGGACGG + Intergenic
1071721124 10:88147190-88147212 GGCAGCAGCAGCACAGAGGAAGG + Intergenic
1072392182 10:94998350-94998372 GAGCACACCTGGACAGAGGAGGG + Intergenic
1075738107 10:124676580-124676602 GGCCCCACCAGCACAAAAGATGG + Intronic
1076759344 10:132593259-132593281 GGTCCCACCTGCACTGAGGACGG + Intronic
1079744944 11:24114076-24114098 GGAAACACCACCACAGAGGCAGG + Intergenic
1084217751 11:67659570-67659592 GGTAACACCAGCACCTGGGAAGG - Intergenic
1084861824 11:72023818-72023840 GGTCACACAAGCAGTGAGGGGGG + Intronic
1085310663 11:75514680-75514702 GGGCACATCTGGACAGAGGAGGG + Intronic
1086511554 11:87563552-87563574 GGCCTCACCATCACAGTGGAAGG - Intergenic
1087055943 11:93936465-93936487 GGTCCAAACAGCACAGAGGATGG + Intergenic
1087989206 11:104727480-104727502 GGTCACACTAGCACACATTAGGG - Intergenic
1089138174 11:116266036-116266058 GGTCCCACCAGCCCAGAGAGGGG - Intergenic
1089331642 11:117693052-117693074 GGTCTGAACAGCACAGAGTACGG + Intronic
1090923185 11:131225771-131225793 GATCACAACAGCACAAAGAATGG - Intergenic
1090931192 11:131299441-131299463 GGCCAGACCTGCACAGAGGTGGG - Intergenic
1091229840 11:133981237-133981259 ACTCACACCAGCTCAGAGGCGGG + Intergenic
1092787275 12:12038506-12038528 GGGGACACCAGTACAGTGGAAGG - Intergenic
1093214689 12:16348929-16348951 GGTCAGGTCAGCACAGAGAAAGG + Intronic
1093297049 12:17404050-17404072 GGTCTCACCATCATGGAGGAAGG - Intergenic
1093297320 12:17406116-17406138 GGCCTCACCATCATAGAGGAAGG - Intergenic
1094523400 12:31216093-31216115 GGGAACACCTGCACAGAGGCTGG + Intergenic
1094629781 12:32162063-32162085 GGTAGCACCATCACAGAGAAGGG + Intronic
1096248878 12:50013927-50013949 GGTCACATCATCTCAGAAGATGG - Intronic
1100575455 12:95887958-95887980 GGGTACACCAGCCCAGAGGAAGG - Intronic
1102855637 12:116290640-116290662 GGTCACCAGACCACAGAGGAGGG + Intergenic
1104463639 12:128973607-128973629 CGTCACACAAGCCCAGAGGAAGG + Intronic
1105614392 13:21999194-21999216 GTGCTCACCAGCACACAGGAGGG + Intergenic
1105702972 13:22947759-22947781 GGTCACACCAGGGGTGAGGATGG - Intergenic
1105855727 13:24370562-24370584 GGTCACACCAGGGGTGAGGATGG - Intergenic
1106483748 13:30155411-30155433 CGTGATACCAGCACACAGGAGGG + Intergenic
1111178903 13:84636114-84636136 GGGCAGACCACCAAAGAGGATGG - Intergenic
1112041854 13:95554611-95554633 AGTCACATGAGCACACAGGAAGG - Intronic
1113608766 13:111628673-111628695 GGAAACACCAGCAGTGAGGAAGG - Intronic
1118383523 14:65237081-65237103 GGTCACACAGGAACACAGGAGGG + Intergenic
1119546047 14:75472168-75472190 GGTCACACATGCACAGTGGCAGG - Intronic
1119922836 14:78462273-78462295 GGTCTCTGCAGTACAGAGGAGGG - Intronic
1122145574 14:99687128-99687150 GGTAAGAAAAGCACAGAGGAGGG - Intronic
1202930786 14_KI270725v1_random:30911-30933 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1124009627 15:25827490-25827512 GACAACACCAGCACAGTGGAGGG + Intronic
1124040945 15:26103059-26103081 GCCCCCACCAGCACGGAGGAGGG + Intergenic
1124178203 15:27447126-27447148 TGTTCCAGCAGCACAGAGGACGG + Intronic
1126329870 15:47520795-47520817 GGGAACCCCAGCAAAGAGGAAGG + Intronic
1126538331 15:49793902-49793924 GGTTACACCAAGACAGAGGAAGG + Intergenic
1128725177 15:69982749-69982771 GGTCACCCCAACACCTAGGAGGG - Intergenic
1129687966 15:77697045-77697067 GGTCAGAGGAGCAGAGAGGAGGG + Intronic
1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG + Intergenic
1130192599 15:81750782-81750804 GGTAACAGCAGCACTGCGGAGGG - Intergenic
1130681089 15:85997356-85997378 GGTGCCACAAACACAGAGGATGG + Intergenic
1130746860 15:86663549-86663571 GGTCACAACAGCAAAGGGGAGGG + Intronic
1130956725 15:88632038-88632060 TGTCAGCACAGCACAGAGGAAGG + Exonic
1131074356 15:89486013-89486035 GGTCACTGCAGAACAGAGGGAGG + Intronic
1131387340 15:92018392-92018414 GGTCACACCTCCACAGAACATGG + Intronic
1132607816 16:800815-800837 GGTCAGCCCAGCCCTGAGGAGGG - Intergenic
1133480388 16:6164732-6164754 GGTCACACCAGCACTTTGGAAGG - Intronic
1133774744 16:8887701-8887723 GGTCACACCAGCCCCGGGGAAGG + Intergenic
1133816674 16:9202984-9203006 GGTGCCAGGAGCACAGAGGAGGG - Intergenic
1134869400 16:17638244-17638266 GGTCTCACAATCACAGTGGAAGG + Intergenic
1136926454 16:34379768-34379790 GGTAATAGCAGCATAGAGGAGGG - Intergenic
1136978120 16:35032039-35032061 GGTAATAGCAGCATAGAGGAGGG + Intergenic
1138821782 16:60269286-60269308 GCTCACAACAGGGCAGAGGATGG - Intergenic
1139573529 16:67827665-67827687 GCTCAGCCCAGCACAGAGGAGGG + Intronic
1140408660 16:74727701-74727723 GATGCCACCAGCACAGAAGATGG + Intronic
1140525397 16:75618717-75618739 AGTCCCACCAGCACCCAGGATGG + Intronic
1140855563 16:78974999-78975021 GGTCTCACCAGGAGAGAAGAGGG - Intronic
1141749050 16:85946146-85946168 GGACACACCAGCACAGCCCAAGG - Intergenic
1142839078 17:2613272-2613294 GGCCACTTCAGCACAGAGGCTGG + Intronic
1143473568 17:7190877-7190899 GGTTGCACCAGCCCAGAGGAAGG + Intronic
1143531614 17:7508327-7508349 AGACACACCAGCATAGTGGAAGG - Exonic
1144243243 17:13335151-13335173 GCTCACACCAGCACTTTGGAAGG + Intergenic
1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG + Intronic
1144727579 17:17509591-17509613 GGCCACACCATCACTGAGGGAGG + Intronic
1144752733 17:17660965-17660987 GGTCTCACCAGCTCAGGGAAAGG + Intergenic
1146577442 17:34007119-34007141 GGTAACAGCAGCCCAGAGGGGGG + Intronic
1147537996 17:41333399-41333421 GCTCACACCAGGACAGATGCAGG - Intergenic
1149363357 17:55916321-55916343 GGTCCCCCGAGCACAGAGCATGG + Intergenic
1149882248 17:60304627-60304649 CGTAACAATAGCACAGAGGATGG + Intronic
1150013860 17:61533397-61533419 AGTCACATCAGCCCATAGGAAGG - Intergenic
1151945892 17:77319670-77319692 GGCCAGCCCAGGACAGAGGAAGG + Intronic
1152223608 17:79082520-79082542 GGTCACACCAGCACAGAGGAAGG + Intronic
1153487342 18:5613129-5613151 GGACACACTTGCAGAGAGGAGGG + Intronic
1153980468 18:10304529-10304551 GGTCAGAGCAGAACAGAGGTGGG - Intergenic
1154131068 18:11737751-11737773 GGACATATCAGCCCAGAGGAAGG + Intronic
1155558956 18:27053937-27053959 GGTTACAGAAGCACAGAAGAAGG - Intronic
1160382169 18:78468151-78468173 GGTCACCCCAGGACTGGGGAAGG - Intergenic
1160840775 19:1146251-1146273 GGTCACCCCAGCACAGACTCAGG + Intronic
1161551703 19:4916601-4916623 GGGCATCCCAGCACACAGGACGG - Intronic
1162866501 19:13551878-13551900 GGTCACAGGGGCAGAGAGGAGGG - Intronic
1163222392 19:15930919-15930941 GGACACACTAGCACAGAGCCTGG - Intronic
1163875693 19:19865921-19865943 GGTCACACGGCCACAGAGGACGG - Exonic
1164162164 19:22634394-22634416 GGTCACAGGGCCACAGAGGATGG - Exonic
1165325673 19:35113181-35113203 CGTCAGAGCAGCACAGAGGCAGG + Intergenic
1166257768 19:41618701-41618723 GGTCTCAGGAGCACAGAAGATGG - Intronic
1167042858 19:47032798-47032820 GGTGAGACCAGGAGAGAGGAAGG - Intronic
1202691304 1_KI270712v1_random:96967-96989 GGTAGCACCAGGGCAGAGGAGGG + Intergenic
925059973 2:883555-883577 ACTCACACCAGCACTGAGAACGG - Intergenic
925059978 2:883592-883614 GGTCACACAAGCACTGAGAATGG - Intergenic
927922018 2:26979972-26979994 GGAGTCAGCAGCACAGAGGAGGG + Intronic
929928684 2:46235542-46235564 GGACAGACCAGCTCAGAGGGTGG - Intergenic
931883193 2:66588354-66588376 GGTGATAGAAGCACAGAGGAGGG + Intergenic
933279038 2:80312197-80312219 GAGCACACCTGGACAGAGGAGGG + Intronic
933955086 2:87356983-87357005 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
934239275 2:90253197-90253219 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
934273909 2:91563501-91563523 GGTAGCACCAGGGCAGAGGAGGG + Intergenic
936164159 2:110105441-110105463 GGTCCCACGGGCACAGAGGTTGG + Intronic
937411801 2:121683038-121683060 GATCATACCAGGACAGGGGAGGG + Intergenic
937454840 2:122032310-122032332 AGTCACACCAGAACACAGCATGG - Intergenic
938287165 2:130128241-130128263 GGTCTCCCCAACACAGAGCATGG + Intronic
938428428 2:131210629-131210651 GGTCTCCCCAACACAGAGCATGG - Intronic
938469330 2:131544647-131544669 GGTCTCCCCAACACAGAGCATGG - Intergenic
939600815 2:144187925-144187947 GGACACACACACACAGAGGAAGG + Intronic
939881858 2:147640399-147640421 GGTAAGACCAGCACAGACCAGGG - Intergenic
940082491 2:149819804-149819826 GGTGACAACAGAACAGAGCAGGG + Intergenic
941303025 2:163827923-163827945 GGCCTCACAAGCACAGTGGATGG + Intergenic
942073938 2:172339612-172339634 AGCCACATTAGCACAGAGGAGGG + Intergenic
942781435 2:179647986-179648008 GGTCAGAACAGAACAGAGAAAGG + Intronic
942901174 2:181121047-181121069 GCTAACACAAGCTCAGAGGAGGG + Intergenic
944508571 2:200441582-200441604 GGAGACACCAGGAGAGAGGAAGG - Intronic
945256242 2:207805885-207805907 GGTCCCACCAGCACTCAGGCTGG + Intergenic
945342073 2:208668203-208668225 AGTTACACCTGCACAGAGAATGG - Intronic
947049959 2:226031124-226031146 GGTCACGCCAGCACAGTGGAGGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
949007647 2:241658808-241658830 GGTCTCACTGGCACAGAGGCAGG - Intronic
1169844519 20:9975069-9975091 GGACTCACAATCACAGAGGAAGG - Intergenic
1170646328 20:18199152-18199174 GGTCCCACCAGCAAAGTGAATGG - Intergenic
1170737478 20:19024268-19024290 GCTCACACCAGCACTCAGGGAGG + Intergenic
1175113429 20:56664931-56664953 TGACACACCAGGACAGGGGATGG + Intergenic
1176592806 21:8659534-8659556 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1176688142 21:9873205-9873227 TGTCAGACCTGCACAGAGAAGGG + Intergenic
1178585315 21:33866451-33866473 GCTGACACCAGCCCAGAGCAGGG + Intronic
1178598563 21:33976487-33976509 GGCCCCACAAGCTCAGAGGAAGG - Intergenic
1178934922 21:36852943-36852965 GAACACAGCAGCACAGAAGAAGG + Intronic
1180192444 21:46172519-46172541 GGTCCCATCTGCCCAGAGGAGGG - Intronic
1180275659 22:10636676-10636698 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1180550140 22:16531616-16531638 GGCAACACCAGGGCAGAGGAGGG - Intergenic
1181354534 22:22290205-22290227 GGTAGCACCAGGGCAGAGGAGGG + Intergenic
1182130084 22:27844374-27844396 AGGCACTACAGCACAGAGGAGGG + Intergenic
1183380936 22:37490190-37490212 GGTGACGCCAGCACAGATGGCGG + Intergenic
1183695722 22:39420990-39421012 GGACACACCAGCACCTGGGAGGG - Intronic
1183695730 22:39421016-39421038 GGACACACCAGCACCTGGGAGGG - Intronic
1183695738 22:39421042-39421064 GGACACACCAGCACCTGGGAGGG - Intronic
1184089789 22:42286402-42286424 GGTCACACAGTCACACAGGAAGG - Intronic
1184645998 22:45895831-45895853 GGTCTCAGCAGCACTGAGGTTGG + Intergenic
1184946199 22:47805742-47805764 GTCCACAACAGCAAAGAGGAAGG - Intergenic
1185083509 22:48723118-48723140 GGACACACCAGCCAAGAAGACGG - Intronic
1185150318 22:49160514-49160536 GGTCACACCTGGAGAGAGGGGGG - Intergenic
950182987 3:10928039-10928061 AGACACAGAAGCACAGAGGAGGG - Intronic
951840759 3:27031638-27031660 AGTCACACCAGCTCTGTGGAAGG + Intergenic
953135633 3:40179366-40179388 GGTCCCAACAGCAGAGAGTAGGG - Intronic
953795790 3:45985015-45985037 GGTGGCACCTGCACAGAGGAAGG + Exonic
953863735 3:46566046-46566068 GGTCACCAAGGCACAGAGGAAGG + Intronic
955301531 3:57784346-57784368 GGGCACACTAGGACAGAGGCTGG - Intronic
956319259 3:67977839-67977861 AGTCAAAAGAGCACAGAGGAGGG + Intergenic
956699999 3:71950537-71950559 GGCCACAGCAGCCCAGAGGAAGG + Intergenic
956927941 3:74009609-74009631 GGTCACAGGAGAACAGAGGGTGG + Intergenic
958689714 3:97448209-97448231 GGGCACACCAGCAGAGTGCAAGG - Intronic
960198503 3:114801058-114801080 GGTCACAGAAACACAGAAGAAGG + Intronic
960873427 3:122273906-122273928 GGTCACCCCAACAGCGAGGAGGG + Intronic
963513293 3:146276123-146276145 GGTCTCACAATCACAGCGGAAGG - Intergenic
964843582 3:161022283-161022305 GTTGACAACAGCACAGAGAATGG - Intronic
967257673 3:187609949-187609971 GGTCACATAAACACAAAGGACGG + Intergenic
967769418 3:193318136-193318158 GGTGAAACAAGCACAGAGTAAGG + Intronic
968644055 4:1729884-1729906 GGTAACACCAGCACTTGGGAAGG - Intronic
970079426 4:12263941-12263963 GGTGAGATCAGCAGAGAGGAGGG + Intergenic
970875491 4:20864513-20864535 GGTCACACCATAACAGAGTCAGG + Intronic
971687577 4:29788442-29788464 GGGCTCACAATCACAGAGGAAGG + Intergenic
972180173 4:36455200-36455222 GCACATAGCAGCACAGAGGAAGG - Intergenic
972957487 4:44410629-44410651 GGTCTCACAATCATAGAGGAAGG + Intronic
975170574 4:71227713-71227735 TGACACACCAGCACAGAGGATGG - Intronic
976738083 4:88331029-88331051 GGGCCCCCCAGCAAAGAGGATGG + Intergenic
978940949 4:114435203-114435225 TGTCAGACCAGAACAGAGCAGGG - Intergenic
979559136 4:122082266-122082288 GGTCAGACCAGCCAAGAGTAAGG + Intergenic
980351515 4:131691044-131691066 TGTCAGACCTGCACAGAGAAGGG + Intergenic
981078896 4:140618636-140618658 GATGACACCAGTGCAGAGGAAGG - Intergenic
981488416 4:145313429-145313451 GGTTACACTAGCCCAGAGGAAGG + Intergenic
981752090 4:148102470-148102492 GGTAGCACCTGCCCAGAGGAGGG - Intronic
982228828 4:153189616-153189638 AGTTACAGCAGCACAGAGGAAGG - Intronic
984914965 4:184714462-184714484 TGACAAAACAGCACAGAGGATGG + Intronic
990580137 5:57160157-57160179 GGTGACTCCAGCAGAGAGGTGGG - Intergenic
990739492 5:58897721-58897743 GCTCACACCTGCACAAAGGTAGG + Intergenic
994200031 5:96962991-96963013 GCTCACAGCTGCACAGAGGGAGG + Intronic
996402951 5:123083175-123083197 TGACACCCCAGCTCAGAGGAGGG + Intergenic
999962089 5:156766838-156766860 GGCCACAGCAGCAAAGAGGTTGG + Intronic
1000599492 5:163254607-163254629 GCTCACCCTAGCACAGAGAAAGG + Intergenic
1002565709 5:180112165-180112187 GGTGACACCAGCCCAGAGCCAGG - Intronic
1002805243 6:567316-567338 GGACACAACCACACAGAGGATGG - Intronic
1004630099 6:17412785-17412807 GGTGAAACCACCACAGTGGAGGG + Intronic
1005752897 6:28899759-28899781 GCTCACACCAGCACTTTGGAAGG - Intergenic
1005872288 6:29983555-29983577 GAACATACCAGTACAGAGGAGGG + Intergenic
1008439338 6:51514564-51514586 GGACACCTCAGCACTGAGGAGGG + Intergenic
1008534967 6:52500602-52500624 GGTCCCACCAGCCCAGTGGCCGG - Exonic
1009427682 6:63532454-63532476 GGTCAGCACAGCACAGTGGATGG + Intronic
1011702304 6:89967108-89967130 TTTCACACCAACACAGGGGATGG + Intronic
1013348757 6:109287540-109287562 GACCACACCTGCCCAGAGGAAGG - Intergenic
1016036271 6:139386782-139386804 GGCGACACCACCACAGATGAAGG - Intergenic
1016461349 6:144283118-144283140 GGTCACTCCTGCACAGAAGGTGG + Intergenic
1018223793 6:161608101-161608123 GGACCCTCCAGCACAGCGGAGGG - Intronic
1019145990 6:169975900-169975922 GTTCACACATGCACACAGGACGG + Intergenic
1019145998 6:169975941-169975963 GTTCACACATGCACACAGGACGG + Intergenic
1019146016 6:169976023-169976045 GTTCACACATGCACACAGGAGGG + Intergenic
1019294615 7:267145-267167 GGTCCCTCCAGCTCACAGGATGG - Intergenic
1019967763 7:4513996-4514018 GCTCACACCAGCACTTTGGAAGG + Intergenic
1020965679 7:14865014-14865036 AGTCACAGCAGCAGAGATGAGGG + Intronic
1022045722 7:26620692-26620714 GGGCACACCTGCAGAGGGGAGGG + Intergenic
1022427489 7:30283527-30283549 GACCACACCAACACTGAGGAAGG + Intergenic
1022612167 7:31886690-31886712 GGTCAGCCAGGCACAGAGGATGG + Intronic
1022810301 7:33861730-33861752 GGTAACACCAGCACAGCAGGAGG + Intergenic
1024048285 7:45600118-45600140 GTCCTCACCAGCACAGAGGTGGG - Intronic
1024941725 7:54769569-54769591 GGGCATACTAGCATAGAGGAGGG + Intergenic
1025840211 7:65139953-65139975 GGAGACACCAACACAGAGGATGG + Intergenic
1025882851 7:65556012-65556034 GGAGACACCAACACAGAGGATGG - Intergenic
1025890593 7:65646592-65646614 GGAGACACCAACACAGAGGATGG + Intergenic
1032191334 7:129767558-129767580 GGTCAGATTAGCTCAGAGGACGG + Intergenic
1034391278 7:150789565-150789587 GGTGACACCAGCACAGCCGGTGG + Intergenic
1034656756 7:152735918-152735940 TGTCACATGAGCAAAGAGGAGGG - Intergenic
1034984085 7:155496802-155496824 GGTCAGACCAGCACGGCGGGAGG - Intronic
1035140901 7:156759798-156759820 GAGCACACCTGCACAGGGGAGGG + Intronic
1037961620 8:23102425-23102447 GGTCACAGCAGCAAGGAGGCTGG + Intronic
1037969906 8:23164496-23164518 GGTCACAGCAGCAAGGAGGCTGG - Intergenic
1038009131 8:23459991-23460013 GGTCACACCTGCACAATGAATGG + Intergenic
1040545684 8:48396673-48396695 GGTCACACCCGGGCAGGGGAAGG - Intergenic
1040729008 8:50419899-50419921 GGGCACAACAGCACAATGGACGG + Intronic
1041658422 8:60376885-60376907 GGTGGCCCCAGCACAGAGGCAGG + Intergenic
1041988391 8:63954580-63954602 GGTCACACAAGCAAATTGGAGGG + Intergenic
1044114011 8:88312037-88312059 GGTGATACCAGCACAGTGGTGGG + Intronic
1045270230 8:100655153-100655175 TGCCACAACAGCACACAGGAGGG + Intronic
1045376114 8:101575846-101575868 AGTTGCACCAGCACAGAGAATGG + Intronic
1047857697 8:128930344-128930366 GCTCACAGTAGCACAGAGAATGG + Intergenic
1048490159 8:134884910-134884932 CGACACAGCAGCACAGAGCAGGG - Intergenic
1051726243 9:20090004-20090026 GGTAGCACCAACACAGAGAAAGG - Intergenic
1053077747 9:35149240-35149262 GGTCACAGGGCCACAGAGGATGG + Intergenic
1053692192 9:40592203-40592225 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1054169145 9:61818821-61818843 TGTCAGACCTGCACAGAGAAGGG - Intergenic
1054272608 9:63045282-63045304 GGTAGCACCAGGGCAGAGGAGGG + Intergenic
1054303450 9:63393169-63393191 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1054402229 9:64719679-64719701 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1054435834 9:65203994-65204016 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1054494558 9:65817693-65817715 GGTAGCACCAGGGCAGAGGAGGG + Intergenic
1054668387 9:67761995-67762017 TGTCAGACCTGCACAGAGAAGGG + Intergenic
1055330364 9:75177377-75177399 GGATGCACAAGCACAGAGGAAGG - Intergenic
1055678998 9:78695294-78695316 GGGCTCACAAGCACAGATGAAGG + Intergenic
1056858864 9:90161301-90161323 GGACACACCAGCACTTTGGATGG + Intergenic
1056910730 9:90697878-90697900 GGTCCCAAGAGCAGAGAGGAAGG + Intergenic
1057330570 9:94110670-94110692 GGTAACATGAGCAGAGAGGAGGG - Intergenic
1057930047 9:99185306-99185328 TGTCAAAACAGCTCAGAGGACGG - Intergenic
1059227143 9:112682564-112682586 GGAAACACCTGCACAGAGGCAGG - Intergenic
1060880028 9:127111573-127111595 GGTCAGAGCTGCGCAGAGGAGGG + Intronic
1061591297 9:131599461-131599483 GGTCACAGTAGCACAGAGAAAGG + Intronic
1062095010 9:134698625-134698647 GGTCACTCCAGCACAGCTGCAGG - Intronic
1062595373 9:137296751-137296773 GGACACAGCAGGCCAGAGGAGGG - Intergenic
1203622852 Un_KI270749v1:138340-138362 GGTAGCACCAGGGCAGAGGAGGG - Intergenic
1185448573 X:271280-271302 CATCACACCAGGACAGAGGAAGG + Intergenic
1185448965 X:272900-272922 CATCACACCAGGACAGAGGAAGG + Intergenic
1185568139 X:1112238-1112260 GGTCATACCTGCAAACAGGAAGG - Intergenic
1186283015 X:8014506-8014528 GGCAACCCCACCACAGAGGATGG - Intergenic
1186637162 X:11418982-11419004 AGTGAGACCAGCACAGAGAAGGG - Intronic
1187213106 X:17249016-17249038 GATGAAACCAGCACTGAGGATGG + Intergenic
1187223631 X:17354642-17354664 TGTCATAGCAACACAGAGGATGG - Intergenic
1189251236 X:39601900-39601922 GGCCACACCAGCCCAGCGCAGGG + Intergenic
1189693654 X:43641668-43641690 GGTCAGAGCAGGACAGAGAAAGG + Intergenic
1191685434 X:63884938-63884960 TGTCAGACCTGCACAGAGCAGGG + Intergenic
1191853063 X:65600350-65600372 GGTGAAACACGCACAGAGGAAGG - Intronic
1195061030 X:101194810-101194832 GGTAACAACAGCACAAAGGAGGG - Intergenic
1195790780 X:108582841-108582863 GGTGACATCAGCACAAATGATGG - Intronic
1197126679 X:122955092-122955114 AGTGACAGCAGGACAGAGGATGG - Intergenic
1199681841 X:150230113-150230135 GGACACCCCAGCAGAGAAGATGG - Intergenic
1199731009 X:150632189-150632211 TGTCACAGGAGCACAAAGGAGGG + Intronic
1202093432 Y:21217846-21217868 GCTTATACCAGCACAGGGGAAGG - Intergenic
1202349373 Y:23971461-23971483 GGTAACTCCAGCACATTGGAGGG + Intergenic
1202521402 Y:25698643-25698665 GGTAACTCCAGCACATTGGAGGG - Intergenic