ID: 1152227315

View in Genome Browser
Species Human (GRCh38)
Location 17:79098464-79098486
Sequence CTTCATCTGCAAAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1398
Summary {0: 2, 1: 13, 2: 83, 3: 327, 4: 973}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152227315_1152227324 20 Left 1152227315 17:79098464-79098486 CCCTCCCCATTTTGCAGATGAAG 0: 2
1: 13
2: 83
3: 327
4: 973
Right 1152227324 17:79098507-79098529 AGCAACCTCCCGTCAGCAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 98
1152227315_1152227328 27 Left 1152227315 17:79098464-79098486 CCCTCCCCATTTTGCAGATGAAG 0: 2
1: 13
2: 83
3: 327
4: 973
Right 1152227328 17:79098514-79098536 TCCCGTCAGCAGCTGGGGAGTGG 0: 1
1: 0
2: 3
3: 27
4: 245
1152227315_1152227325 21 Left 1152227315 17:79098464-79098486 CCCTCCCCATTTTGCAGATGAAG 0: 2
1: 13
2: 83
3: 327
4: 973
Right 1152227325 17:79098508-79098530 GCAACCTCCCGTCAGCAGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 76
1152227315_1152227326 22 Left 1152227315 17:79098464-79098486 CCCTCCCCATTTTGCAGATGAAG 0: 2
1: 13
2: 83
3: 327
4: 973
Right 1152227326 17:79098509-79098531 CAACCTCCCGTCAGCAGCTGGGG 0: 1
1: 0
2: 2
3: 16
4: 146
1152227315_1152227321 -6 Left 1152227315 17:79098464-79098486 CCCTCCCCATTTTGCAGATGAAG 0: 2
1: 13
2: 83
3: 327
4: 973
Right 1152227321 17:79098481-79098503 ATGAAGAAACAGCCCTGGAGAGG 0: 1
1: 1
2: 6
3: 69
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152227315 Original CRISPR CTTCATCTGCAAAATGGGGA GGG (reversed) Intronic
900312218 1:2039211-2039233 CTTCATCCCTTAAATGGGGACGG + Intergenic
900508275 1:3041613-3041635 CTCCATCTGCAAAAAGTGGTAGG + Intergenic
900628478 1:3620922-3620944 CCTCAGCTGCCAAACGGGGAAGG - Intergenic
900656922 1:3763091-3763113 CTGCATCTGTAAGATGGGTAGGG - Exonic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901531208 1:9853635-9853657 CTTCATCTGTAAAACAGGGTAGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901785451 1:11621712-11621734 CTTCATCCATAAAATGGGCACGG - Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
901895224 1:12306225-12306247 CTTCATCTGTGAAATCGGGGCGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902411810 1:16216230-16216252 CTTTATCTGCAAGCTGGGGTTGG - Intergenic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902685925 1:18077632-18077654 CTTCATCGCTAGAATGGGGATGG + Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902759659 1:18572885-18572907 GTTTCTCTGCAGAATGGGGAGGG - Intergenic
903073421 1:20741653-20741675 CTTAACCTACAAAATGAGGAAGG - Intergenic
903124347 1:21237646-21237668 CATCATCTGCAATGTGGAGACGG - Intronic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903320225 1:22538721-22538743 CATCTTCTGTGAAATGGGGAGGG + Intergenic
903452696 1:23465404-23465426 CTTCATCTTTAAAATGGGAATGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903927613 1:26841821-26841843 CTTTATCTGTAAAATAGAGATGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904330455 1:29754997-29755019 TTTCTTCTGTAAAATGGGAATGG + Intergenic
904341038 1:29834787-29834809 CTTTATCTTTAAAATGGGGGAGG + Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904449942 1:30604744-30604766 CTTCATCTGTCAAATAGGGATGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904748419 1:32725507-32725529 CTTGGCCTGCAAGATGGGGATGG + Intergenic
904763723 1:32824928-32824950 CCTCATTTACAAAATGGGAAAGG - Intronic
904774407 1:32897947-32897969 CTTCATCTATCAAATGGAGATGG - Intronic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904918366 1:33986432-33986454 CTTCAGCTGTAAAATGGGCATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905370153 1:37478722-37478744 TTTCATCTGAAAAACAGGGAAGG + Intronic
905370625 1:37480828-37480850 CCTCATCTGAAACATGGGGTCGG + Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
905857154 1:41321676-41321698 CTTCTTCTGCACCATGGGGATGG - Intergenic
905861767 1:41356882-41356904 CCTCATCTGGGAAATGGGAATGG - Intergenic
905905972 1:41618739-41618761 CCTCATCTGGAAAATGGGCCAGG - Intronic
906002075 1:42435139-42435161 CTCCATCAGCAACATGGGGAAGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906526390 1:46495728-46495750 CTGAATCTGTAAGATGGGGATGG + Intergenic
906533009 1:46534133-46534155 CTTCATCTGAATAAGGGGGTGGG - Intergenic
906591361 1:47027261-47027283 CCTGATCTGATAAATGGGGAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
906899749 1:49821358-49821380 CTTCATCTGTAAAATTAAGATGG + Intronic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907315877 1:53572268-53572290 CTCCATCTGTAAAATGAGAATGG + Intronic
907318635 1:53588879-53588901 CTTCTTCTGTAAAATGGGCATGG + Intronic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907383704 1:54111699-54111721 TTTCATTTGCCAAATGAGGATGG - Intronic
907395129 1:54184419-54184441 CCTCATCTGAAAATTGGGAATGG - Intronic
907506928 1:54925938-54925960 CTTCTGCTGCAAAATGAGGGGGG - Intergenic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
907734524 1:57099014-57099036 CTTCATCTGTAAAACTGGGTTGG + Intronic
907739071 1:57146210-57146232 CATCATCTGGAAAATGGAAATGG - Intronic
907747986 1:57233809-57233831 CTTCCTCTGCAAACTGAGAAAGG + Intronic
907913252 1:58845552-58845574 TTTTATGTGCAAAATGGGGCAGG + Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908846807 1:68333023-68333045 CTTCATCTGTAAAATGACGGGGG + Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909606117 1:77509974-77509996 CTTCAGTTACAAAATGGGGGTGG - Intronic
910099910 1:83564643-83564665 TTCCATCTGCAAAATGGAAAGGG - Intergenic
910454943 1:87387574-87387596 CATCATCTGCAAAACAGAGATGG + Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910725862 1:90338100-90338122 CTTCATCTACAAAATGATGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911532839 1:99065984-99066006 CTCAAATTGCAAAATGGGGAGGG - Intergenic
911708117 1:101038994-101039016 CAGCATGTGCAAAATGGTGATGG - Intergenic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912472846 1:109917384-109917406 CTGCAGCTGCACAATGGCGATGG - Exonic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
913015566 1:114730528-114730550 CTTCATCTGCAATATGGAGCTGG + Exonic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
914858756 1:151370153-151370175 CATCCTCTGTAAAATGGAGATGG + Intronic
914871302 1:151477042-151477064 CTTTATCTGCAAACAGGGGCAGG - Intergenic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915456342 1:156043360-156043382 CTTCATCTCCAGGATGAGGAAGG - Intronic
915555420 1:156658249-156658271 CTACACCTGCAAGATGGGGCTGG + Exonic
916025681 1:160831502-160831524 TTAAATCTGTAAAATGGGGATGG - Intronic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916988970 1:170221510-170221532 CTTCATCTGTAAAACAGAGATGG + Intergenic
917051314 1:170927302-170927324 TTTCATCTGCAAATTAGGAAAGG + Intergenic
917470661 1:175323417-175323439 CTTCATTTCCACAAAGGGGATGG + Exonic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917522450 1:175759503-175759525 CTTCCTCTGCAACCTGTGGAGGG + Intergenic
917634936 1:176926191-176926213 CGTTATCTATAAAATGGGGAGGG + Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918118376 1:181516441-181516463 CTTCATCTGTAAAATGGGACTGG - Intronic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
918639321 1:186819870-186819892 CTGCTTATGCAAAATGGTGAAGG + Intergenic
918966825 1:191361838-191361860 CTTCAGATGCAAAATAGGTACGG - Intergenic
919022621 1:192126757-192126779 CTTCATTTGCAAGCTGGGGCTGG + Intergenic
919631478 1:199964180-199964202 CTTCCTCTGTAAAATGGGTGGGG + Intergenic
919753934 1:201054825-201054847 CTGCATCTCCAAAATGAGAAGGG - Intronic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920534239 1:206727314-206727336 CTTCCTTTGTAAAGTGGGGATGG - Intronic
920562176 1:206946741-206946763 TTTCATCTGGAAAAGAGGGATGG + Intergenic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921232773 1:213089756-213089778 CTTTAACAGCAAAATGGGGCCGG - Intronic
921300178 1:213744579-213744601 CTTTATCTGTAAAATGGGGCTGG + Intergenic
921383457 1:214548125-214548147 CTTCATCTGCAAAATGGATCTGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921639111 1:217530321-217530343 CTTCATCTACAAAATGGGGGTGG + Intronic
922053166 1:222014440-222014462 CTTTACCTGTAAAATGGAGAGGG - Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924013454 1:239693185-239693207 CTTCATGAACAAAAAGGGGATGG - Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1063068248 10:2631999-2632021 TTTCATCTTGAAAATGGGCAAGG - Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1064120510 10:12614175-12614197 CCTTATCTCCAAAATGGGCATGG + Intronic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1067468798 10:46521527-46521549 CTACTTCTGACAAATGGGGATGG + Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068709920 10:60122604-60122626 CTGCATTTTCAAACTGGGGATGG + Intronic
1068715062 10:60178904-60178926 CTTCAAATGCAAAAGGGGGGTGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069694215 10:70374930-70374952 CTTCATCTATAAAATGGGAATGG - Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1069892016 10:71657867-71657889 CTTTATCTGCAGCCTGGGGAGGG + Intronic
1070333598 10:75435241-75435263 CTTCTTCAGCAAAAGGGAGACGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070684691 10:78471993-78472015 CTTCATTTTTAAAATAGGGAGGG - Intergenic
1070726567 10:78795516-78795538 TATCATCTGTAAGATGGGGATGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1071261413 10:83922717-83922739 CTGCATGTCAAAAATGGGGAAGG + Intergenic
1071277153 10:84065729-84065751 CTCCATCTGCAAAATGGTGGTGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071792201 10:88966699-88966721 CCTCATCTGCAAAATGACAATGG + Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072656180 10:97332141-97332163 GTTTTTGTGCAAAATGGGGAGGG - Intergenic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074407611 10:113192632-113192654 CTTCAGCTCCATAATGGGAATGG + Intergenic
1074455982 10:113595414-113595436 TTTTATCTGCAAAATGGTAATGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074662951 10:115682990-115683012 CATCTTCTGTAAAAGGGGGATGG + Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075247805 10:120839582-120839604 CTTCATTTACAAAATGGGGTTGG + Intergenic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1075672505 10:124272159-124272181 TTTCATCTGGATAAAGGGGAGGG + Intergenic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1078974550 11:16457538-16457560 CTTCATCTGTTAAATGGGTATGG - Intronic
1079004016 11:16779961-16779983 TTTCATCTCTAAAACGGGGAGGG + Intronic
1079016026 11:16869445-16869467 CTTCATCTCTAAAATGGTGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1080911225 11:36601083-36601105 CTCCATTTATAAAATGGGGATGG - Intronic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1081760798 11:45575346-45575368 CTTTATCTCTAAAATGGGGGTGG - Intergenic
1081858469 11:46318456-46318478 CTTCATCTAGAAAATGGGAGTGG + Intronic
1082943380 11:58732405-58732427 CTGCAGCTTCAAAATGGGCATGG - Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083195503 11:61083437-61083459 CTTCATCTGCAAAGCAGGGGAGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275884 11:61596876-61596898 CTCCACCTGTAAAATGGAGATGG - Intergenic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083502998 11:63128685-63128707 CCTCAGCTGCCAAATTGGGAAGG + Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083856683 11:65396502-65396524 CTTCCTTTGCAGAGTGGGGATGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084966642 11:72748078-72748100 CCTCATGTGGAAAATGGGAATGG + Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085130255 11:74032168-74032190 CTTCACCTGTAAAATGGAGGCGG - Intronic
1085196717 11:74677087-74677109 CTTCAGCTGGAAAATGGGGGTGG - Intergenic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085477883 11:76799196-76799218 CCTCCTCTGCAAAACGGGGCAGG + Intergenic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085636590 11:78163943-78163965 CTTCCTCGGCAAAATGTGCAAGG - Intergenic
1085706166 11:78788389-78788411 CTTCAGCTGTAAAGTGGGAAGGG + Intronic
1085782628 11:79423298-79423320 CTTCATCTGTACAATGGCGGGGG - Intronic
1085798818 11:79568283-79568305 CCTAATCTGAAAAATGGAGATGG + Intergenic
1085911680 11:80834365-80834387 CTTCATTTCACAAATGGGGAAGG + Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086157127 11:83679797-83679819 CTTTATCTGTAAAATGGAGGAGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086270327 11:85055685-85055707 ATTCATTAGCAAAGTGGGGAAGG + Intronic
1086325706 11:85696669-85696691 CTTCATCTATAAAATGGGAATGG + Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087101428 11:94369048-94369070 CTTCAGCTGAAATATGAGGAAGG - Intergenic
1087706102 11:101493626-101493648 TTTCATGTGCAAAATGGGAACGG - Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088090729 11:106036239-106036261 CCTGATCCACAAAATGGGGAGGG + Intergenic
1088504810 11:110517270-110517292 CTTCATCTCTAAAATGGGACTGG - Intergenic
1088642766 11:111889396-111889418 CTCCCTCTGGAAAATGGTGAAGG - Intergenic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089172621 11:116525993-116526015 CTTCCTCTGCAAGCTGGAGAAGG + Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1089995203 11:122900099-122900121 CTTCTTCAGCAAAATGGGAATGG - Intronic
1090144358 11:124304425-124304447 CGTCATCTGATAAATGGAGAAGG - Intergenic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090429795 11:126636143-126636165 CTTCATTTGTAAAAATGGGAAGG + Intronic
1090621689 11:128566415-128566437 CTTCATCTGTAAAATAGGCATGG - Intronic
1090641734 11:128735071-128735093 CTTCATCAGCAAAGTGGGGGAGG + Intronic
1091099105 11:132853847-132853869 CTTCATCACCAAAATGTGCAGGG + Intronic
1091155884 11:133372377-133372399 TTTCATCTGAAAAATTGGTAGGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091650559 12:2305982-2306004 CTTCAACTGTAAAGTGGAGAAGG - Intronic
1091869288 12:3873712-3873734 CTTCATCCTCAAAATGGAGATGG + Intergenic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092072950 12:5648122-5648144 TTTCATCTGTAAATTGGGCACGG + Intronic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1092815648 12:12310387-12310409 CTGCTTCTCCAACATGGGGATGG - Intergenic
1092984594 12:13833731-13833753 CTGCATCTGTAAAATGGGGTAGG - Intronic
1093156950 12:15697506-15697528 ATTCATCTGTAAAGTGGGAATGG - Intronic
1093395020 12:18670531-18670553 CTTCATCTGCAAAATCTCCAGGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1093673540 12:21905815-21905837 CTTCATCAGTAAAATGAAGATGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1096070143 12:48770770-48770792 CTTCATCTGGAAATTGTTGAAGG + Exonic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097811393 12:64023058-64023080 CTTTATCAGTGAAATGGGGATGG + Intronic
1097822936 12:64145873-64145895 CTTCATGTGCAATTTGGGGAGGG + Exonic
1097900213 12:64865500-64865522 CTTACTATGCAAAATAGGGATGG + Intronic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098420865 12:70296160-70296182 CTATATCTGAAAGATGGGGAGGG - Intronic
1098491107 12:71079927-71079949 CTTCATTTGTAAAATAGAGATGG + Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098842969 12:75499229-75499251 CTAAATCTGCAAAATGAGCAAGG + Exonic
1099273671 12:80547874-80547896 CTTCATCTGTAACATGGGAATGG - Intronic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100883167 12:99040627-99040649 CTTAACCTGTAAAATGGGAATGG + Intronic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101438491 12:104684433-104684455 TATCATCTGTAAAAAGGGGATGG + Intronic
1101659724 12:106754887-106754909 CTCCATCTGTAAAATGGGGTGGG + Intronic
1101722571 12:107362891-107362913 CCTCATCTACAAAATGGAAATGG - Intronic
1101750207 12:107577269-107577291 CTTCACCTGTAAAGTGGGGTGGG - Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101842354 12:108337355-108337377 CACCATCTGTAAAATGGGGTGGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102199294 12:111046415-111046437 GTTCATCTGTAAAATGGGAATGG - Intronic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102639752 12:114356324-114356346 CTTCATCTGTAAGATGGAAAGGG + Intronic
1102714606 12:114959445-114959467 CTTCATTTATAAAATGGGGGAGG - Intergenic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1102730375 12:115103849-115103871 CTTCAGTTGCAAAAGGGAGATGG - Intergenic
1102751117 12:115295567-115295589 CAACATCTGAAAAATGGGAAGGG - Intergenic
1102782110 12:115574283-115574305 CTTCATCTGCATAACAGGGCTGG - Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1102866409 12:116378480-116378502 CTACATCTGGAAAATGGGGCTGG + Intergenic
1102912558 12:116728734-116728756 CTTCCTCTGTAAAATGGAGATGG - Intronic
1103042353 12:117705908-117705930 ATTCTTCTGTAAAATGGGGCTGG + Intronic
1103042420 12:117706376-117706398 CTCCATCTGTGAAATGGGGTTGG - Intronic
1103139454 12:118535928-118535950 CTTCATCTGCAACATGGGTTTGG - Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103475694 12:121216961-121216983 CCACTTCTGCCAAATGGGGATGG - Exonic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103598643 12:122040116-122040138 CTCCATCTGTAAAATGCGGTTGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105618954 13:22048423-22048445 CCTCATCTGCCAAATGGACATGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106415891 13:29545453-29545475 CTACGTGTGTAAAATGGGGATGG + Intronic
1106974778 13:35196613-35196635 TTTCATGTACATAATGGGGAAGG + Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108687399 13:52832597-52832619 CCACATCAGCAAAATGGGAATGG + Intergenic
1108967330 13:56326109-56326131 GTACATCTGTAAAATGGGGGTGG + Intergenic
1109862170 13:68214238-68214260 CTTCATCTGTAAAATGAAGTGGG + Intergenic
1110105223 13:71666393-71666415 CTGCATCTGCAATATGGCCATGG + Intronic
1110167436 13:72460324-72460346 CTTGGTCTGTAGAATGGGGAGGG + Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111771046 13:92596100-92596122 CTTCATCTGAAAAATTAAGAGGG - Intronic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1113082271 13:106532808-106532830 CTTCATCATCAGAATGGGGGGGG + Intronic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113673666 13:112194031-112194053 GTTTATCTACAAAATGAGGAAGG - Intergenic
1113963829 13:114140508-114140530 CTTCGTCTGTAAAATGGGGCTGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1115378977 14:32711878-32711900 CTTCATCTGTAAAGTGAGGGGGG + Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116526459 14:45911660-45911682 CTGCATCTTCAAGATGGTGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116853935 14:49935508-49935530 CTCCATCTGTAAAATGAAGATGG + Intergenic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1117947876 14:61049467-61049489 CTACATCTTTAAAATGGGGATGG - Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118289705 14:64508320-64508342 CTTCAGATTCAAAGTGGGGATGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118398818 14:65360921-65360943 ATTGTTCTGCAAAATGGGGATGG + Intergenic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118743703 14:68759068-68759090 CTTCATGTGTAAAATGCAGAGGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1119113903 14:72000473-72000495 CTTCATCTTCAAGATGGGGTTGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1119895321 14:78214976-78214998 CTTCGTCTGTAAAATGGGGGTGG + Intergenic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120679848 14:87467646-87467668 CTTCATCTGTGAAATAGGAATGG + Intergenic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121230809 14:92356565-92356587 CTCCAACTGTAAAATGGAGATGG + Intronic
1121265146 14:92597046-92597068 CCTCATCTAGAAAATGCGGATGG + Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121444374 14:93969411-93969433 CTCCATCTGTAAAATGGACAAGG + Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121643639 14:95502649-95502671 TTCCTTCTGCAAAATGGAGATGG - Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1123899608 15:24863205-24863227 CTACATCTGCAAAATGGCTGAGG - Intronic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124689135 15:31807185-31807207 TTTCACCTGCAAAATGGGAACGG - Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1125903867 15:43371993-43372015 CTTAATCTGTAAAATGGATAAGG - Intronic
1126414890 15:48407150-48407172 CTTCATTTATGAAATGGGGATGG + Intergenic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127631935 15:60835627-60835649 CTTCACCTGTAAAATAGAGATGG - Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128555296 15:68627643-68627665 CTTCATCTGCAGGATGGGACGGG + Intronic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1128691966 15:69731455-69731477 CATCAACTGTAAATTGGGGAGGG + Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1129328680 15:74815748-74815770 CGTCATCTGAGAAATGGGAAGGG + Intronic
1129368419 15:75071173-75071195 CTTGAGCAGCAAGATGGGGATGG + Intronic
1129678698 15:77646001-77646023 CTCCATCTGCAAAGCAGGGATGG + Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1129877807 15:78988194-78988216 CTTCATCCACAAAGTGGGCATGG + Intronic
1130123903 15:81076131-81076153 CTTCAATTGCAAAATTAGGAAGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130430933 15:83846293-83846315 CTCCATTTGTTAAATGGGGAGGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130927039 15:88393300-88393322 CTTTATCTGTAATATGAGGATGG + Intergenic
1131156187 15:90077179-90077201 CTTAATAAACAAAATGGGGACGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131528276 15:93170201-93170223 CTAAATCTGCAAATTGGGGCGGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132125495 15:99220527-99220549 CTGAATCTACAAAATGGGGTGGG + Intronic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132816366 16:1829383-1829405 CTTCATCTGAGTAATGGGGATGG - Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133331787 16:4979402-4979424 CTCCATCTGTCAAATGCGGAGGG + Intronic
1133333963 16:4994756-4994778 CGACCTGTGCAAAATGGGGAAGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133777186 16:8905980-8906002 CCTCATCTGCCAAATGAGTATGG + Intronic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134233032 16:12443842-12443864 CTTCACTTGCAAAAAGGGTATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134517455 16:14898667-14898689 CTTTCTCTGAAAAATGGGGCTGG - Intronic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1134705123 16:16297318-16297340 CTTTCTCTGAAAAATGGGGCTGG - Intergenic
1134771506 16:16813233-16813255 CTTCATCTGTATAATGGTGGTGG - Intergenic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134819414 16:17234138-17234160 TTTCCTCTGCAAAATGGGCGTGG - Intronic
1134962418 16:18414796-18414818 CTTTCTCTGAAAAATGGGGCTGG + Intergenic
1134966715 16:18497395-18497417 CTTTCTCTGAAAAATGGGGCTGG + Intronic
1134978400 16:18588673-18588695 TTCCATGTGCAAAATGGGGTCGG - Intergenic
1135155538 16:20049769-20049791 CTTTATCTGTAAAGTGGGGATGG + Intronic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135194402 16:20382751-20382773 TTCCATCTGTTAAATGGGGATGG - Intronic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1135893180 16:26375193-26375215 CTTCATCTGCAAGGTGGAGATGG - Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136099156 16:27980567-27980589 CTTCATCTGTAAAATGGGTGTGG - Intronic
1136237369 16:28923002-28923024 CTTCCTCTGTAAAATGGAGATGG + Intronic
1136369355 16:29826251-29826273 CCTCATCTACAAAATGAGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136624834 16:31456000-31456022 CTTCATCTGTAAAACAGGGATGG - Intergenic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136863164 16:33714656-33714678 CTACATTTGGAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137291738 16:47056129-47056151 CTTTGTCTGTACAATGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138342799 16:56301880-56301902 CTTCGTCTGTAAATTGGGGGTGG - Intronic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1139416134 16:66812279-66812301 CTTCATGTGTAAAATGGGGCCGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140071134 16:71650834-71650856 CTTCATCTGTAAAATGAAAATGG + Intronic
1140739801 16:77931007-77931029 CTAAATCTGTAAAATGAGGAGGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141010093 16:80388971-80388993 CTTCAGATGCTAAAGGGGGAGGG + Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141483349 16:84321898-84321920 CTTGATCTGTAAAATAGAGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1141759984 16:86021949-86021971 CTTCATCTGTCAAACAGGGAGGG - Intergenic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142246865 16:88974199-88974221 CTTCTTCTGCAAAGTGGGCTTGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1203124656 16_KI270728v1_random:1562809-1562831 CTACATTTGGAAAATGGGGATGG - Intergenic
1142605808 17:1080457-1080479 CTCCGTCTGCCAAGTGGGGATGG - Intronic
1142640939 17:1285708-1285730 CTCCATCTAAAAAATGGGAAGGG + Intronic
1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG + Intronic
1142928793 17:3264928-3264950 CTTCATGTGCAACATGGGGGTGG - Intergenic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143258598 17:5582452-5582474 CCCCATCTGCCACATGGGGAGGG + Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143439304 17:6956110-6956132 CTTCATCCATAAAATGAGGATGG + Intronic
1143960102 17:10709966-10709988 TTTCATCTGAAAAGTGGGTATGG + Intronic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145198975 17:20922612-20922634 CTTCCTTTGCAAGTTGGGGAGGG - Intergenic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145907844 17:28526025-28526047 CCTCATCTGCAACACGGGTATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146270996 17:31485783-31485805 CTTCATCTGTAAGATGGGAATGG - Intronic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1146637649 17:34518189-34518211 CTGCATCTGTTAAATGGGGATGG + Intergenic
1146660842 17:34664370-34664392 CTTCCTCTGGAAAATGGGACTGG - Intergenic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147043591 17:37736434-37736456 CTTCATCTGTAAAATGGAGGTGG - Intronic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147171128 17:38619575-38619597 CTTCATCTGTAAAATGGGCCTGG + Intergenic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147743580 17:42682215-42682237 TTTCATCTGCAAAGTGGAGTAGG + Intronic
1147887587 17:43694928-43694950 CTTCATCTGTAAAATAGGATAGG + Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148681956 17:49479235-49479257 CTGCATCTGTAAGATAGGGAGGG + Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148922565 17:51051821-51051843 CTCAATCTGTAAAATGGGAATGG + Intronic
1148986659 17:51628434-51628456 CCTCCTCTGCGAAATGGGGGAGG - Intergenic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149329132 17:55563467-55563489 ATTTATCTGTAAAATGGGGGTGG + Intergenic
1149440064 17:56666370-56666392 CCTCTGCTGCAAAGTGGGGAGGG + Intergenic
1150134588 17:62688938-62688960 CTTCATCTGCCAGAAGGGCACGG + Exonic
1150285431 17:63951313-63951335 CTCCAGCTGTAAAATGGGGGTGG - Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1150438334 17:65171354-65171376 CTCCATCTGAATAACGGGGATGG - Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151327991 17:73390650-73390672 CTTCAGCTGCCACCTGGGGAGGG + Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151701082 17:75742891-75742913 CTCCATCTGTAAAATGGGTAAGG + Intronic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1151877306 17:76874172-76874194 TTTCCTCTGGTAAATGGGGATGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152609469 17:81308491-81308513 CTCCATCTATAAAATGGAGAGGG - Intergenic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152705383 17:81840980-81841002 CTGCCTCTGCAAAACGGGAAAGG + Intergenic
1153170369 18:2309519-2309541 CTCCATCTGCAAAATGGAGCTGG - Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153760804 18:8330137-8330159 TTTCTTCTGTAAAATGGGGTAGG - Intronic
1153774471 18:8440576-8440598 ATGTATCTGTAAAATGGGGAGGG - Intergenic
1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG + Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1155120329 18:22812832-22812854 CTCCTTCTGCAAGATAGGGAAGG + Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155159225 18:23182369-23182391 CTGCATCAGCAAACTTGGGATGG - Intronic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155242575 18:23877611-23877633 CTTCCTCTGCAAGATGGGACAGG + Intronic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156190923 18:34719425-34719447 CTTCATCTGTAAAATAAAGATGG - Intronic
1156197534 18:34791868-34791890 CTTCATCTATGAAATGGGGCTGG - Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157165382 18:45354036-45354058 CTTCATCTGTAAAATATTGAAGG + Intronic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157229679 18:45903334-45903356 ATTCATCTGTAAAATGGTGCTGG - Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157514905 18:48304005-48304027 CTTCATCTGCAAGATGGGGGTGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157547289 18:48555435-48555457 CTTCCTCTGCAAAGTGGGTCAGG - Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1157987240 18:52452045-52452067 CTCTATCTGCAAACTGGGGCAGG - Intronic
1158451384 18:57568970-57568992 CCTCAGCTAGAAAATGGGGATGG - Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159052042 18:63429418-63429440 CTGCATCTGTAAAATGGGGGTGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159459417 18:68704926-68704948 TTTCATCTATAAAATGGGAAAGG + Intronic
1159485990 18:69057793-69057815 GTTTATCTGCAAGATGGGCATGG - Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160075734 18:75674834-75674856 GTTTATCTGCAACATGGGGCAGG + Intergenic
1160268973 18:77366757-77366779 TTTCATTTACAAAATGGGTAAGG - Intergenic
1160495897 18:79374961-79374983 TTGCATCTGCAAACTGGAGACGG + Intronic
1161067087 19:2243983-2244005 CCTCATCTGGAAGACGGGGACGG - Intronic
1161394090 19:4035485-4035507 CTGCATTTGTAAAATGGGGCTGG + Intronic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1161692568 19:5745320-5745342 CTACATCTTCAAAATGAGGCCGG + Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162107416 19:8378429-8378451 CTGCATTTGGAAAATGGGGATGG + Intronic
1162365039 19:10243440-10243462 CTTCATCTTTAAAATGGGATTGG - Intergenic
1162416774 19:10543462-10543484 CCTCATGTGCAAAATAGGGCTGG - Intergenic
1162475489 19:10896928-10896950 CTTCATTTGCAAAACCCGGAAGG - Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162982258 19:14247759-14247781 CTTCAAATGCAAAATCGGGCTGG + Intergenic
1163172836 19:15544407-15544429 CTTCAGCTACAAAATGGGGGTGG + Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1163584776 19:18157632-18157654 ATCAATCTGCAGAATGGGGAGGG - Intronic
1163748631 19:19062577-19062599 CTTCATCTTCAGGATGGAGAGGG - Intergenic
1163834925 19:19567456-19567478 CTCCAACTGCAAAGTAGGGAGGG + Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1165362901 19:35347617-35347639 CTCCATCTGTAAAGTGGAGAGGG + Intergenic
1165541177 19:36492889-36492911 CTTCAGCTGCCAAACAGGGAAGG - Intergenic
1166064547 19:40349545-40349567 CTTCATCTGCAAAATGCACACGG + Intronic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166135156 19:40772314-40772336 CTTCATCAGTAATATGGGGCAGG + Intronic
1166156953 19:40920906-40920928 CTCCATCTATAAAATGGGGATGG + Intergenic
1166166020 19:40989380-40989402 CTCCATCTATAAAATGGGGATGG + Intergenic
1166796676 19:45430380-45430402 CTTCATCTCTAACATAGGGATGG - Intronic
1166797390 19:45435318-45435340 CTCCCTCTGTAAAATGGGCATGG - Intronic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167419196 19:49393359-49393381 CTTCCTCTGGAAAATGGGGTTGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168331536 19:55572678-55572700 CTGCATCCAGAAAATGGGGAGGG + Intergenic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
1168345162 19:55647098-55647120 GTTAATCTGTAAAGTGGGGAGGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926389836 2:12378148-12378170 TTTCATCTGCAAAATAGAGATGG + Intergenic
926549674 2:14286717-14286739 CTGTATTTGGAAAATGGGGATGG - Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926861685 2:17316831-17316853 CTTCACCTGATAAATGGGGTAGG + Intergenic
926908710 2:17829685-17829707 TTCCATCTGTAAAATGGAGATGG - Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927653732 2:24928394-24928416 TTTCATCTGTAAAATGGATATGG - Intergenic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
930613090 2:53564644-53564666 CTTCATCTGTAAAACAGAGATGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931633658 2:64323034-64323056 CACCAGCTGCAAAATGGGGGTGG + Intergenic
931888128 2:66640836-66640858 ATCCATCAGCAAAATGGTGATGG + Intergenic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932449427 2:71800133-71800155 CTTCATTCACAAAATGGGGATGG - Intergenic
932461450 2:71884405-71884427 CTTCATCTGAAAACTGGAGGTGG - Intergenic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932910110 2:75797393-75797415 CCTCATCTGAAAAACGGAGATGG + Intergenic
933267164 2:80193485-80193507 CTGCATCTGTAAAATGGAGAAGG - Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
934896655 2:98125477-98125499 CTTCATCTGTAAACTGGGCATGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937204152 2:120224894-120224916 CTTCATCTGTGAAATGGGCTTGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937228675 2:120384336-120384358 TTTCATGTGCAAAATGGGGCTGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937365752 2:121260139-121260161 CTTCATCTCTGAAATGGGCACGG - Intronic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
937969229 2:127536562-127536584 CGTCCTCTGTGAAATGGGGATGG - Intronic
938014394 2:127855667-127855689 CAGCATCAACAAAATGGGGATGG + Intronic
938049916 2:128159642-128159664 CTTCATCACCAAAATGGCCAAGG + Exonic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938628273 2:133135735-133135757 TTTCCTCTGCATACTGGGGACGG + Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
939621127 2:144420482-144420504 CTTCAGCTGAAAAATGAGGGTGG - Intronic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
941215939 2:162709117-162709139 TATCATCTGCAAAATAGAGACGG + Intronic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
944568350 2:201015301-201015323 TTACTTCTGCAAGATGGGGAGGG - Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944617039 2:201471532-201471554 CCTCATCTGCGAAATGGGAGTGG - Intronic
944877102 2:203973349-203973371 CTTCCTCTACACACTGGGGAAGG + Intergenic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
945147155 2:206750334-206750356 TTTCATCTGCAAAGTGGAAATGG - Intronic
945147160 2:206750401-206750423 TTTCATCTGCAAAGTGGAAATGG + Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945755934 2:213847070-213847092 CTTCATCTTCAAAATAGGCTAGG + Intronic
945827487 2:214741627-214741649 CTTCAACATCAAAATGGTGAGGG - Intronic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947806553 2:232972615-232972637 TTTGATCTGTAAAATGGGTATGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
1168838117 20:891297-891319 CTCTATCTGCCAAATGGGGCTGG + Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169637281 20:7706408-7706430 ATCCATCAGCAAAATGGAGAAGG + Intergenic
1170057726 20:12225222-12225244 CTTCATCTGTGAAATGAGTACGG + Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170401481 20:15989027-15989049 CTTCATCTGTAAGATGATGATGG + Intronic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1171490986 20:25516975-25516997 CCTCATCTGAATAATGGGTATGG + Intronic
1172114312 20:32564668-32564690 CTTCATCTGTAAAATGGGCTAGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172186467 20:33034176-33034198 CTTCACCTTCAAACTGGGAAGGG - Exonic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173054422 20:39597479-39597501 CAACATCTGCAAAAGGGGGTTGG - Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173338051 20:42129099-42129121 CTTAATCATTAAAATGGGGATGG + Intronic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173380965 20:42540849-42540871 CTTCATCGGGAGGATGGGGAAGG + Intronic
1173468614 20:43304266-43304288 CTTCATCTTAAAGTTGGGGAAGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173580091 20:44141002-44141024 CTCCATCTGAAAGATGGAGAAGG + Intronic
1173748372 20:45455875-45455897 ATGCATCTGTAAAATGGGGTTGG + Intergenic
1173795130 20:45854596-45854618 CTTCAGCTGTAAAATGGAGAAGG - Intronic
1173818788 20:46007721-46007743 CTTCAACTGCAAATTGGGGCAGG - Intergenic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174124433 20:48292597-48292619 CTTTCTCTGCAACATGGAGAGGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174709405 20:52688968-52688990 CTGCATCTGTAAAACGGGGGGGG - Intergenic
1174993896 20:55544104-55544126 CCTCAACTGCAAGGTGGGGAAGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175072268 20:56344421-56344443 CTTCATCTGCAAAATCGAAATGG + Intergenic
1175183428 20:57164512-57164534 CTTCATCTGTGACATGGGTATGG - Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175311192 20:58012605-58012627 CTTCGTCTATAAAATGGTGATGG - Intergenic
1175465749 20:59190506-59190528 CCAGATCTGCAAAATGGGCAAGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175572385 20:60033851-60033873 TTTCCTCTGCAAACTGTGGATGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1176118568 20:63444045-63444067 CTTTGTCTGCAGAATGGGCAGGG - Intronic
1176265103 20:64205149-64205171 CTCCATCTGCAGAGTGGGCAGGG - Intronic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179237696 21:39562127-39562149 CTTCATCTATAAAATGATGATGG + Intronic
1179293523 21:40040753-40040775 CTGCATCTGTAAAATGGGAATGG - Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1180826102 22:18862935-18862957 TTTCATCTATAAAATGGGCATGG + Intergenic
1181186630 22:21111616-21111638 TTTCATCTATAAAATGGGCATGG - Intergenic
1181212570 22:21298878-21298900 TTTCATCTATAAAATGGGCATGG + Intergenic
1181540075 22:23568195-23568217 CTTCATCTTAAAAATGGAGCTGG + Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181949392 22:26543075-26543097 CTTCAGCTGCAAAATCAGGGTGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182115727 22:27755220-27755242 CCTCATCTGCAACTTGGGGGTGG + Intronic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182159011 22:28103284-28103306 CTTCATTTGCAAGAAGAGGAAGG + Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182287574 22:29257419-29257441 CTTCACCTGTAAAATGGCCACGG - Intronic
1182427987 22:30284931-30284953 CCTCGTCTGGAAAATGGTGATGG + Intergenic
1182580173 22:31303622-31303644 CTTTATCTGTAAAATGGATAGGG + Intergenic
1182623130 22:31628702-31628724 GTACATCTGGAAAATGGGAAAGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183424664 22:37733115-37733137 CCCCTTCTGAAAAATGGGGATGG - Intronic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1183594403 22:38801669-38801691 CTTCATCTATAAAATGGGAAGGG + Intergenic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183711192 22:39504499-39504521 ATACATCTGTAAGATGGGGATGG - Exonic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184043125 22:41956311-41956333 CTACATCTATAAAATGGGAATGG - Intergenic
1184330339 22:43823255-43823277 CTCCATCTGCAAAGTGAGGTGGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184384835 22:44168079-44168101 CTTCATCTGTAAAATGGGCCTGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184581754 22:45422677-45422699 CTTCTTCTGTAACATGAGGATGG + Intronic
1184628957 22:45760698-45760720 CCTCATCTGCAACATGGGAGAGG - Intronic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1203276244 22_KI270734v1_random:88841-88863 TTTCATCTATAAAATGGGCATGG + Intergenic
949102973 3:168209-168231 TTTTATCTACAAAATGGTGAAGG - Intergenic
949317067 3:2768849-2768871 CTACATGTGTAAGATGGGGATGG - Intronic
949441636 3:4087377-4087399 CTCCACCTGCAAGATGGGAATGG - Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949707288 3:6833866-6833888 TTTCATCTGAAAATTGGAGAAGG - Intronic
949741604 3:7240698-7240720 CTTCATGTGGAAGAGGGGGAGGG - Intronic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
949876251 3:8627901-8627923 CTTCATCTGTAAAATGGTGCGGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950611695 3:14131124-14131146 CTTCGTGTATAAAATGGGGACGG + Intronic
950630602 3:14279385-14279407 CTACAGGTGCAAGATGGGGAGGG + Intergenic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711022 3:14812764-14812786 CTTTATCTGAAAAATGGGGTTGG + Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951821701 3:26821108-26821130 CTTCCTCTGCAAACTGGTAAAGG + Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
952912847 3:38205143-38205165 CTACTTCTGGGAAATGGGGAAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953079239 3:39599955-39599977 CTCCATCTGACAAATGGGAATGG - Intergenic
953203412 3:40798424-40798446 CTTCATCCATAAAATGGGGATGG + Intergenic
953210565 3:40871448-40871470 CTGCATCTGCAACAGGGGGCAGG - Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953904584 3:46862064-46862086 CTTTACCTGCAACCTGGGGATGG + Intronic
953975106 3:47376489-47376511 CTACATTGGTAAAATGGGGAAGG + Intergenic
954139655 3:48598348-48598370 CTGCCTCAGGAAAATGGGGAGGG + Intergenic
954260393 3:49434469-49434491 CTTCATCTCAAAAATGCGGCCGG + Intergenic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954635287 3:52067888-52067910 TTCCATCTGAAAAATGGGAAGGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955510458 3:59675574-59675596 CTTTATCTGCAAAATGGGAGTGG - Intergenic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
956029159 3:65018424-65018446 CTTCAACTGCAAAATAGAAATGG - Intergenic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956971680 3:74533550-74533572 TTTCATCTGTAACATGGGGGTGG - Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959461745 3:106635101-106635123 CTTCATTGGTAAAATGGAGAGGG + Intergenic
960031358 3:113058113-113058135 CTTCATCTGCAAGATGGGTGGGG - Intergenic
960376744 3:116911760-116911782 CTTCAACTGGAAAATGAGAAAGG + Intronic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
961404071 3:126666636-126666658 GTTCATCTGCAACATGGAGATGG - Intergenic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962471088 3:135709971-135709993 CTTCATCTGTAGAATGGGTGTGG - Intergenic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963843276 3:150130012-150130034 CTACATCTGTAGAATGGAGATGG + Intergenic
964116082 3:153137689-153137711 CTTCACATGGCAAATGGGGAAGG - Intergenic
964174174 3:153805390-153805412 CTTCATCTGTAAAGTGGGATAGG + Intergenic
964374144 3:156033104-156033126 ATTTATCAGAAAAATGGGGAGGG - Intergenic
964724814 3:159803895-159803917 CTAAATCTGTAAAATGGGAATGG - Intronic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965847009 3:172974808-172974830 CTTCAACTGGAAAGTGAGGATGG - Intronic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
966622623 3:181982337-181982359 CTTCATTTCCAAAATGGCAATGG - Intergenic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
966904413 3:184511360-184511382 CTGCATCTGGAAAAGGGGGTGGG + Intronic
967506422 3:190257748-190257770 CTTCCTCCGTAAAATGGGGGTGG - Intergenic
967754028 3:193148244-193148266 ATTCAACTGCACACTGGGGATGG + Intergenic
967905981 3:194500642-194500664 CTTCATCTGTAATGTGGGAATGG - Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
969501721 4:7557354-7557376 CTTCATCTGTAAATTGGGGTTGG + Intronic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970445281 4:16118714-16118736 CATCCTCTGCAAAACAGGGATGG + Intergenic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970673478 4:18421839-18421861 CTCCATCTATAAAATGGGTATGG - Intergenic
971161406 4:24137507-24137529 ATGCATCTGTAAAATGGGGTTGG - Intergenic
971198123 4:24488637-24488659 CAGCATCTGTAAAAAGGGGATGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972689005 4:41378370-41378392 CTTAATCTGTGAAATGGTGAGGG + Intronic
973099781 4:46251556-46251578 GTTCATGTGAAAAATGGGGTGGG - Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973702006 4:53546727-53546749 CTTCCTCTTCAAACTGGGGAAGG + Intronic
973991200 4:56409170-56409192 GTTTATCTGTAAAATGGGCATGG - Intronic
974083254 4:57234094-57234116 CTCCATCTGCAGCATGGGGCGGG - Intergenic
974119120 4:57617045-57617067 CTTTATCTGCAAACTGGAGTGGG - Intergenic
974744374 4:66051755-66051777 CTTCATTTGAAAAATGATGATGG - Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976658572 4:87515272-87515294 CTTCATCTACAAAACAGGAAAGG + Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977171114 4:93763753-93763775 CTTCATCCATAAAATGGGGGAGG + Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978308086 4:107354094-107354116 CCTCAGCTGCCAAATAGGGAAGG - Intergenic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
978634800 4:110791554-110791576 CATCATCTGCACAATGAGCAGGG + Intergenic
979382904 4:120029609-120029631 TTTCACCTGCAACATGGAGAAGG + Intergenic
979679711 4:123446202-123446224 CTTCATCTCTAAAATGGAGCTGG - Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980074019 4:128274909-128274931 TTTTATCTGCCAAATGGGGAAGG - Intronic
982225404 4:153160912-153160934 CTTCATTTTTAAAAAGGGGAGGG + Intronic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
982462698 4:155690753-155690775 CCTCTGCTGCAAAAAGGGGAGGG - Intronic
983699468 4:170574013-170574035 CTTGATCTGAACAATGGTGAGGG + Intergenic
983891800 4:173037332-173037354 CTTCATCAGTAAAATGAGGTGGG - Intronic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
986592994 5:9390920-9390942 CCACATCTGCAAAATGGCAAAGG - Intronic
986856808 5:11878841-11878863 CATCATTTGCAAGGTGGGGAAGG + Intronic
987130630 5:14856851-14856873 ATTCATCTTCGAAGTGGGGAAGG + Intronic
987227614 5:15859833-15859855 CTTTATCTGTAAAATGGGTCAGG - Intronic
987333540 5:16878021-16878043 CTCCATCTGTAAAATGGGAATGG - Intronic
987650659 5:20736338-20736360 CTTCATCAGCAAAATGAGATGGG - Intergenic
987807386 5:22786638-22786660 CTTCATTTGTGTAATGGGGAAGG + Intronic
988744893 5:34125123-34125145 CTTCATCAGCAAAATGAGATGGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990544312 5:56807215-56807237 CTTCACCTGGAAAATGGCGATGG + Intergenic
990743166 5:58933125-58933147 CTTATTATGCAAAATGGAGAAGG - Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991504987 5:67315431-67315453 CTTCCTTTGCAAAGTGGGCATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992009371 5:72511532-72511554 CTTCATCTGTAAAAAGGGCAGGG - Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
994022066 5:95038660-95038682 TTTCATCTGTGAAATGGGGGAGG - Intronic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995420452 5:111961087-111961109 CTTCACTTGCAAAGTGGGAAGGG - Intronic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998831872 5:146168199-146168221 CTTCATCTGGAAAATCAGGGGGG + Exonic
998895503 5:146795109-146795131 CTTTATCTATAAAATGGGGCTGG + Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999189094 5:149732966-149732988 CTCCATCTGTCAAATGGGGCTGG + Intronic
999262978 5:150249022-150249044 CTTCCACTGCAGGATGGGGATGG + Intronic
999381015 5:151121567-151121589 CTTCATCTGGGAAATGGAAATGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000776760 5:165429468-165429490 CTCCATCTAGAAAATGAGGACGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001284623 5:170413534-170413556 CTTCATCTGCAAGATGGGAATGG + Intronic
1001308026 5:170589982-170590004 CCCCCTCTGCAAAATGGGAATGG + Intronic
1001382834 5:171315380-171315402 CTGCATCTGTAAAATGGGCGCGG - Intergenic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001759179 5:174193434-174193456 CTTCATCTGTCAAATGGACAAGG + Intronic
1001769380 5:174281508-174281530 CTTGTTCTGCAAAATGGGGTTGG - Intergenic
1001811955 5:174635672-174635694 CATCATCTGAAAAATAGAGAAGG + Intergenic
1001874159 5:175184985-175185007 CATTATCTGTGAAATGGGGATGG - Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1003480358 6:6525526-6525548 CATCATCTGTAAAACAGGGAAGG + Intergenic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004110404 6:12712744-12712766 GTTCATCTGGAAATAGGGGAAGG - Intergenic
1005882544 6:30072082-30072104 CTGGGTCAGCAAAATGGGGAAGG + Intronic
1006782864 6:36643850-36643872 CTTCATCTGTAAAACAGGGGTGG + Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1006915370 6:37590468-37590490 TGTCATCTAGAAAATGGGGATGG + Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007217279 6:40250132-40250154 CTTCATCTGTGAAATGGGTGTGG + Intergenic
1007638017 6:43311973-43311995 CTTCATCTGGGTAATGGGGTAGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007833944 6:44659952-44659974 CATCACCTGCAAAATGGGTTAGG + Intergenic
1007856010 6:44858407-44858429 CTTCATCCGTAAAATGGAGGTGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008299572 6:49818561-49818583 CATTATCTGTAAAATGGAGATGG + Intergenic
1008476125 6:51937715-51937737 CTCCATCTGTAAAATGGGCATGG + Intronic
1008642600 6:53480028-53480050 CTTCGTATGCAAAGTAGGGATGG - Intergenic
1010189630 6:73181852-73181874 CTTTATCTGCAAAACAGGGATGG + Intronic
1010337159 6:74700109-74700131 CTTCCTCCACAAAATGAGGATGG - Intergenic
1010869693 6:81022027-81022049 CTCCATCTCAAAAATGGGAAGGG - Intergenic
1011180573 6:84615227-84615249 CTTAATTTGTAAAATGGGAATGG + Intergenic
1011350850 6:86422107-86422129 CTTCATTTGCAAAATGGTGTGGG + Intergenic
1011580317 6:88855947-88855969 CATCATCTGCAAAAATGGCATGG + Intronic
1011675832 6:89732647-89732669 CTTCATGAACAAAATGGGGGAGG - Exonic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014139939 6:117929976-117929998 CTTCATCTTTAAATTGGAGATGG - Intronic
1014550133 6:122780475-122780497 CTTCTTCTTCAGAGTGGGGATGG + Intronic
1015150328 6:130030280-130030302 CTTCAACTGTAAAATGGGTTAGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015316309 6:131820697-131820719 TTTCATCTCTAACATGGGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1016106701 6:140172150-140172172 CTTCATCAGCAACATGAAGATGG - Intergenic
1016492565 6:144623205-144623227 CTTCATCTGTAATATGAGAAAGG + Intronic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016676328 6:146773607-146773629 CTTCATCTGTAAAACTGGGATGG - Intronic
1017094968 6:150796742-150796764 CTTCATCTATGAAATGGGGAAGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017507998 6:155086325-155086347 CTTCATCTGCAAAGTGAACAGGG + Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019339104 7:500067-500089 TTTCATCTGTCAAATGGGGTGGG + Intronic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019577375 7:1744019-1744041 CCTCATCTGCAAAATGGACGGGG - Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1020678135 7:11204127-11204149 CTACCTCTGTAAAATGGGGACGG + Intergenic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022403487 7:30064158-30064180 GTTCATCTATAAAATGGGAATGG + Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1022789847 7:33676059-33676081 CTCCATCTATAAAATGGGCAGGG + Intergenic
1022983341 7:35625310-35625332 TTCCATCTGTAAAATGGCGATGG + Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023881024 7:44321518-44321540 CTTTGTCTGTAAAATGGGGCTGG + Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1024985650 7:55191363-55191385 GTTTATCTGCAAAGTGGGGGTGG - Intronic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1026461154 7:70616291-70616313 CTTCACCTGCCACATGGGGCTGG - Intronic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1028137559 7:87238297-87238319 CTTGATCTGTCAAATGGGGATGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028710629 7:93903560-93903582 CCTCATCTGCAAAATGGAATAGG + Intronic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1028866845 7:95723313-95723335 TTTCATCTGGAAAGTGGTGAAGG + Intergenic
1029031283 7:97469898-97469920 TTTCATCTGAAAAATGGAAATGG - Intergenic
1029065639 7:97845148-97845170 CTTCAGCCATAAAATGGGGATGG + Intergenic
1029151994 7:98487164-98487186 GTGCATGTGCAAAATTGGGAGGG + Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029608988 7:101616603-101616625 TTCCATCTGTAAAATAGGGAAGG - Intronic
1030086692 7:105821713-105821735 CTTTAACTGCAAAATGGAAATGG + Intronic
1030666357 7:112282875-112282897 CTTCATCTGTAAAACAGAGATGG + Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032067521 7:128782909-128782931 CTTCATCTGCTGGTTGGGGAAGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033420624 7:141201579-141201601 CATCATCTGCAAAATACTGATGG - Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1033755270 7:144393806-144393828 CTCCAAGTGCAAAATGAGGAGGG + Intergenic
1033811664 7:145020831-145020853 CTTTTTCTGTAAAACGGGGATGG + Intergenic
1034299791 7:150005541-150005563 CTTCATCTGGTACATCGGGAGGG + Intergenic
1034353226 7:150430697-150430719 CTGCATCTGCACCAAGGGGAAGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034806257 7:154091763-154091785 CTTCATCTGGTACATCGGGAGGG - Intronic
1035762604 8:2080690-2080712 AATCATCCGAAAAATGGGGAGGG - Intronic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036125073 8:6055094-6055116 GTTCATATTAAAAATGGGGAAGG + Intergenic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036974203 8:13392051-13392073 CTTCATTTTCATAATGGGTAAGG - Intronic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1037589111 8:20298393-20298415 CCTCATCTGCCAAATGGCAAAGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1037801628 8:22039093-22039115 CCTCATCTGGGAAATGGGGCTGG - Intergenic
1038041508 8:23727604-23727626 TTTCATCTGTAAAATGGGACTGG - Intergenic
1038367918 8:26955738-26955760 CATCATCTGCAAAAATGAGATGG - Intergenic
1038389240 8:27179797-27179819 TTCCGTCTGTAAAATGGGGATGG + Intergenic
1039554460 8:38466781-38466803 CTACATCTGGAAATTGGGGGTGG + Intronic
1039773832 8:40716278-40716300 CTGCATCAGAAATATGGGGAGGG + Intronic
1039911376 8:41829395-41829417 CTGCATCTGAAAAATGGGATTGG - Intronic
1040351548 8:46573660-46573682 CTTCAACCATAAAATGGGGATGG + Intergenic
1040365123 8:46707776-46707798 CTTCAACCATAAAATGGGGATGG - Intergenic
1040525931 8:48225359-48225381 AGGCATCTGAAAAATGGGGAAGG - Intergenic
1040956296 8:52983233-52983255 CTTTATCTTCAAAATCCGGAAGG + Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1042479864 8:69290997-69291019 CTTCATCTATATAGTGGGGAGGG + Intergenic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1043663406 8:82776242-82776264 CTTCATTTGTGAAATGGAGATGG - Intergenic
1043696434 8:83224691-83224713 CTTCAGCTGTAAATTTGGGATGG + Intergenic
1043980984 8:86639037-86639059 CTTTATCTGTAAAATTGAGAAGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044553959 8:93542071-93542093 CTTCATCTGTAAGGTGGAGAGGG - Intergenic
1044570404 8:93711640-93711662 CTTAACCTGAAAAATGGGAATGG + Intronic
1044742514 8:95342401-95342423 CTTCAGCTGTAAAATGGAAATGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044928941 8:97233535-97233557 CTTCATCAGTAAAACGAGGACGG + Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1045362520 8:101446050-101446072 CTTCATCTGAAAAACAGGGATGG - Intergenic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048180274 8:132188010-132188032 CTTCATCTCTAAAATGGGAATGG - Intronic
1048358464 8:133673723-133673745 CTTTATAAGCCAAATGGGGATGG + Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1048781788 8:138009464-138009486 TTTAATCTGTAAAATGGGAATGG - Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049293561 8:141817464-141817486 CTTCTTTTGCAAAATGGTTATGG + Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049697739 8:143991792-143991814 CTTCATCCGCAAGGTGGGTAGGG + Exonic
1049991775 9:998249-998271 CCTCATCTACGAAATGGGAATGG - Intergenic
1050150442 9:2614506-2614528 TTTCATCTGAAAAATGGGGGTGG - Intergenic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1050953174 9:11623236-11623258 CTTCATTTCTAAAATGGAGAGGG + Intergenic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051599161 9:18854940-18854962 CTTACCCTGGAAAATGGGGAGGG - Intronic
1051712424 9:19945664-19945686 CTTCATCTGTAAATTAGGGGTGG - Intergenic
1052610347 9:30764801-30764823 CTTATTCTTCAAAATGTGGAGGG - Intergenic
1053308307 9:36999601-36999623 CCTCATCCGAAAAATGGGCAAGG + Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053418945 9:37964794-37964816 CTTCATCTGTACAGTGGGGGCGG - Intronic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1055073805 9:72193877-72193899 CTCCACCTTCAAAAAGGGGAAGG - Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056089220 9:83187947-83187969 CTTCATCTGCAAGACGGGGGTGG + Intergenic
1056757933 9:89393913-89393935 ACTCATCTGCAAAATGGAAATGG + Intronic
1056789645 9:89617264-89617286 CTTCATCTGAAACATCTGGAAGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057911035 9:99020913-99020935 CTCCATCTGTAAAATGGAGGTGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058382399 9:104391905-104391927 CTCAATCTGTAAAATGGAGATGG + Intergenic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058685910 9:107479407-107479429 CTTCATCCGCATACTGGAGATGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059576680 9:115496875-115496897 CTTTATCTACAAAATGAGAAGGG - Intergenic
1059691097 9:116687110-116687132 CTTCATCTGCACCAAGGAGACGG + Intronic
1059732631 9:117072035-117072057 CTTAATCTGTAAAATGGGAGTGG - Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059925412 9:119204514-119204536 CTTTATCTGTAAAATAGGAATGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060471984 9:123955792-123955814 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060623754 9:125091770-125091792 CATCAGCTGAAAAGTGGGGATGG - Intronic
1060694725 9:125698695-125698717 CGGCATTTGTAAAATGGGGACGG + Intronic
1060806533 9:126581093-126581115 TTTCTTTTGCAAAATGGGAAAGG + Intergenic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061276269 9:129570729-129570751 CTTCATCTTAAAAATGGAGCTGG + Intergenic
1061537089 9:131256946-131256968 CTTCGTCTGTGAAATGGGGGTGG + Intergenic
1061551288 9:131336254-131336276 CTTAATGTGTAAAGTGGGGATGG + Intergenic
1061721158 9:132552202-132552224 CTGCATCTGTGAAGTGGGGATGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061946205 9:133909411-133909433 CTCCATCTGCAAAATGGATCAGG + Intronic
1061952866 9:133945936-133945958 CTCAATCTGTAAAATGGGCAAGG + Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062099107 9:134718821-134718843 CTGCATCTGTGAAATGGGGATGG + Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1185943979 X:4353754-4353776 CTTCATCTATAAAGTGGGGATGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186826823 X:13348819-13348841 ATTTATCTGCAAAATAAGGATGG - Intergenic
1187256773 X:17650401-17650423 CTTCATCTATAAAATAAGGAGGG - Intronic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1187378431 X:18778551-18778573 CCCAATTTGCAAAATGGGGATGG - Intronic
1188269413 X:28120182-28120204 CTGCTTTTGCAATATGGGGAAGG + Intergenic
1188960988 X:36491159-36491181 CTTCACCTGCTACATGGGGAAGG - Intergenic
1189150962 X:38706184-38706206 CCTCATTTACAAAATGGTGAGGG + Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189300976 X:39952082-39952104 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190556572 X:51641819-51641841 CTTCCTCTGCAAATCGGTGATGG + Intergenic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192082336 X:68060400-68060422 CTCCATCTATAAAAAGGGGAGGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1193751226 X:85346831-85346853 TTTCATCTGCAAAATTAGTAGGG - Intronic
1193764168 X:85505563-85505585 TTTCACCTGCAAATTGGGCATGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1194936644 X:99958105-99958127 CTTCAGCTGGAAAATGGAAAAGG + Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195404749 X:104500666-104500688 ATTCATCTGTCAAATGGTGAAGG + Intergenic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196198774 X:112862362-112862384 CTTCATCAGAAAAATGGGATGGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196885096 X:120236900-120236922 ATACATATGCAAAATGGGGGTGG + Intergenic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197169562 X:123416049-123416071 CTCCATCTCCAACATGGGAATGG + Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197464564 X:126786558-126786580 TTTCATTTGTTAAATGGGGATGG + Intergenic
1197806184 X:130400796-130400818 CTTCCTCTACAAAATGAGGGTGG + Intergenic
1197893374 X:131287240-131287262 GTTCATCAGTAAAATGGGGATGG - Intronic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1197974020 X:132145947-132145969 CTTCGTCTCTAAAATGTGGAAGG - Intergenic
1198039288 X:132833992-132834014 CTGTATCTGCCAAATGAGGATGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1198551487 X:137749778-137749800 CCTCATCTGAAAAATTGAGAAGG + Intergenic
1198552142 X:137756366-137756388 ATTAATCTGCAAACTGGGAAAGG - Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1200336094 X:155353110-155353132 TTTCATTTGTAAAATGGAGATGG - Intergenic
1200350376 X:155488117-155488139 TTTCATTTGTAAAATGGAGATGG + Intergenic