ID: 1152229180

View in Genome Browser
Species Human (GRCh38)
Location 17:79106136-79106158
Sequence CGGGGGACACAGGCCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 309}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152229160_1152229180 21 Left 1152229160 17:79106092-79106114 CCCATTGACTGTGCATCCGGTTC 0: 1
1: 0
2: 0
3: 9
4: 34
Right 1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 309
1152229161_1152229180 20 Left 1152229161 17:79106093-79106115 CCATTGACTGTGCATCCGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 309
1152229167_1152229180 -1 Left 1152229167 17:79106114-79106136 CCAAGTTCCCCACCTGGGGGCCC 0: 1
1: 1
2: 1
3: 17
4: 255
Right 1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 309
1152229162_1152229180 5 Left 1152229162 17:79106108-79106130 CCGGTTCCAAGTTCCCCACCTGG 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 309
1152229173_1152229180 -9 Left 1152229173 17:79106122-79106144 CCCACCTGGGGGCCCGGGGGACA 0: 1
1: 0
2: 3
3: 24
4: 261
Right 1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 309
1152229174_1152229180 -10 Left 1152229174 17:79106123-79106145 CCACCTGGGGGCCCGGGGGACAC 0: 1
1: 0
2: 4
3: 42
4: 267
Right 1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 309
1152229172_1152229180 -8 Left 1152229172 17:79106121-79106143 CCCCACCTGGGGGCCCGGGGGAC 0: 1
1: 1
2: 1
3: 24
4: 236
Right 1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152229180 Original CRISPR CGGGGGACACAGGCCCGGAG AGG Intronic
900001189 1:15720-15742 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
900020904 1:186241-186263 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
900142674 1:1145162-1145184 CGGGGAGCACAGGCCAGGAGGGG - Intergenic
900269965 1:1782086-1782108 CGGGGGCCAGAGGCACAGAGAGG + Intergenic
900295521 1:1947201-1947223 TGGGGCACCCAGGCCCAGAGAGG + Intronic
900340863 1:2188474-2188496 TGGGGGACACAGGCCAGAAGAGG - Intronic
900648313 1:3718816-3718838 CGGGGGACTCAGCCCCGGAAAGG + Intronic
900659073 1:3773924-3773946 CCTGGCACTCAGGCCCGGAGAGG - Intronic
900901057 1:5516164-5516186 TGGGGGACTGAGGCCTGGAGAGG - Intergenic
901039202 1:6354154-6354176 GAGGGGACACCGGCCGGGAGTGG - Intronic
901238042 1:7678100-7678122 CCGCGGAAACAGGCCTGGAGGGG - Intronic
901700960 1:11044622-11044644 TGGGGCACTGAGGCCCGGAGAGG - Intronic
902143147 1:14373723-14373745 CCTGGGAGACAGGCCTGGAGTGG + Intergenic
902478211 1:16699121-16699143 CGTGGGAGGCAGGCCCAGAGAGG + Intergenic
902515051 1:16985733-16985755 GAGGGAACACAGGCCCAGAGAGG + Intergenic
902597904 1:17521651-17521673 CGGAGGAAACAGGCACAGAGAGG + Intergenic
902811618 1:18891187-18891209 AGGGGGAAACAGGCCTGAAGGGG - Intronic
902956097 1:19924879-19924901 CGGAGGATAGAGGCCCGGGGAGG + Intergenic
903420862 1:23217221-23217243 CGGGGAACTGAGGCCGGGAGCGG - Intergenic
903780917 1:25819747-25819769 CCGGGGACACAGACCCCGCGGGG + Intronic
904485512 1:30822408-30822430 CAGGGGACAGTGGCCCAGAGAGG + Intergenic
904498315 1:30900162-30900184 GGGGGCACAGAGGCCCTGAGAGG - Intronic
904498831 1:30902520-30902542 TGGAGGACAGAGGCCTGGAGGGG + Intronic
905239946 1:36575071-36575093 GGGGAGACTGAGGCCCGGAGAGG + Intergenic
905569345 1:38991481-38991503 CGGGGGCCTGAGGCCCGGAGTGG - Exonic
905891554 1:41521510-41521532 AGGAGGAGACAGGCCTGGAGAGG - Intronic
905976158 1:42175479-42175501 ATGTGGAAACAGGCCCGGAGAGG - Intergenic
906541425 1:46589376-46589398 GGAGGGACACAGGGCCGGTGGGG + Intronic
907052684 1:51340326-51340348 TGGGTGGCACAGGCCCCGAGAGG + Intronic
907273160 1:53302454-53302476 CGGGGCACTGAGGCCCAGAGAGG + Intronic
908156673 1:61360414-61360436 AGGGAGACACAGGCTCAGAGAGG - Intronic
911665203 1:100543684-100543706 CGGGAGGCACAGGCTCTGAGTGG + Intergenic
912401491 1:109397511-109397533 CGGGGCGCACGGGCCGGGAGGGG + Intronic
913253335 1:116930804-116930826 CGGGGGACACAGGCAGGTAGTGG - Intronic
915231159 1:154446267-154446289 GGGGAAACAGAGGCCCGGAGAGG - Intronic
915573598 1:156760297-156760319 CTGGGGACAGAGGCCTGGGGAGG + Intronic
916588285 1:166166584-166166606 CGGGGGGCTCCGGCCCGGGGTGG - Exonic
916641153 1:166729948-166729970 CTGGGGACCCAGGCTGGGAGGGG - Intergenic
916694330 1:167221122-167221144 AGGGGGAAAGAGGCTCGGAGCGG + Intronic
919740671 1:200979599-200979621 CGGAGAACACAAGCCCCGAGTGG + Exonic
922025261 1:221743157-221743179 GCGGGGACCCAGACCCGGAGGGG - Intergenic
922505062 1:226121587-226121609 CGCGGGACCCAGGCCGGGCGGGG - Intergenic
922544249 1:226443774-226443796 TGGGGGACAAAGGCAAGGAGAGG + Intergenic
922744552 1:228036919-228036941 AAGGGGACAGAGGCCAGGAGCGG + Intronic
923237759 1:232050800-232050822 CTGTGGACACAGGACAGGAGAGG + Intergenic
923652941 1:235890620-235890642 TGGGGGACTCAGGGCCAGAGTGG - Intergenic
924937906 1:248787978-248788000 CGTGGGACACAGACCAGGAGTGG + Intergenic
1063450210 10:6145622-6145644 CGGGGGTCAGAGGGCGGGAGGGG - Intronic
1065023078 10:21516848-21516870 CGGGGGCCACTTGCCTGGAGAGG - Exonic
1067433943 10:46264364-46264386 CAGGGGACACAGGGCAGGTGGGG + Intergenic
1067581899 10:47451532-47451554 CAGGGGACACAGGGCAGGTGGGG - Intergenic
1067683852 10:48455941-48455963 CGGGAGACTGAGGCCTGGAGTGG - Intronic
1067726873 10:48777139-48777161 CTGGGGACACAGCCCCTGGGAGG - Intronic
1075425808 10:122341041-122341063 CGGGGCTCACAGCCCCTGAGAGG - Intergenic
1075437734 10:122458013-122458035 GGGAGAACAGAGGCCCGGAGTGG + Intergenic
1076243895 10:128931597-128931619 CGGGTGACACAGGCCAGGCACGG - Intergenic
1076313147 10:129522270-129522292 CAGGGGTCACAGGCTGGGAGAGG + Intronic
1077056337 11:595638-595660 TGGGGGACACAGGCCTGGCCTGG + Intronic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077484229 11:2831605-2831627 CGGGGGAGAGAGGAGCGGAGGGG - Intronic
1079102885 11:17552531-17552553 TGGGGGACACAGGACAGGTGGGG - Intronic
1079102891 11:17552549-17552571 TGGGGGACACAGGACAGGTGGGG - Intronic
1081672100 11:44948206-44948228 CAGGACACACAGGCCAGGAGAGG - Intronic
1082027646 11:47584604-47584626 GGGGGGACACAGGCAGGCAGGGG + Intergenic
1083367104 11:62147993-62148015 AGGGGGAAACAGGTCCAGAGAGG + Intronic
1083630911 11:64094892-64094914 CTTGGGACACAGGCCCAGATGGG - Intronic
1083774862 11:64889448-64889470 AGGAGGACACAGGCTCAGAGAGG - Intergenic
1083780168 11:64913621-64913643 CAGGTGATACAGGCCCAGAGTGG - Intronic
1083945252 11:65919667-65919689 CGGGGGACACGGACGCGGGGAGG - Intronic
1084319234 11:68364155-68364177 TGGGGGACACGGGCCTGCAGAGG + Intronic
1084480080 11:69415046-69415068 CGGGGGAGAGGGGCCAGGAGAGG + Intergenic
1085259411 11:75195752-75195774 AGGGAGACAGAGGCCCAGAGAGG - Intronic
1085387306 11:76164514-76164536 CGGGGGACACATGCACAGAGGGG + Intergenic
1085387438 11:76165101-76165123 GGGAGGACACAGGCACGGAGGGG + Intergenic
1085387478 11:76165250-76165272 GGGGGGACACAGGCACGGGGGGG + Intergenic
1085387485 11:76165267-76165289 GGGGGGACATAGGCACGGGGGGG + Intergenic
1085566565 11:77519986-77520008 GGGGGGCCACAGGCCAGGGGAGG - Intronic
1086268123 11:85027540-85027562 AGGGGGAGCCAGGCACGGAGTGG + Intronic
1087176238 11:95098770-95098792 AGGAGGAAACAGGCCCAGAGAGG + Intronic
1090365013 11:126198354-126198376 CAGGAGCAACAGGCCCGGAGAGG + Intergenic
1091056117 11:132420672-132420694 CGGGGGGCACAAGGCCAGAGAGG + Intronic
1091374278 12:15837-15859 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
1091444453 12:535553-535575 TGGAGGTCGCAGGCCCGGAGTGG - Intronic
1094514200 12:31118241-31118263 GGGGGGACGCACACCCGGAGAGG + Intergenic
1094842983 12:34349712-34349734 CGGGGTTCACACCCCCGGAGAGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096514938 12:52150540-52150562 CTGGGGACACAGGCTGGCAGGGG - Intergenic
1103763665 12:123267869-123267891 AGGGGGAGACAGGCACAGAGGGG - Intronic
1104346157 12:128001149-128001171 CAGGGGATCCAGCCCCGGAGAGG + Intergenic
1106131980 13:26948460-26948482 GGGTGGACGCAGGCCCGGTGAGG - Intergenic
1107604177 13:42041344-42041366 CCGGGGACACGCGCCTGGAGAGG + Intronic
1108582451 13:51838798-51838820 AGGAAGACACAGGCCTGGAGGGG + Intergenic
1113950538 13:114069079-114069101 TGGGGGACACAGGCCTGAGGTGG + Intronic
1119831510 14:77707232-77707254 AGGGGAACACAGTCCGGGAGCGG - Intronic
1122123924 14:99569088-99569110 GTGAGGACACAGGCCAGGAGTGG - Intronic
1122244118 14:100389533-100389555 CGGGGGACAGAAGCCCTGAGGGG + Intronic
1122557945 14:102591824-102591846 CGGGGCACAGAGTCCCGGCGTGG - Intergenic
1122861384 14:104584176-104584198 ATGGGGAAACAGGCCTGGAGAGG - Intronic
1122968905 14:105144497-105144519 GGGTGGAGACATGCCCGGAGAGG - Intronic
1123041664 14:105492755-105492777 CACGGGACACAGCCCCTGAGTGG - Intronic
1123060491 14:105592177-105592199 GGGGAGACACAGGGCCAGAGAGG + Intergenic
1123084969 14:105713148-105713170 GGGGAGACACAGGGCCAGAGAGG + Intergenic
1127862726 15:63007758-63007780 GGGAGGACACAGGCGCAGAGGGG - Intergenic
1128326223 15:66725884-66725906 CGGAGGACACAGGCCCTGAGGGG - Intronic
1128509806 15:68306477-68306499 GGGTGAGCACAGGCCCGGAGGGG - Intronic
1129462468 15:75706505-75706527 CCGGGGACAGAGGCCAGGTGAGG + Intronic
1129710756 15:77819300-77819322 CGGGGGATGCCGGCCCGGAGCGG - Intronic
1129761526 15:78131581-78131603 GCGGGGACAAAGACCCGGAGCGG + Intronic
1131611805 15:93972670-93972692 CAGGGCACACAGGCACTGAGAGG - Intergenic
1132452320 15:101975219-101975241 CGGTGGACTCAGGGCTGGAGGGG - Intergenic
1132454576 16:15404-15426 CGGTGGACTCAGGGCTGGAGGGG + Intronic
1132641594 16:980828-980850 CAGGGCTCACAGGCTCGGAGCGG + Intronic
1132688676 16:1172746-1172768 CGGGGCACCCAGGGGCGGAGTGG + Intronic
1132815943 16:1826664-1826686 CGGGGGACGCGGGCCTGGCGGGG - Intronic
1132845433 16:1998992-1999014 CTGGGGACACAGGCCGGGTGGGG + Exonic
1132988787 16:2782543-2782565 AAGGGGAAACAGGCCCAGAGAGG - Intergenic
1133277877 16:4648941-4648963 CCTGGCACACAGCCCCGGAGAGG - Intronic
1134030806 16:10990849-10990871 CAGGGGACAGAGGCCAGAAGTGG - Intronic
1135423623 16:22321595-22321617 CTGAGGACACTGGCCCAGAGAGG + Intronic
1135651156 16:24207958-24207980 TGGGGGACACAGGCAGGGAAGGG + Intronic
1136615114 16:31393744-31393766 TGGGGGAAACAGGCCCAGGGAGG - Intronic
1137447084 16:48538554-48538576 CTGGGCACACAGGTCCGGGGAGG - Intergenic
1137868025 16:51921543-51921565 AGGGGCACACAGGCCTGGTGAGG + Intergenic
1138546349 16:57722087-57722109 GGGGGGTCTCAGGACCGGAGAGG + Intronic
1139694488 16:68664034-68664056 CTGAGGAAACAGGCCCAGAGAGG + Intronic
1139750287 16:69105975-69105997 CGGGGGACCCAGCTTCGGAGAGG + Intronic
1141097175 16:81171082-81171104 CGGGGGAGAAAGGCAGGGAGAGG + Intergenic
1141820803 16:86444218-86444240 CAGGGGGCTCAGGCCTGGAGTGG + Intergenic
1141989726 16:87602880-87602902 CGCTGGAGACAGGACCGGAGGGG - Intronic
1142099984 16:88265927-88265949 ATGGGGACAGAGGCCCAGAGGGG + Intergenic
1142113515 16:88344651-88344673 CTGTGGTCACAGGCCCAGAGAGG - Intergenic
1143030433 17:3964366-3964388 CGGGGGACTCGGGCCCGGGCGGG + Intronic
1143180960 17:4983872-4983894 AGGGGCACAGAGGCCAGGAGTGG - Intronic
1143955341 17:10663646-10663668 GGGGGGACACAGGACAGGAGGGG + Intergenic
1144847858 17:18229371-18229393 AGGGAGACAGAGGCCCAGAGAGG - Intronic
1144872617 17:18380451-18380473 AGGGGAACACAGGGCTGGAGTGG + Intronic
1145259004 17:21343714-21343736 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1145317617 17:21744290-21744312 CTGGGGAAACAGGCACAGAGAGG - Intergenic
1146687906 17:34853952-34853974 CGTGAGACACAGGCCTGGGGAGG - Intergenic
1147657449 17:42098776-42098798 AAGGGGACTCAGGCCAGGAGAGG - Intergenic
1147914355 17:43877727-43877749 AGGGGGTCACAGGTCAGGAGGGG + Intronic
1148683481 17:49487584-49487606 CGGAGGACACAGGTATGGAGGGG + Intergenic
1148821358 17:50361612-50361634 AGGGGTAAACAGGCCCAGAGAGG + Intronic
1150343139 17:64385001-64385023 TGGGGGACACAGCCCCTGGGAGG + Intronic
1150649646 17:67001438-67001460 CGGCAGACAGAGGCCCAGAGGGG - Intronic
1151780317 17:76240808-76240830 CGGGATAAACAGGCGCGGAGGGG - Intergenic
1151871544 17:76840289-76840311 TGGGGGACACGGGACAGGAGTGG - Intergenic
1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG + Intronic
1152735537 17:81995287-81995309 GGGGGGGCACTGGCCCGGAGGGG + Intronic
1152876565 17:82789859-82789881 CCGGGTAAACAGGCCAGGAGGGG - Intronic
1152923894 17:83079139-83079161 CGGGGGACCCAGAACCGGCGGGG + Intergenic
1154163455 18:11996771-11996793 CAGGGGACACAGCCCCAGAGAGG - Intronic
1155293107 18:24360840-24360862 AGGGGGATCCAGGCCTGGAGAGG - Intronic
1157199212 18:45644573-45644595 CAGGGGACACAGGCTAGGAAGGG + Intronic
1159888941 18:73936543-73936565 CAGGGGACACAGAACCTGAGAGG - Intergenic
1160048352 18:75408330-75408352 CAGGGTACACAGGCCTGGATGGG + Intronic
1160579257 18:79874391-79874413 CGGGGCACACCTGCCCCGAGGGG + Intronic
1160773269 19:843363-843385 CGGGAGACGGAGGCTCGGAGAGG + Intronic
1160874970 19:1292675-1292697 TGGGCCACACAGGCCTGGAGGGG + Intronic
1161407488 19:4098703-4098725 GAGGGGACACAGCCCGGGAGGGG - Intronic
1161573052 19:5040846-5040868 CAGGGGACAGAGGCCCTGGGAGG - Intronic
1161855557 19:6762840-6762862 CGGGAGACTGAGGCCCAGAGAGG + Intronic
1162744244 19:12790038-12790060 CGGGGGACGCAGCCGAGGAGCGG - Intronic
1162809826 19:13157077-13157099 TTGGGGAAACAGGCCCAGAGAGG - Intergenic
1163153092 19:15426142-15426164 CGGAGGAAACAGGCTCAGAGAGG - Intronic
1163547720 19:17949542-17949564 GAGGGGACAAAGGCCCAGAGAGG - Intergenic
1163666641 19:18606715-18606737 CGCGGGACGCAGGCCGGGCGCGG + Exonic
1164575044 19:29401005-29401027 CAGGAGACACAGCCCCTGAGAGG + Intergenic
1166861517 19:45814477-45814499 TGGGGGACCCAGGCAGGGAGGGG - Intronic
1167140346 19:47646223-47646245 CTGGGGACACAAGCCCTCAGTGG - Intronic
1167260474 19:48455162-48455184 AGGGGGACAGAGACCCAGAGAGG - Exonic
1167315639 19:48761405-48761427 AGGGGGACAGAGACCCAGAGAGG + Intergenic
1167384710 19:49156858-49156880 AGGGGGACAGAGACCCAGAGAGG - Intergenic
1167384813 19:49157234-49157256 GGGGGGACAGAGACCCAGAGAGG - Intergenic
1167413903 19:49360731-49360753 AGGGGGACAGAGACCCAGAGAGG + Intronic
1167413911 19:49360755-49360777 AGGGGGACAGAGACCCAGAGAGG + Intronic
1167427756 19:49438181-49438203 AGGGGGACAGAGACCCAGAGAGG + Intronic
1167631065 19:50626507-50626529 GGGGGGACAGAGACCCAGAGAGG + Intronic
1167743632 19:51338990-51339012 CAGAGGACACTGGCCCGGCGCGG + Exonic
1168239322 19:55081431-55081453 CCGGGGACCCAGGTCCGGGGAGG - Exonic
1168241955 19:55092911-55092933 CCGGGGACCCAGGCACCGAGAGG - Intronic
1168308807 19:55450864-55450886 GGGGGGACAGAGACCCAGAGAGG + Intergenic
1168308830 19:55450952-55450974 GGGGGGACAGAGACCCAGAGAGG + Intergenic
1202712232 1_KI270714v1_random:24949-24971 CGTGGGAGGCAGGCCCAGAGAGG + Intergenic
925572401 2:5325876-5325898 CCGTGGACACAGGCCTGGGGTGG + Intergenic
926055476 2:9771555-9771577 TGGGGGAGCCAGGCCCAGAGAGG - Intergenic
926722049 2:15968144-15968166 CTGGGGACCCAGGGACGGAGGGG - Intergenic
927867322 2:26598533-26598555 CAGGGGACACTGTCCCTGAGAGG + Intronic
927917758 2:26947603-26947625 GGGGGGTCACAGGCCCAGAAGGG + Exonic
928195070 2:29209744-29209766 TGGAAGAGACAGGCCCGGAGGGG + Intronic
928637039 2:33257477-33257499 CCGGGAACACGGGCCAGGAGTGG + Exonic
929452906 2:42048415-42048437 CGGGGGCCCCGGGCCCGGGGCGG + Exonic
930701085 2:54457673-54457695 CGGGGGCCGCAGGCGCCGAGCGG - Intronic
932567247 2:72917774-72917796 CGGGCGAGCCAGGCGCGGAGCGG - Exonic
932584700 2:73020432-73020454 CTGGGGACACAGCCCCGGTGAGG - Intronic
933650688 2:84847582-84847604 CTGGGGACAGTGGCCAGGAGGGG + Intronic
935067046 2:99658302-99658324 TGGGGGACACATGCCTGGTGTGG + Intronic
935354656 2:102187418-102187440 CCGAGGACACAGGCGCGCAGGGG + Intronic
936556937 2:113503994-113504016 CCGGGGCCACAGGCTGGGAGTGG + Intergenic
936568536 2:113597692-113597714 CGGTGGACTCAGGGCTGGAGGGG - Intergenic
938342111 2:130542470-130542492 CGGGGAACTGAGGCCCAGAGAGG - Exonic
938347721 2:130578241-130578263 CGGGGAACTGAGGCCCAGAGAGG + Intronic
941173311 2:162165745-162165767 CGGTGGAGACAGGGCCAGAGAGG + Intergenic
946702132 2:222424548-222424570 CGGAGGGCACCGGCCCGGCGTGG + Exonic
947815693 2:233034760-233034782 CTGGGGAGCCAGGCCCCGAGCGG - Exonic
947819324 2:233059540-233059562 CTGGGGAAACAAGCTCGGAGAGG - Intergenic
948460693 2:238128652-238128674 AAGGGGACCCAGGCCCTGAGTGG - Intronic
948460697 2:238128669-238128691 TGGGTCACACAGGCCCGAAGGGG - Intronic
948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG + Intergenic
948669932 2:239561741-239561763 TGGGGGACACAGGCCTGCACTGG + Intergenic
948711365 2:239827622-239827644 AGGGAGACACAGGCCCAAAGTGG - Intergenic
948944612 2:241213164-241213186 CATGGCACACAGGCCCGCAGGGG + Intronic
949063567 2:241975366-241975388 CGGGGGGCACAGGCGCGATGTGG + Intergenic
949063584 2:241975437-241975459 AGGGGGGCACAGGCGCGGTGTGG + Intergenic
1169131193 20:3167093-3167115 CGTGGGGCAAAGGCCAGGAGAGG + Exonic
1171473488 20:25390362-25390384 TGCGGGACACAGGCGCGGACGGG + Intronic
1172211480 20:33201762-33201784 GGGGCGACTCAGGCCCAGAGAGG - Intergenic
1172344230 20:34184477-34184499 CGGGGGACAGAGGCAGGAAGAGG + Intergenic
1172992652 20:39047806-39047828 GGGTGCACAGAGGCCCGGAGTGG + Intergenic
1173224317 20:41153018-41153040 TGGGGCACACAGGCCTTGAGGGG + Intronic
1173988605 20:47282306-47282328 TGTGGGACACAGGCCATGAGTGG + Intronic
1174072653 20:47909713-47909735 GGAGGGACACCGGCCCTGAGAGG - Intergenic
1175148275 20:56912826-56912848 CTGGGGACCCATGCCCAGAGAGG - Intergenic
1175812972 20:61868695-61868717 GGGGGGACACCTGCCCAGAGTGG - Intronic
1178440358 21:32593437-32593459 CTTGGGACACAGTCCAGGAGAGG - Intronic
1179992152 21:44953663-44953685 CTGAGGACACAGGCCAGGTGTGG + Intronic
1180051985 21:45335530-45335552 GAGGGGGCACAGGCCCGGGGAGG - Intergenic
1180082986 21:45494984-45495006 CGGGGGTGACATGCCCAGAGGGG + Intronic
1180083446 21:45497114-45497136 CTGGGGACACAGGCTCTGAAGGG + Intronic
1180181514 21:46120513-46120535 AGGGGGACCCTGGCCCTGAGGGG + Exonic
1180998093 22:19975442-19975464 TGGGGGAGACAGGCACAGAGAGG - Intronic
1181048827 22:20229113-20229135 CAGGGGACACAGGCTGGGGGAGG + Intergenic
1181085049 22:20436104-20436126 AGGTGGAGACAGGCCCAGAGAGG + Intronic
1181673522 22:24437201-24437223 CGGGGGACACAGAGCTGCAGAGG + Intronic
1182540420 22:31037540-31037562 CAGGGGAAACAGGCTCAGAGAGG - Intergenic
1183332542 22:37229192-37229214 TGGGAGACTGAGGCCCGGAGAGG - Intronic
1183360423 22:37380324-37380346 GGGGAGAAACAGGCTCGGAGAGG - Intronic
1183643624 22:39108967-39108989 AGGGGGAAACTGGCCAGGAGTGG + Intergenic
1183956114 22:41381693-41381715 CAGGGGACACAGGGGCGGCGGGG + Intronic
1185342813 22:50299275-50299297 GGGTGGACACAGGCCCTGCGTGG + Intronic
950650441 3:14403638-14403660 GGTGGGACCAAGGCCCGGAGGGG + Intronic
950944168 3:16927707-16927729 CGGGGGAAACAGGCAGGTAGGGG - Intronic
952152477 3:30607307-30607329 CGGGGAGCAGCGGCCCGGAGCGG + Intronic
953484846 3:43285952-43285974 CGGGAGACACAGGCCCTGCTAGG - Intergenic
954672593 3:52298819-52298841 CTGGGGACACAGGCATGGGGTGG - Intergenic
955397436 3:58567061-58567083 GGGAGGACTCAGGCCAGGAGTGG + Intronic
961537813 3:127580539-127580561 GGGGGGACACAGGCACGGAGAGG - Intronic
961561192 3:127731551-127731573 AGGGGGACAGTGGCCTGGAGCGG - Intronic
964502895 3:157368230-157368252 CTGGAGACACAGGCACGGAAAGG - Intronic
968069021 3:195774397-195774419 CGGGGAACACAGGACAGGTGTGG - Intronic
968428490 4:538381-538403 CTGGGGACACTGGCCCAGCGGGG - Intronic
968459879 4:719505-719527 CGGAGGACACAGGACCTGGGGGG - Intronic
968729482 4:2262822-2262844 GTGGGGAAACAGGCCCAGAGCGG + Intergenic
968901065 4:3432065-3432087 AGGGGGACTCAGGCCAGGGGTGG - Intronic
968960033 4:3738840-3738862 CGGCGCCCACAGGGCCGGAGAGG + Intergenic
968967452 4:3776353-3776375 CGGGGGACTCAGGTCAGGAGAGG - Intergenic
969174067 4:5385761-5385783 TGGGGGCCATAGGCCAGGAGAGG - Intronic
969453219 4:7286614-7286636 TGGAGGACACAGGCCCAGGGAGG + Intronic
969604465 4:8195595-8195617 CAGGGGACAATGGCCAGGAGAGG + Intronic
972788321 4:42347295-42347317 AGGGGCAGCCAGGCCCGGAGTGG - Intergenic
974009260 4:56592580-56592602 CGGGGGACCGAGGCCAGGAGAGG + Intronic
975131901 4:70839608-70839630 CGGGAGGCACAGGCCCGGTCTGG + Exonic
977287470 4:95126547-95126569 CAGGGGATACAGGCCCAGATAGG + Intronic
981179620 4:141725228-141725250 GGAGGGACACAGGCCATGAGAGG - Intronic
984889047 4:184474918-184474940 CGGGGGGCGCAGGCCCGCGGCGG + Intergenic
985520849 5:373439-373461 AGGGGGCCACAGGCCCAGGGCGG - Intronic
985927176 5:3027486-3027508 CTGGACACACAGGCCCTGAGTGG + Intergenic
989011334 5:36876404-36876426 GGGGGCACTCAGGCCCGGACGGG - Intergenic
992742751 5:79790557-79790579 TGGGGGATACAGGCCGGGTGAGG - Intronic
999321782 5:150619687-150619709 CGGGGGACACAGTCCCGGGAGGG + Intronic
999515810 5:152300415-152300437 CTGGGGTCACAGAGCCGGAGAGG + Intergenic
1001004532 5:168038782-168038804 CTGGGGGAACAGGCCAGGAGGGG - Intronic
1001275655 5:170349282-170349304 GTGAGGAAACAGGCCCGGAGAGG - Intergenic
1001481330 5:172091143-172091165 CATGGAACACAGGCCGGGAGTGG - Intronic
1002985968 6:2191025-2191047 TGGGGGACCCAGGGCGGGAGGGG + Intronic
1003353628 6:5344287-5344309 GGAGGCACACAGGCCCAGAGAGG + Intronic
1004477354 6:15986237-15986259 AGGAGGAAACAGGCCCAGAGAGG - Intergenic
1006101837 6:31690351-31690373 CTAGGGACACAGGCCAGGGGAGG + Intronic
1006782146 6:36639342-36639364 CGGGGGTCTGAGGCCTGGAGAGG - Intergenic
1007749567 6:44063661-44063683 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1009176592 6:60467484-60467506 GGGGGAAAACAGGCCCAGAGAGG - Intergenic
1009981242 6:70728249-70728271 AGGGGAACACAGGCCCAGTGTGG + Intronic
1012398298 6:98824605-98824627 CGGGGCTCCGAGGCCCGGAGAGG - Intergenic
1015929266 6:138340672-138340694 AGGGGAACACAGACCCAGAGAGG + Exonic
1017842397 6:158232378-158232400 AGGGGCACACACGCCCGGCGGGG - Intronic
1019256368 7:54904-54926 TGGGGGACACAGGCTGAGAGTGG - Intergenic
1019347617 7:538550-538572 CTGGGGTGACAGGCCCGGGGGGG - Intergenic
1019351458 7:556017-556039 AGGGAGACAGGGGCCCGGAGGGG - Intronic
1019637344 7:2083020-2083042 CGGGTGGCACAGGCCCCCAGGGG + Intronic
1020124098 7:5523212-5523234 CTGGGGACACAGGCCCAAAGAGG - Intergenic
1023076022 7:36483372-36483394 CTGGGGTCTCAGGCCTGGAGAGG + Intergenic
1026795597 7:73364181-73364203 CGGGGGACAGAGGCACGCTGAGG + Intergenic
1026817261 7:73522381-73522403 GGCGGGACCCAGGCGCGGAGCGG - Intergenic
1029112796 7:98222296-98222318 TGGGGGACCCTGGCCCAGAGGGG + Intronic
1029113474 7:98224827-98224849 CGGGGGGCACGGACCAGGAGGGG - Exonic
1030050430 7:105532422-105532444 CGGGGGAGATAGTCCCGGTGCGG + Intronic
1030303963 7:108001760-108001782 GGGGGGACACAAGCAGGGAGTGG + Intronic
1032800523 7:135314045-135314067 AGGGGGAGACAGGCTGGGAGAGG - Intergenic
1033365382 7:140669621-140669643 TGGGGAACACAGGCTCAGAGAGG + Intronic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1038828463 8:31032890-31032912 CGGGGGAGCCGGGCCCGGCGTGG - Exonic
1039996851 8:42541645-42541667 CGGGGTAAAGAGCCCCGGAGCGG + Intronic
1040841924 8:51793178-51793200 CGAGGGACCCAGGTCTGGAGTGG + Intronic
1041713722 8:60914951-60914973 CAGGAGACAGAGGCCCTGAGAGG - Intergenic
1042611721 8:70607962-70607984 CGGGGGGCTCGGGCCCGGGGTGG - Intronic
1048860066 8:138717736-138717758 TGGGGAACACAGGGCCAGAGGGG + Intronic
1049083049 8:140457644-140457666 CGGTGGCCCCGGGCCCGGAGCGG + Intronic
1049098148 8:140560860-140560882 TTGGGGACACAGGCCCCAAGAGG - Intronic
1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG + Intergenic
1049366033 8:142237320-142237342 CTGGGGACACAGGCCTGAACAGG - Intronic
1049510299 8:143023944-143023966 CAGGGGAGACAGGCTCAGAGTGG + Intergenic
1049594479 8:143477107-143477129 AGAGGGACCAAGGCCCGGAGGGG - Intronic
1049595112 8:143479801-143479823 GGGGGGACAAAGGCCAGGAGGGG + Intronic
1049607461 8:143536367-143536389 CGGCGGAGACAGGCCCTCAGGGG - Exonic
1049883994 9:15833-15855 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
1049896064 9:113307-113329 CCGGGGCCACAGGCTGGGAGTGG - Intergenic
1049992990 9:1007505-1007527 CGGGAGAGACAGGCCTGGAAAGG + Intergenic
1050537823 9:6645555-6645577 CGGGGGACCGAGGCCAGGAGAGG - Exonic
1052860281 9:33433843-33433865 CTGGGGACCCAGGCCTGGACAGG + Intergenic
1057871828 9:98723719-98723741 CAGGGCACACAGGCCTGGGGGGG + Intergenic
1057897477 9:98921385-98921407 AGGGGGAAAAAGGCCGGGAGTGG - Intergenic
1057935467 9:99234882-99234904 CAGAGGAGACAGGCCCAGAGAGG + Intergenic
1058619118 9:106864208-106864230 CGGGGGGCACCGGCCGGGTGGGG + Intronic
1058637613 9:107051586-107051608 AGAGGGACAGAGGCCCAGAGGGG + Intergenic
1060232179 9:121833602-121833624 TGAGGAACACAGGCCCAGAGAGG + Intronic
1060240278 9:121897273-121897295 GGCAGGACACAGGCCCAGAGAGG + Intronic
1060727546 9:126016373-126016395 CCTGGGAGACAGGCCCAGAGAGG - Intergenic
1060940823 9:127542006-127542028 CGGCGGGCACAGGACGGGAGTGG - Intronic
1061045810 9:128164283-128164305 CTGGGGAGACAGGCCAAGAGTGG - Intergenic
1061617744 9:131791438-131791460 AGGGGGACACAGGCCTTGCGTGG - Intergenic
1061725572 9:132580440-132580462 CGGGGGACAGTGGCCCGGCTCGG - Intergenic
1062159163 9:135070231-135070253 CTGGGGACACCGGCCTGGGGCGG - Intergenic
1062362524 9:136194406-136194428 GGGGGGACCCAGGCCAGGACAGG + Intergenic
1062368796 9:136225948-136225970 TGTGCGACACAGGCCCCGAGAGG + Intronic
1062556341 9:137114838-137114860 TGGGGGGCACAGCCCCGGCGCGG - Intronic
1189917419 X:45870006-45870028 GGGGGGACACATGCACAGAGTGG - Intergenic
1192089018 X:68132966-68132988 CGGGGGCCTGAGGCCCGGAGTGG - Intronic