ID: 1152227799

View in Genome Browser
Species Human (GRCh38)
Location 17:79100750-79100772
Sequence GCTCAAAGCAGGCCCCTTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152227794_1152227799 -3 Left 1152227794 17:79100730-79100752 CCCCAACGTACGCCTGCTCTGCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 153
1152227796_1152227799 -5 Left 1152227796 17:79100732-79100754 CCAACGTACGCCTGCTCTGCTCA 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 153
1152227793_1152227799 -2 Left 1152227793 17:79100729-79100751 CCCCCAACGTACGCCTGCTCTGC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 153
1152227791_1152227799 20 Left 1152227791 17:79100707-79100729 CCCTGGCAGGAATGAGCGGAGGC 0: 1
1: 0
2: 1
3: 20
4: 128
Right 1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 153
1152227795_1152227799 -4 Left 1152227795 17:79100731-79100753 CCCAACGTACGCCTGCTCTGCTC 0: 1
1: 0
2: 1
3: 1
4: 62
Right 1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 153
1152227792_1152227799 19 Left 1152227792 17:79100708-79100730 CCTGGCAGGAATGAGCGGAGGCC 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152227799 Original CRISPR GCTCAAAGCAGGCCCCTTGC CGG Intronic
902094051 1:13927835-13927857 GCCCAAATGTGGCCCCTTGCAGG - Intergenic
912498765 1:110107978-110108000 GCTCAAGGCAGGCCCCAGGCCGG + Intergenic
913715108 1:121526013-121526035 CCTCAAAATAGGCCCCTGGCAGG + Intergenic
919805424 1:201378523-201378545 GTTCAAGGCTGGCCCATTGCAGG + Intronic
921207156 1:212858575-212858597 GCCCAAAGCGGGCACCTTCCCGG + Exonic
921277292 1:213532710-213532732 GCTAGGAGCAGGCTCCTTGCCGG + Intergenic
1062889678 10:1048897-1048919 GCTCAAAGCGGGCGCCATCCGGG - Exonic
1064140402 10:12785390-12785412 ACTCAAAGCATCCCTCTTGCAGG + Intronic
1065887708 10:30093479-30093501 ACTCACAGCTGGCCCCCTGCAGG + Intronic
1073631512 10:105154419-105154441 ACTGACAGCAGGCCCCTTGGCGG - Intronic
1075725361 10:124608142-124608164 GCTCCAAGCAGGACCCTAGGGGG - Intronic
1076176829 10:128374608-128374630 GCTCCAAGCAGTCCCCTCTCTGG + Intergenic
1076522090 10:131087736-131087758 CGTCAGAGCATGCCCCTTGCCGG - Intergenic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1077200017 11:1302075-1302097 GCCTGGAGCAGGCCCCTTGCAGG - Intronic
1078406262 11:11072423-11072445 GATCAAAGTAGGCCTCTTGGTGG - Intergenic
1078599498 11:12717719-12717741 GCTCACCCCAGGCCCCTGGCAGG + Intronic
1079034217 11:17008406-17008428 GCTCAAAGCAGGAAGCTGGCTGG - Intronic
1082678019 11:56132949-56132971 GCTGAATGCAGACTCCTTGCGGG + Intergenic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1084147239 11:67271646-67271668 CCACAAAGCAGCTCCCTTGCGGG - Intronic
1084494716 11:69497262-69497284 GCTCAGAGCAGGGCCCTGGAAGG - Intergenic
1088122331 11:106385108-106385130 ACCCAAAGCAGACCCCTTTCTGG + Intergenic
1089496682 11:118911568-118911590 GCTCTGAGCAGGCTCCTGGCTGG + Intronic
1096510472 12:52125205-52125227 GCCCACAGCAGGGCTCTTGCAGG - Intergenic
1100955554 12:99904040-99904062 GCTCTACCCAGGCCCTTTGCAGG + Intronic
1102402299 12:112640018-112640040 GTTCAAAGCAGGGCTCTGGCTGG + Intronic
1103947043 12:124532479-124532501 GCTCCCAGGAGCCCCCTTGCAGG - Intronic
1105403850 13:20118343-20118365 GCTCAGGCCAGGCCCCTGGCGGG + Intergenic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1107806456 13:44158103-44158125 GCTTGAAGCAGGGGCCTTGCTGG + Intronic
1110378817 13:74825746-74825768 GTCCAAAACAGGCCTCTTGCAGG + Intergenic
1112599735 13:100843220-100843242 GCTCAATGCGGGCCCATGGCTGG - Intergenic
1113747774 13:112756826-112756848 GCTGGGAGCAGGCCCCGTGCTGG - Intronic
1113747788 13:112756880-112756902 GCTGGGAGCAGGCCCCGTGCTGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1119147535 14:72330729-72330751 TCTCACAGCAGGCCCCTTGTGGG + Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121836622 14:97098191-97098213 GCTGAAAGCAGCTCCCTAGCTGG - Intergenic
1122428366 14:101624540-101624562 GCTCACAGCAGGCCCCTTCTCGG - Intergenic
1125956141 15:43792440-43792462 GGTCAAAGCCGGCGCCTCGCCGG - Intronic
1126675484 15:51156591-51156613 TCCCACAGCAGGCCTCTTGCTGG - Intergenic
1128740504 15:70080384-70080406 GTTCAAAGCAGGCGCTTTGTTGG + Intronic
1128891899 15:71338991-71339013 GTTAAAAGCAGGCTCCTTGCAGG + Intronic
1130022390 15:80242321-80242343 GCTCACAGGAGCCCCCTTGCGGG - Intergenic
1131487274 15:92831876-92831898 GCCCCAAGCAGGCGCATTGCGGG - Intergenic
1132683940 16:1154427-1154449 GCCCGAGGCAGGCCCCTCGCGGG + Intronic
1132828376 16:1916086-1916108 GCTCATTGCAGGCTCCTAGCAGG + Intronic
1132883150 16:2171124-2171146 GCTCTAAGCAGGCCTCTCTCAGG + Intronic
1135809875 16:25577393-25577415 GCACAGAGCAGGCCCCTGGGAGG - Intergenic
1136269535 16:29140467-29140489 TTTCAAAGCAGACCCCTTCCTGG + Intergenic
1138095352 16:54207030-54207052 GCTCAATGCAGACCCTCTGCAGG - Intergenic
1138614765 16:58156677-58156699 GAGGAAAGCAGGCCCCTTTCAGG - Intergenic
1142139206 16:88465195-88465217 GCTCACAGCAGGGCCCGGGCTGG + Intronic
1143111108 17:4553344-4553366 GGTCAAGGCTGGCCCCTTGTGGG - Intronic
1144421186 17:15100213-15100235 GCTCAAAGCTCACCTCTTGCAGG - Intergenic
1145260711 17:21352765-21352787 GCTCACAGCATGGCCCTGGCGGG + Intergenic
1146606603 17:34263737-34263759 GATTAAAGCTGGACCCTTGCTGG - Intergenic
1147635392 17:41960836-41960858 GCTCATAGCAGGCCCGTGGCTGG - Intronic
1148233688 17:45953074-45953096 GCTCCATGCAGGTGCCTTGCAGG - Intronic
1149740286 17:59039284-59039306 ACTAAAAGCAGGCACTTTGCAGG - Intronic
1149784858 17:59426092-59426114 CCTCATAGAAGGCCCCTTGCTGG + Intergenic
1150307350 17:64097166-64097188 GATCCAAGCAGGGCCCATGCAGG + Intronic
1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG + Intronic
1153803251 18:8690053-8690075 GCTCAAAGCCAGCCTCTTCCTGG + Intergenic
1153926047 18:9835943-9835965 TCTCACAGCAGGCCCCGTTCCGG - Intronic
1154259712 18:12819950-12819972 GCTCAAAGCAGACCACATGAAGG - Intronic
1156362853 18:36399609-36399631 GCTCAGGGCATGCACCTTGCTGG + Intronic
1159735153 18:72087037-72087059 GCTCAAGTCAGGCTGCTTGCTGG + Intergenic
1159955533 18:74516027-74516049 GCACAAAGGAGGCCCCTGACAGG - Intronic
1160144242 18:76350637-76350659 CCGCAGAGCAGGCCCCTTGACGG + Intergenic
1160787418 19:907484-907506 GGTGATACCAGGCCCCTTGCTGG - Intronic
1161448900 19:4333678-4333700 GTTCAAGGTAGGTCCCTTGCTGG - Exonic
1161642332 19:5432137-5432159 GCTCAGAGCTGTCCCTTTGCAGG + Intergenic
1162922141 19:13909527-13909549 GGGAAAAGCAGGCCCCTGGCTGG - Intronic
1163679521 19:18672592-18672614 GAACAAAGCAGGGGCCTTGCTGG - Intergenic
1165707419 19:37986483-37986505 GCCAAAAGCAGCCCCTTTGCTGG + Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1166341678 19:42141220-42141242 GCTAAATGCAGGCCCAGTGCTGG - Intronic
1167211468 19:48136477-48136499 GCTCAAAGCAAGGACCATGCTGG - Intronic
1167501420 19:49850905-49850927 ACACCAAGCTGGCCCCTTGCGGG - Intronic
925130059 2:1488419-1488441 GGTCCAAGCTGGCCCCTGGCAGG + Intronic
926109600 2:10173523-10173545 GCCCAATGCAGGCCCGTGGCTGG + Intronic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
926636211 2:15182231-15182253 GCTCAGAGCAGCTGCCTTGCTGG - Intronic
933258637 2:80107819-80107841 GCTCCATGCAGGCCCCATGGTGG - Intronic
935102992 2:100014618-100014640 GCTCAAAGCTGGTCTCCTGCAGG - Intronic
937032984 2:118756219-118756241 GCTCAAAGTGGGCCATTTGCTGG - Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
938763405 2:134444642-134444664 GCTCAAAGCAGGCTCCAAGTTGG - Intronic
946811596 2:223531100-223531122 GCTCCATGCAGGCCCCATGGTGG - Intergenic
947160291 2:227207782-227207804 TCTCAAAGCAGTCCCCTGGTGGG + Intronic
947769413 2:232659216-232659238 GCTCAGTGCAGCCTCCTTGCTGG - Intronic
948639608 2:239366952-239366974 GCTCAATTCAGGCCCGTTGTTGG - Intronic
1168902423 20:1376267-1376289 GCGTAAAGCTGGCCCCTTGTAGG + Intronic
1170158135 20:13286874-13286896 GCTAAAGGCATGCCCCTTGCCGG - Intronic
1171234091 20:23510252-23510274 GCTCACACCTGGGCCCTTGCAGG + Intergenic
1173339389 20:42139867-42139889 CCTCAAAGCAGGCCCTGTGATGG - Intronic
1174864596 20:54123589-54123611 GAGCAAAGCAGGCCCCAGGCTGG - Intergenic
1175172901 20:57092600-57092622 GCTCAGGGCAGGGCTCTTGCAGG - Intergenic
1179439766 21:41385022-41385044 ACTCACAGAAGGCCACTTGCAGG - Intronic
1180984675 22:19897341-19897363 CCACGAAGGAGGCCCCTTGCAGG - Intronic
1182110372 22:27718829-27718851 GCTCAAAGCAATGCCCTGGCAGG - Intergenic
1182322443 22:29486902-29486924 CTTCAAAGCAGGCCTCTGGCTGG - Intronic
949674652 3:6439427-6439449 GCTCTAAGACGGCCCCTTGCAGG - Intergenic
953234074 3:41090934-41090956 GTTCCGAGCAGGCCCCATGCAGG - Intergenic
954402175 3:50324702-50324724 CCTCACTGCAGGCCCCCTGCAGG - Intronic
954602121 3:51878070-51878092 GTTCTCAGTAGGCCCCTTGCAGG + Intergenic
959277808 3:104299606-104299628 ACTCAAATCAGGCCCCCTGAAGG + Intergenic
961216151 3:125162263-125162285 GCCCACAGCAAGCCCCGTGCTGG + Intronic
961450351 3:126999717-126999739 GCTCAATGCAGGCCCCAGGCTGG - Intronic
961606884 3:128102152-128102174 TCTCAAAGCTGGCATCTTGCAGG + Intronic
962214036 3:133504312-133504334 GCTCATAGCAGGTCCCTTCAGGG - Intergenic
963255693 3:143142545-143142567 GAGCACAGCAGGCACCTTGCCGG - Intergenic
963787381 3:149548568-149548590 ACTCAGAGCCAGCCCCTTGCAGG - Intronic
969819228 4:9707868-9707890 GCTCCAGTCAGGCCCCATGCGGG + Intergenic
975831383 4:78372794-78372816 GCTCCACGCAGGCCCCATCCTGG - Exonic
976417886 4:84800375-84800397 GCTCAAAGCAGGAGGCTTCCTGG + Intronic
978099358 4:104818435-104818457 TCTCACACCAGGCCTCTTGCAGG - Intergenic
984944306 4:184959358-184959380 GCTCACACCAGGCTGCTTGCTGG + Intergenic
985542898 5:495033-495055 CCTCAAAGCAGCCCACGTGCCGG - Intronic
985647079 5:1090065-1090087 GATCAGAACAGGCCCCGTGCGGG + Intronic
989962625 5:50434444-50434466 CCTCAAAATAGGCCCCTGGCAGG - Intronic
995461683 5:112410390-112410412 GCTGGAAGCAGGGGCCTTGCAGG + Intronic
997529650 5:134573932-134573954 GCACAACTCAGGACCCTTGCAGG - Intronic
1001052168 5:168422301-168422323 GCACAAAGAAGGCCCCAGGCAGG + Intronic
1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG + Intronic
1005200946 6:23343123-23343145 GCTGAACTCAAGCCCCTTGCAGG - Intergenic
1005360562 6:25027574-25027596 ACTCCGAGCAGGCCCCTTGGGGG + Intronic
1006370181 6:33639523-33639545 ACTAAAAACAAGCCCCTTGCTGG + Intronic
1016826831 6:148396176-148396198 GGTCATAGCAGGGCCATTGCTGG + Intronic
1019478451 7:1255237-1255259 CCTCAGAGCAGGCCCCAGGCCGG - Intergenic
1019647058 7:2136595-2136617 GCCCAAAGCCTGCCCCTTCCAGG + Intronic
1019735526 7:2648186-2648208 TCTCAGAGCAGGCCCAGTGCAGG - Intronic
1019774183 7:2902523-2902545 CCCCAAAGCAGCCCCCTTCCTGG + Intergenic
1019993314 7:4707405-4707427 GCTGAAAGCAGGCCTCTCCCTGG + Intronic
1025027026 7:55525025-55525047 GCAGAAAGAAGGCCCCGTGCTGG + Intronic
1025211404 7:57021091-57021113 GCTCACAGCAGGCCCCACCCAGG - Intergenic
1025660549 7:63555756-63555778 GCTCACAGCAGGCCCCGCCCAGG + Intergenic
1033317856 7:140313275-140313297 GCTCAGAGCAGGGCCCAGGCAGG + Intronic
1034450371 7:151134080-151134102 GCACAAAGCAGGCCAAGTGCTGG - Intronic
1035028802 7:155844253-155844275 GCTCGAGGGAGGCCCCTAGCTGG - Intergenic
1035618168 8:1017741-1017763 GCCCACGGCAGGCCCCTTGCAGG - Intergenic
1037766096 8:21773238-21773260 GCTCAGAGCAGCTCCCATGCTGG - Intronic
1039835995 8:41256727-41256749 GCACAAATCAGGCCCCGAGCTGG - Intergenic
1040007034 8:42629475-42629497 GTGCCTAGCAGGCCCCTTGCTGG - Intergenic
1048271936 8:133036222-133036244 GCTCCAAGCAGTCACCTGGCAGG - Intronic
1049599421 8:143500109-143500131 GCTCAGAGAAGGCCCCTTTGAGG - Intronic
1049725147 8:144142334-144142356 GCTGAAAGCAGGGGCCTGGCTGG + Intergenic
1050489526 9:6173235-6173257 TCTCACAGCAGGTCCCTTGGAGG + Intergenic
1051186533 9:14466633-14466655 GGGCAGAGAAGGCCCCTTGCTGG - Intergenic
1053528032 9:38849102-38849124 CCTTAAAGCAGGCGCATTGCTGG - Intergenic
1054200253 9:62073535-62073557 CCTTAAAGCAGGCGCATTGCTGG - Intergenic
1054638102 9:67514829-67514851 CCTTAAAGCAGGCGCATTGCTGG + Intergenic
1057446162 9:95116578-95116600 GCTCCAATAAGGCCCCTTTCTGG + Intronic
1057563655 9:96149131-96149153 GATGAAAGCAGCCCACTTGCTGG - Intergenic
1059202327 9:112429854-112429876 GGTCAAAGCAGGCCGATCGCTGG + Intronic
1060221055 9:121764303-121764325 GCACCAGGCAGGCCTCTTGCTGG + Intronic
1060810359 9:126608601-126608623 GCTCAGAGCTGGACCCTGGCGGG - Intergenic
1061004083 9:127918497-127918519 GCTCAAAGGAGGCCCCTAGGGGG - Intergenic
1061182432 9:129032690-129032712 GCTCCATGCAGGCCCCATGGCGG - Intergenic
1062618178 9:137407423-137407445 GCTCACCGCAGGCCCTTTCCTGG + Intronic
1190148521 X:47920669-47920691 GTTAACAGCAGCCCCCTTGCAGG + Exonic
1192196907 X:69034596-69034618 GTTCCAATCAGGCCCCTGGCCGG - Intergenic
1193266135 X:79472045-79472067 ACTCAAAGCAGGGGCCTTTCAGG - Intergenic
1195484893 X:105393112-105393134 GCTCAAATCAGTCCCCCTGAAGG + Intronic
1200766847 Y:7087502-7087524 GTTCAAAGCAGTGCCCTTGAGGG + Intronic
1201190491 Y:11439202-11439224 GATCAAGGCAGGTCCATTGCAGG - Intergenic