ID: 1152224885

View in Genome Browser
Species Human (GRCh38)
Location 17:79088102-79088124
Sequence CGTCCACCCAGGACAGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152224885_1152224889 -5 Left 1152224885 17:79088102-79088124 CCGGGGACTGTCCTGGGTGGACG 0: 1
1: 1
2: 3
3: 13
4: 241
Right 1152224889 17:79088120-79088142 GGACGGCAGGTGAACACAAGCGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152224885 Original CRISPR CGTCCACCCAGGACAGTCCC CGG (reversed) Intronic
902163805 1:14553463-14553485 AGTGCACCCAGGCCAGTCCTTGG + Intergenic
902186832 1:14731713-14731735 CATCCTCCCAGCACAGTCCAAGG - Intronic
902873506 1:19327758-19327780 CCTCTAACCAGGACGGTCCCTGG - Intronic
903438921 1:23372405-23372427 CCTCACCCCAGGCCAGTCCCTGG - Intergenic
903701278 1:25250237-25250259 CTTCCACCGAGCACATTCCCAGG + Intronic
903767995 1:25747077-25747099 CTTCCACCCTGGACGGCCCCTGG + Intronic
903772195 1:25770992-25771014 TCTCCACCCAGGGCCGTCCCAGG - Intronic
905106338 1:35565668-35565690 TGTCCACCGGGGACAGACCCAGG + Exonic
905300514 1:36983473-36983495 AGAGCACCAAGGACAGTCCCTGG - Intronic
906881325 1:49594520-49594542 CATCCACCACTGACAGTCCCTGG + Intronic
906898742 1:49809305-49809327 CCTCCCCCCACGACAGGCCCTGG + Intronic
908917167 1:69142185-69142207 CCCCCACCCTGGACAGGCCCTGG - Intergenic
908955894 1:69626727-69626749 CGCCCCCCCATGACAGGCCCCGG + Intronic
909365355 1:74814041-74814063 CCTCAACCCACGACAGACCCTGG + Intergenic
909456562 1:75856441-75856463 CCTCCACCCCCGACAGGCCCCGG + Intronic
909853769 1:80502652-80502674 CCCCCACCCACGACAGGCCCTGG - Intergenic
910335264 1:86121128-86121150 CTTCACCCCATGACAGTCCCCGG - Intronic
911184172 1:94886738-94886760 CAGCCACTCGGGACAGTCCCAGG + Intronic
913433546 1:118822903-118822925 CCCCCACCCACAACAGTCCCCGG + Intergenic
913498614 1:119450359-119450381 CGTCAACCCAGGCCAGTACACGG + Intergenic
915561370 1:156690092-156690114 CCTCCAGCCAGCCCAGTCCCTGG - Intergenic
923305607 1:232685531-232685553 CTGCCACCCAGAACAGTGCCTGG + Intergenic
923858390 1:237868544-237868566 CTTCCACCCCTGACAGGCCCAGG - Intergenic
1062874317 10:932225-932247 TGGCCACCCAGGACACGCCCTGG + Intergenic
1065892361 10:30132062-30132084 CGTCCACCCATGACTGTCCCAGG - Intergenic
1067556884 10:47278889-47278911 CCTCTGCCCATGACAGTCCCTGG + Intergenic
1068369025 10:56090087-56090109 CCCCAACCCAGGACAGGCCCTGG - Intergenic
1068858643 10:61823794-61823816 CGTCCACCCAGGTCAAACCAGGG - Intergenic
1069143954 10:64865394-64865416 CGTGCGCCCATGACAGCCCCAGG + Intergenic
1070132707 10:73666085-73666107 CGTCCACCCAGCCCAGTCCATGG + Intergenic
1071608977 10:87017989-87018011 CATCCACCCAGCCCAGTCCATGG - Intergenic
1073777089 10:106798441-106798463 CCCCCACCCACGACAGGCCCTGG + Intronic
1074064268 10:109999012-109999034 CTACCACCCAGAACAGTGCCTGG + Intronic
1074646256 10:115456471-115456493 CGTCACCCCATGACAGGCCCTGG - Intronic
1075006724 10:118835923-118835945 CCTCCAGCCAGGACAGCACCTGG + Intergenic
1076482727 10:130795495-130795517 CATCCTCCCAGGCCACTCCCTGG + Intergenic
1077443577 11:2579795-2579817 CGTGCACCCAGCTCAGCCCCAGG + Intronic
1077594564 11:3520656-3520678 CCACCACCCAGCACAGTGCCTGG + Intergenic
1078738987 11:14048996-14049018 AGTGCACCCAGAACAGTGCCTGG - Intronic
1079275443 11:19031824-19031846 CCCCCACCCACGACAGGCCCCGG + Intergenic
1083672281 11:64306046-64306068 CTTCCACCCCGGCCAGCCCCAGG - Intronic
1084166839 11:67379104-67379126 GTCCCACCCAGGACATTCCCTGG + Intronic
1084170603 11:67399152-67399174 CGGCCCCCCAGGCCTGTCCCCGG - Exonic
1084578443 11:70006397-70006419 CGCCCACCCCAGGCAGTCCCTGG - Intergenic
1084822372 11:71701415-71701437 CCACCACCCAGCACAGTCCCTGG - Intergenic
1085819786 11:79780195-79780217 ACACCACCCAGCACAGTCCCTGG + Intergenic
1087749824 11:101995027-101995049 CCTCCACCCCCGACAGGCCCTGG + Intronic
1087794828 11:102444530-102444552 CCCCCACCCACGACAGGCCCTGG - Intronic
1089385687 11:118066084-118066106 CCTCCACCCAGGGCTCTCCCTGG + Intergenic
1089691842 11:120191710-120191732 CCGACACCCAGGACAGTGCCTGG - Intergenic
1091637040 12:2205094-2205116 CTTCCACCCACAGCAGTCCCAGG + Intronic
1092420738 12:8329445-8329467 CCACCACCCAGCACAGTGCCTGG + Intergenic
1093093369 12:14945532-14945554 AGACAACCCAGGTCAGTCCCAGG - Intronic
1098881936 12:75926221-75926243 TGTCCACTTAGGACAGGCCCAGG - Intergenic
1099362154 12:81717667-81717689 CTAGCACCCAGGACAGTGCCTGG - Intronic
1099423550 12:82494416-82494438 CCCCCACCCACAACAGTCCCCGG - Intergenic
1101512267 12:105404130-105404152 CCTCCACCCCTGACAGGCCCTGG + Intergenic
1101876980 12:108602636-108602658 TCGCCACCCAGGACAGTGCCTGG + Intergenic
1102779933 12:115555566-115555588 CTTCCCCCCAGGAGTGTCCCAGG + Intergenic
1103951711 12:124554964-124554986 GGTGGACCCAGGACTGTCCCTGG + Intronic
1104768419 12:131345459-131345481 CGTCCAGCCAGCACCGTCACAGG - Intergenic
1104809845 12:131613439-131613461 CGTCCACCCAAGACAGCCACTGG - Intergenic
1104811627 12:131623129-131623151 CGTCCAGCCAGCACCGTCGCAGG + Intergenic
1105344727 13:19561657-19561679 CTTCCACCCCGGCCAGCCCCAGG + Intergenic
1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG + Intronic
1106775078 13:33001332-33001354 TGTCCTCCCAGGAATGTCCCTGG + Intergenic
1109014542 13:56992808-56992830 CCCCCACCCACAACAGTCCCTGG + Intergenic
1111648974 13:91066030-91066052 CGTGCACCCATGACAGCCTCAGG - Intergenic
1112012919 13:95307236-95307258 CCCCCACCCACAACAGTCCCCGG - Intergenic
1112435816 13:99390597-99390619 CATCCACCAAAGACAGACCCAGG + Intergenic
1112462332 13:99613960-99613982 GCTAAACCCAGGACAGTCCCAGG - Intronic
1117829940 14:59740187-59740209 CTTGCACCCAGCACAGTGCCTGG + Intronic
1118958809 14:70508463-70508485 CTCCCACCCCTGACAGTCCCTGG - Intergenic
1119041399 14:71277703-71277725 CGGCCACCCAGAACAGTACCTGG + Intergenic
1121718639 14:96094149-96094171 CCACCACCCAGCACAGTGCCTGG + Intergenic
1122768157 14:104085527-104085549 CTCCGACCCTGGACAGTCCCCGG + Intergenic
1122837642 14:104437879-104437901 TGACCACCCAGGCCAGCCCCGGG + Intergenic
1123998518 15:25735098-25735120 CCTCCAAGCAGGACAGTGCCAGG + Intronic
1124469956 15:29975508-29975530 CCTGCACCCAGAACAGTGCCTGG + Intergenic
1125483893 15:40099041-40099063 GGCCCACCTAGGACAGTGCCAGG - Intronic
1125806127 15:42495397-42495419 CGTTCATCCAGCACAGTGCCTGG + Exonic
1129124779 15:73430094-73430116 CCTACACCCAGGATAGTCCTTGG - Intergenic
1129701737 15:77772208-77772230 CATCCACCCAGGTCATTCTCAGG - Intronic
1129778600 15:78253877-78253899 CTATCACCCAGGACATTCCCTGG - Intergenic
1131072106 15:89472504-89472526 CGTGCATCCAGGACAGACACAGG - Intronic
1132692736 16:1188839-1188861 GGTACATCCAGGACAGGCCCAGG + Intronic
1132730395 16:1358144-1358166 CCTCCAGCCAGGCCAGCCCCAGG - Intronic
1132756109 16:1486251-1486273 CGTCCACCCAGGGCAGGTACTGG - Exonic
1132834081 16:1943581-1943603 TGTCCCCCCAGTCCAGTCCCTGG + Intergenic
1134353928 16:13463427-13463449 CCTCCAGCCACAACAGTCCCAGG - Intergenic
1135166318 16:20142132-20142154 CCTCCACACAGCACAGTCTCTGG - Intergenic
1138042229 16:53684580-53684602 CCCCCACCCATAACAGTCCCTGG - Intronic
1138607572 16:58098751-58098773 CCTGCCCCCAGGACAGTGCCTGG - Intergenic
1139749052 16:69097633-69097655 CTCCCACCCAGGGAAGTCCCAGG - Intergenic
1140128468 16:72137241-72137263 CCAGCACCCAGGACAGTGCCGGG - Intronic
1140164549 16:72536175-72536197 CCCCCACCCACGACAGGCCCCGG - Intergenic
1142322636 16:89394090-89394112 ACTCCACCCATCACAGTCCCAGG + Intronic
1142970138 17:3605840-3605862 CATGCACCCAGCACAGACCCAGG - Intergenic
1143386996 17:6536878-6536900 CCACAGCCCAGGACAGTCCCTGG - Intronic
1144826098 17:18106517-18106539 GGTAGACCCAGGACAGCCCCTGG + Intronic
1146263435 17:31436135-31436157 GGGCCACCCAGGACAGGCCATGG + Intronic
1148547700 17:48530085-48530107 TGTGCACCCAGCACAGACCCAGG - Intronic
1150774682 17:68070013-68070035 CTTCCACCGAGCACATTCCCAGG + Intergenic
1151402657 17:73865952-73865974 CGTTCACCCAGCCCAGGCCCTGG - Intergenic
1152224874 17:79088058-79088080 CCTCCACCCAGGACAGTCCCCGG - Intronic
1152224885 17:79088102-79088124 CGTCCACCCAGGACAGTCCCCGG - Intronic
1152721602 17:81926547-81926569 TGTCCAACCAGGCCAGTCCCAGG + Intronic
1152734548 17:81991032-81991054 CGGTCACCCACAACAGTCCCCGG - Intronic
1158390751 18:57043116-57043138 CCTCCACCCCCGACAGGCCCTGG - Intergenic
1161031267 19:2058755-2058777 CGACCACCCAGCACAGGGCCCGG + Intergenic
1161507369 19:4651083-4651105 CCTCCACCCTGAACAGCCCCGGG + Intronic
1161723645 19:5916640-5916662 CCTGCCCCCAGGACAGTCCAGGG - Exonic
1162927069 19:13936074-13936096 CCTCCACCCAAGACAGGCCTGGG - Intronic
1163500362 19:17672607-17672629 CTACCACCTAGGACACTCCCAGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164627927 19:29741649-29741671 CATCCCCTAAGGACAGTCCCTGG + Intergenic
1165980063 19:39714099-39714121 CCCACACCCATGACAGTCCCCGG + Intergenic
1166214991 19:41329001-41329023 CTTCCTCCCAGGACAATCACTGG + Intronic
1166256021 19:41605175-41605197 CCTCCACCCAGGTCAGCTCCAGG + Intronic
1167108162 19:47443116-47443138 CCAACACCCAGAACAGTCCCTGG + Intronic
1167888510 19:52521617-52521639 CTTCCACCGAGCACATTCCCAGG + Intergenic
1168140285 19:54381425-54381447 CCTGCACCTAGGACAGTCCCTGG + Intergenic
925924478 2:8660249-8660271 CATCCACCCAGGGCTGTCCTGGG + Intergenic
927842764 2:26455986-26456008 CGTGGCCCCAGCACAGTCCCAGG + Intronic
929441882 2:41971253-41971275 CGGCCCCCCAGGACAGCCCCCGG - Intergenic
930286623 2:49437022-49437044 CCTCCACCCCTGACAGACCCTGG - Intergenic
932319348 2:70809688-70809710 GGTCCACCAAAGACAGTGCCTGG + Intronic
935517607 2:104061509-104061531 CCCCCACCCATGACAGGCCCTGG + Intergenic
936939702 2:117871465-117871487 CCCCCACCCACAACAGTCCCCGG + Intergenic
937025206 2:118691907-118691929 GGTCCACCCAGGAGAGGACCTGG - Intergenic
937259036 2:120573719-120573741 CATGTACCTAGGACAGTCCCCGG - Intergenic
937294800 2:120803623-120803645 CAGACACCCAGGACAGGCCCTGG - Intronic
939380340 2:141427028-141427050 CCTCCACCCCTGACAGGCCCTGG + Intronic
942499879 2:176578300-176578322 CGCCCACCCACAACAGGCCCCGG + Intergenic
948556140 2:238812870-238812892 CCTCCAACCAGGGCTGTCCCTGG - Intergenic
948781752 2:240325789-240325811 TGTCCACCCACAACAGTCCTTGG + Intergenic
948864942 2:240770476-240770498 CCTCCACTGACGACAGTCCCAGG - Intronic
948930664 2:241129808-241129830 CCTCAACCCAGGGCAGCCCCAGG + Intronic
948963346 2:241356701-241356723 AGTCCACGCGGGACACTCCCCGG - Intronic
1168847524 20:955536-955558 CCAGCACCCAGGACAGTACCAGG + Intergenic
1173799640 20:45886970-45886992 AGTCCCCCCAGGGCAGCCCCTGG + Exonic
1174023650 20:47553552-47553574 CCCCCACCCACAACAGTCCCCGG + Intronic
1175800182 20:61797014-61797036 CGGCCACCCAGGAAAGTGGCTGG - Intronic
1176072994 20:63236435-63236457 CTTCCACACAGGTCAGTCCCGGG + Exonic
1176105634 20:63384545-63384567 CGTCAACCCAGGACTGCACCAGG - Intergenic
1176427739 21:6559135-6559157 CACACACCCAGGACACTCCCGGG - Intergenic
1178165256 21:29967252-29967274 CTGGCACCCAGAACAGTCCCTGG - Intergenic
1178880269 21:36444283-36444305 CCTCCACCCCCGACAGGCCCCGG + Intergenic
1179703231 21:43167452-43167474 CACACACCCAGGACACTCCCGGG - Intergenic
1181029778 22:20144133-20144155 TGTCCACCCAGGGCTCTCCCTGG + Intronic
1183600277 22:38835906-38835928 CGTCTCCCCAGGACAGTCTTGGG - Intronic
1184236463 22:43185851-43185873 CTTCCACCCAGCACAGGCCTGGG + Intronic
1184421866 22:44386826-44386848 CATCCACCATGGACAGCCCCAGG + Intergenic
1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG + Intergenic
1184856190 22:47147993-47148015 CTTCCTCCTAGGACAGTGCCAGG + Intronic
949646512 3:6101297-6101319 CCCCCACCCACAACAGTCCCCGG + Intergenic
950265563 3:11570369-11570391 CGGCCACCAAGGTCTGTCCCCGG + Intronic
950486480 3:13276863-13276885 CCCCCACCCAGGGCAGACCCGGG - Intergenic
950815741 3:15700284-15700306 CCCCCACCCCGGACAGGCCCCGG - Intronic
953539246 3:43801038-43801060 CCTCAACCCATGACAGGCCCTGG + Intergenic
954636208 3:52072122-52072144 CTGCCACCCAGCACAGTCCTTGG - Intergenic
955212700 3:56956652-56956674 GCTCAACCCAGGACAGTCCCTGG + Intronic
957064704 3:75512008-75512030 CCACCACCCAGCACAGTGCCTGG + Intergenic
959227324 3:103602787-103602809 CTGCCACCCATGACAGCCCCAGG - Intergenic
961288649 3:125827385-125827407 CCACCACCCAGCACAGTGCCTGG - Intergenic
961320204 3:126067967-126067989 TGCCGGCCCAGGACAGTCCCAGG + Exonic
961664232 3:128486300-128486322 CGTCCAGCCAGGGCAAACCCGGG + Exonic
961898414 3:130188645-130188667 CCACCACCCAGCACAGTGCCTGG + Intergenic
962174781 3:133141612-133141634 AGACCACACAGGTCAGTCCCTGG - Intronic
962662328 3:137615888-137615910 CCTCCACATAGGACAGTCACTGG + Intergenic
964377434 3:156063066-156063088 CCTCCACCCCCGACAGGCCCTGG + Intronic
968293229 3:197555071-197555093 CTCCCACCCTGGCCAGTCCCGGG + Intronic
968516904 4:1019267-1019289 CTCCCACCCAGGACAGGGCCAGG + Intronic
968568446 4:1327137-1327159 CGTTCTCCCAGAACAGCCCCGGG + Intronic
969563434 4:7963670-7963692 CCTGCACCCAGGACAGTGCCAGG + Intergenic
975244369 4:72102529-72102551 CCCCCACCCACAACAGTCCCCGG + Intronic
976102472 4:81580496-81580518 CGTCCACCCAGAACTGGCACTGG - Intronic
982988947 4:162246018-162246040 CCTCCACCCCTGACAGGCCCTGG + Intergenic
985024669 4:185728886-185728908 TGTGCACCCAGCACAGTTCCAGG - Intronic
986175668 5:5349903-5349925 TGTCCCCCCTGGACGGTCCCGGG - Intergenic
987566860 5:19600188-19600210 CCCCCACCCACGACAGGCCCCGG - Intronic
989697690 5:44222808-44222830 CCCCCACCCCCGACAGTCCCTGG - Intergenic
989846621 5:46152237-46152259 CCCCCACCCACCACAGTCCCCGG - Intergenic
993658924 5:90606384-90606406 CCACCACCTAGTACAGTCCCTGG - Intronic
994527982 5:100930242-100930264 CCTCAACCCATGACAGGCCCCGG + Intergenic
994780497 5:104083643-104083665 CCCCCACCCCCGACAGTCCCTGG - Intergenic
997454220 5:134005278-134005300 CATCCCCCGAGGGCAGTCCCAGG + Intergenic
998094669 5:139390506-139390528 CCTCCACCCAGGCCATACCCAGG + Intergenic
1001563711 5:172686371-172686393 CGGCCACCCTGCTCAGTCCCTGG - Intronic
1005235499 6:23757401-23757423 CCCCACCCCAGGACAGTCCCTGG + Intergenic
1005838318 6:29724047-29724069 CCTCCACCCGGGAGAGTCCCAGG + Intronic
1007794681 6:44338010-44338032 CGTCCTCCCAGGCCTCTCCCAGG + Intronic
1008871481 6:56277298-56277320 CCTCAACCCACGACAGGCCCCGG + Intronic
1011128557 6:84032363-84032385 CGCCCACCCCCGACAGGCCCCGG - Intergenic
1012489399 6:99764200-99764222 CGCCACCCCAGGACAGGCCCCGG + Intergenic
1012627734 6:101424720-101424742 CCCCCACCCACAACAGTCCCCGG + Intronic
1014281441 6:119446336-119446358 CCTCCACCTAGAACAGTGCCTGG + Intergenic
1019139765 6:169936005-169936027 GCTCCACCCAGGAGAGTGCCCGG + Intergenic
1019289942 7:245481-245503 CGTCCACCCAGGCCAGGCCCAGG - Intronic
1022806301 7:33825845-33825867 CTACCACCCAGCACAGTGCCTGG - Intergenic
1023140926 7:37101639-37101661 CTTCCACCGAGCACATTCCCAGG + Intronic
1023621173 7:42074669-42074691 CGTCCACCCAGGGCCCTGCCAGG + Intronic
1024318094 7:48040134-48040156 GGACCACCCAGGAGACTCCCTGG - Intronic
1027918356 7:84357289-84357311 CCTCCACCCACAACAGGCCCTGG + Intronic
1028508448 7:91595627-91595649 CATCCCCCCACAACAGTCCCCGG - Intergenic
1029112689 7:98221898-98221920 CGTCCACCCAGCACTGTGCCTGG + Intronic
1029709392 7:102291318-102291340 CCTGCACCCAGGACAACCCCAGG - Intronic
1030939008 7:115621482-115621504 TATGCACCCAGGACAGTGCCTGG + Intergenic
1033102371 7:138485507-138485529 CCTCACCCCATGACAGTCCCTGG + Intronic
1034058145 7:148058417-148058439 AAGCCACCCAGGACATTCCCAGG - Intronic
1035667661 8:1390968-1390990 CGTCCTGCCAGCACAGACCCTGG - Intergenic
1036782466 8:11659024-11659046 GGTGCAGCCAGGACAGTCCGGGG - Intergenic
1037879012 8:22564080-22564102 AGCCCACCCAGCATAGTCCCTGG + Intronic
1039546452 8:38414354-38414376 CCTCTACCCAGGGCAGTGCCAGG + Intronic
1040286006 8:46100749-46100771 AGCCCACCCAGGACAGCCCTGGG + Intergenic
1040294892 8:46144076-46144098 AGCCCACCCAGGACAGCCCTGGG + Intergenic
1040299401 8:46180182-46180204 AGCCCACCCTGGACAGTCCTGGG + Intergenic
1040300820 8:46187158-46187180 CGCCCACCCAGAACAGATCCAGG + Intergenic
1040301757 8:46191642-46191664 AGTGCACCCAGGACAGTCCCCGG - Intergenic
1040304745 8:46206233-46206255 GAACCCCCCAGGACAGTCCCAGG + Intergenic
1040307830 8:46221358-46221380 AGTCTGCCCAGGACAGCCCCGGG - Intergenic
1040308576 8:46224923-46224945 AGCACACCCAGGACAGTCCTGGG - Intergenic
1040315047 8:46256542-46256564 AGCCCACCCAGGACAGCCCTGGG - Intergenic
1040334339 8:46408485-46408507 AGTGCACCCAGGACAGCCCTAGG - Intergenic
1040335330 8:46413110-46413132 AGCCCAACCAGGACAGTCCTGGG - Intergenic
1040337675 8:46424315-46424337 AGCCCACCCAGGACAGCCCTGGG - Intergenic
1043385534 8:79744143-79744165 TGTGCACCCAGCACAGTCTCTGG - Intergenic
1043869733 8:85418998-85419020 CCCCCACCCATGACAGGCCCCGG + Intronic
1044717388 8:95113025-95113047 CGTCTACTCAGCACAGGCCCTGG - Intronic
1045164376 8:99586976-99586998 CATCCCCCCATGACAGGCCCCGG + Intronic
1046985181 8:120380155-120380177 CATACACCCAGCACAGTGCCTGG - Intergenic
1049514362 8:143045613-143045635 CCCCCACCCAGGACCCTCCCAGG + Intronic
1049521302 8:143092779-143092801 GGGCCAGCCGGGACAGTCCCTGG + Intergenic
1049590930 8:143462141-143462163 GGGCCACCCAGGACACTGCCAGG + Intronic
1051575661 9:18612472-18612494 TGTCCACCTAGAACAGTGCCTGG - Intronic
1052596924 9:30573290-30573312 CCTCCACCCCCGACAGGCCCTGG - Intergenic
1055728629 9:79258162-79258184 TGTCCACGCAGCACAGCCCCAGG - Intergenic
1056101644 9:83305561-83305583 AATGCACCCAGGTCAGTCCCAGG + Intronic
1056138343 9:83650373-83650395 CCTCAACCCATGACAGTCCATGG + Intergenic
1056935489 9:90912544-90912566 GGTTCATCCAGGACAGCCCCTGG - Intergenic
1057179431 9:93021835-93021857 CCTCCACTCAAGGCAGTCCCAGG - Intronic
1057897700 9:98922982-98923004 GGTTCTCCAAGGACAGTCCCTGG - Intergenic
1059999446 9:119944883-119944905 CGGCCACCTAGTACAGGCCCTGG + Intergenic
1061839375 9:133348648-133348670 CGCCCACCCAGGAGACACCCCGG - Intronic
1061890080 9:133614676-133614698 CCTCCCCTCAGGACAGTCTCTGG + Intergenic
1062225514 9:135447372-135447394 CGGCCAGGCAGGACAGGCCCGGG - Intergenic
1062326946 9:136017050-136017072 CGTCAGGCCAGCACAGTCCCAGG - Intronic
1062342817 9:136101264-136101286 CGTCCACACAGCCCAGTGCCTGG - Intergenic
1185608069 X:1378607-1378629 GGTCCCCCCAGGACGGCCCCCGG + Intronic
1185756595 X:2658507-2658529 CTTCCAGCCAGGATGGTCCCAGG - Intergenic
1186189225 X:7052789-7052811 GCTACACCCTGGACAGTCCCAGG + Intronic
1187491137 X:19752587-19752609 CATCCTCCCAGGAGACTCCCTGG - Intronic
1190606175 X:52145481-52145503 CCCCCACCCACAACAGTCCCTGG + Intergenic
1192893995 X:75420791-75420813 CCCCACCCCAGGACAGTCCCTGG - Intronic
1192903312 X:75522952-75522974 CTGGCACCCAGGACAGTACCCGG + Exonic
1192929772 X:75793601-75793623 CCTCCCCCCATGACAGGCCCCGG + Intergenic
1193811168 X:86053689-86053711 CCCCCACCCACGACAGGCCCTGG + Intergenic
1197438845 X:126465112-126465134 CCTCAACCCACAACAGTCCCCGG - Intergenic
1200522590 Y:4229840-4229862 CCCCAACCCATGACAGTCCCCGG + Intergenic