ID: 1152230189

View in Genome Browser
Species Human (GRCh38)
Location 17:79110449-79110471
Sequence CCGGGTCCCACCTGCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152230189_1152230196 16 Left 1152230189 17:79110449-79110471 CCTGGACAGCAGGTGGGACCCGG 0: 1
1: 0
2: 0
3: 28
4: 335
Right 1152230196 17:79110488-79110510 GGAACCAAGCTGTGCTGCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 237
1152230189_1152230192 -10 Left 1152230189 17:79110449-79110471 CCTGGACAGCAGGTGGGACCCGG 0: 1
1: 0
2: 0
3: 28
4: 335
Right 1152230192 17:79110462-79110484 TGGGACCCGGTGGCTGTTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1152230189_1152230194 -5 Left 1152230189 17:79110449-79110471 CCTGGACAGCAGGTGGGACCCGG 0: 1
1: 0
2: 0
3: 28
4: 335
Right 1152230194 17:79110467-79110489 CCCGGTGGCTGTTGTTGGCACGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152230189 Original CRISPR CCGGGTCCCACCTGCTGTCC AGG (reversed) Intronic
900154633 1:1199022-1199044 CTGTGCCCCACCTGCTGTGCTGG - Intergenic
900168311 1:1253813-1253835 GGGGGTCACACCTGCTGGCCTGG - Intergenic
900531410 1:3155236-3155258 CCGGGTCCCACCGCCTGCCTTGG - Intronic
900952277 1:5864781-5864803 CCTGGTGCCACCAGCTGGCCGGG - Intronic
901727673 1:11254953-11254975 CGGGATCCCACATGCTGCCCAGG + Intronic
902262954 1:15240604-15240626 CAGGGTCTCTCCTGTTGTCCAGG - Intergenic
903579489 1:24360066-24360088 CTGTGGCCCACCTGCTCTCCAGG + Intronic
904591458 1:31617763-31617785 CCGGCCCCCTCCTGCAGTCCCGG + Exonic
906149113 1:43577494-43577516 CCCAGTCCCTCCTGCTGCCCTGG + Intronic
906506374 1:46382972-46382994 CAGGTTCCCTACTGCTGTCCTGG - Intergenic
907320678 1:53600185-53600207 CCTGGCCCCACCTGCTGCCAGGG - Exonic
913069635 1:115286969-115286991 CCGGGTTACGCCTGTTGTCCCGG - Intronic
915343463 1:155188606-155188628 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343498 1:155188684-155188706 CCGGGGCCCGCCTGGTGTCCGGG + Intronic
915343523 1:155188744-155188766 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343549 1:155188804-155188826 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343598 1:155188924-155188946 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343723 1:155189289-155189311 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343749 1:155189349-155189371 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343775 1:155189409-155189431 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343801 1:155189469-155189491 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343826 1:155189529-155189551 CCGGGGCCGGCCTGCTCTCCGGG + Intronic
915343845 1:155189589-155189611 CCGGGGCCGGCCTGCTCTCCGGG + Intronic
915343871 1:155189649-155189671 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343897 1:155189709-155189731 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343923 1:155189769-155189791 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915343948 1:155189829-155189851 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344019 1:155190009-155190031 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344044 1:155190069-155190091 CCGGGGCCGGCCTGCTCTCCGGG + Intronic
915344065 1:155190129-155190151 CCGGGGCCGGCCTGCTCTCCGGG + Intronic
915344087 1:155190189-155190211 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344176 1:155190426-155190448 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344228 1:155190547-155190569 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344253 1:155190607-155190629 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344327 1:155190787-155190809 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344367 1:155190882-155190904 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344418 1:155190996-155191018 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344443 1:155191056-155191078 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344517 1:155191236-155191258 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344542 1:155191296-155191318 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344599 1:155191477-155191499 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344649 1:155191597-155191619 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344672 1:155191657-155191679 CCGGGACCGACCTGGTGTCCGGG + Intronic
915344694 1:155191717-155191739 CCGGGGCGGACCTGGTGTCCGGG + Intronic
915344745 1:155191837-155191859 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
915344770 1:155191897-155191919 CCGGGGCCGGCCTGGTGTCCGGG + Intronic
918044818 1:180935463-180935485 CCGGGTGTCCCCTGCGGTCCAGG - Exonic
918687392 1:187435282-187435304 CCAGGTCGCTCCTACTGTCCTGG + Intergenic
918863126 1:189859558-189859580 ACAGGTGCCACCTGCTGGCCTGG - Intergenic
920499035 1:206474745-206474767 CCAGGTCCCAGCTTCTGGCCTGG - Intronic
922724961 1:227918381-227918403 CCAGGGCCCTCCTCCTGTCCAGG + Intergenic
922785020 1:228278389-228278411 CCAGGTCCTACCCGCTGTCCCGG - Intronic
922802673 1:228371442-228371464 CCGGGTGCCGCCTGCTCCCCGGG - Exonic
1063381503 10:5588915-5588937 ATGGGTCCCACATGCTTTCCTGG + Intergenic
1064578633 10:16770759-16770781 CGCGATGCCACCTGCTGTCCTGG - Intronic
1066064218 10:31750511-31750533 CCGGGGCCCAGCGGCTGCCCAGG - Intergenic
1066130687 10:32390555-32390577 CCGGGTGCCACATGCTGGCTTGG - Intergenic
1066460318 10:35607725-35607747 CCGTGTCTCACCTGCGGTTCTGG + Exonic
1066708688 10:38208987-38209009 CAGGGTCTCACCTGTTGCCCAGG - Intergenic
1068629540 10:59285144-59285166 CCGGGTCCCACCCCATCTCCAGG - Intronic
1068937827 10:62653241-62653263 CCTGGTCCCAACTGATCTCCTGG + Intronic
1072152736 10:92696370-92696392 CCTCCTCCCACCTGCTTTCCCGG + Intergenic
1072190502 10:93073515-93073537 CCCGGTCCCACCCGCTGCCCCGG - Intronic
1072624598 10:97103051-97103073 CCAAGCCCAACCTGCTGTCCTGG - Intronic
1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG + Intronic
1073179882 10:101577328-101577350 CTTGGTCCCACCTCCTGGCCAGG - Intronic
1075498833 10:122953896-122953918 CCTGGTACCAACTGCTCTCCCGG + Intronic
1075760209 10:124849718-124849740 ATGAGTCCCACCTGCTCTCCAGG - Intergenic
1075863301 10:125696292-125696314 CAGCTTCCCACCTGCTCTCCTGG - Intergenic
1077133551 11:987145-987167 CCGGGTTGGCCCTGCTGTCCTGG + Intronic
1077139925 11:1019777-1019799 CAGGGCCCCATCTGCTGCCCAGG - Intronic
1077240895 11:1510037-1510059 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240921 11:1510103-1510125 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240935 11:1510136-1510158 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240949 11:1510169-1510191 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240987 11:1510265-1510287 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077241001 11:1510298-1510320 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077321791 11:1946170-1946192 CCTGTTCCCACCTGCAGGCCTGG + Intergenic
1077501757 11:2912583-2912605 CCTCCTCCCACCTGCTGCCCAGG - Intronic
1078277590 11:9864933-9864955 CAGGGTCTCACCTGCTGCCCAGG + Intronic
1078823335 11:14905037-14905059 CCGGGTCATACCAGCTGTCCGGG + Intronic
1078877678 11:15414399-15414421 CATGTTCCCACCTGCTGACCTGG - Intergenic
1079915905 11:26367992-26368014 CTAGGTCCCACCTCCTGTACTGG + Intronic
1081773992 11:45665480-45665502 CCGGGTCCCGGCCCCTGTCCCGG - Exonic
1081989144 11:47328325-47328347 CCTGGTCACAGCTACTGTCCAGG - Intronic
1083329580 11:61891341-61891363 GCGGGTCCCTCCCGCGGTCCCGG + Exonic
1083484911 11:62977173-62977195 TGGGGGCCCACCTGCTCTCCAGG + Exonic
1083955294 11:65979443-65979465 ACAGGTGCCACCTTCTGTCCTGG + Exonic
1084311714 11:68320553-68320575 CCGGGTTCCAGCTGTTCTCCTGG + Intronic
1084402793 11:68955075-68955097 CCTGGTCCCACCTGGTGCCCCGG + Intergenic
1084416014 11:69033431-69033453 CCTGGTCCCAGCTGCTGGGCTGG + Intergenic
1085772013 11:79334167-79334189 GCAGGTCCCAGCTGCTTTCCAGG + Intronic
1086108214 11:83169570-83169592 CTGGGTTGAACCTGCTGTCCAGG - Exonic
1086359490 11:86043031-86043053 CTGGTTCACACCTGTTGTCCAGG + Intronic
1086384471 11:86292997-86293019 CAGGGTCTCACTTGCTGCCCAGG + Intergenic
1087304574 11:96473210-96473232 CCATGTCACACCTGCTGTCCAGG + Intronic
1090026743 11:123174055-123174077 CAGGGTCCCACCTGTTGCCCAGG - Intronic
1202804808 11_KI270721v1_random:1483-1505 CCTGTTCCCACCTGCAGGCCTGG + Intergenic
1091401715 12:185233-185255 CCCGGCCCCACCCGCTGTCATGG + Intergenic
1091996833 12:5000499-5000521 CAGGGTCCACCTTGCTGTCCTGG + Intergenic
1092013730 12:5139145-5139167 CCTGCTCCCTCCTGCTCTCCAGG - Intergenic
1092065026 12:5582909-5582931 CCGAGTTCCACCTGCAGTGCTGG - Intronic
1092262103 12:6958346-6958368 CCGGGACCCAGTTGCTGGCCAGG + Intronic
1094493528 12:30975911-30975933 CCGGATCCCTCCTGCTGCACAGG - Intronic
1095369624 12:41451751-41451773 CCAGGTCCCCTCTGGTGTCCTGG + Intronic
1096215016 12:49793782-49793804 CCGGGGCCCACAGGCTGGCCAGG + Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096977506 12:55707906-55707928 CCGGCTCCCGCCTCCTCTCCCGG + Intronic
1097891287 12:64780561-64780583 CCTGGGGCCACCTGCTGCCCGGG - Intergenic
1101779193 12:107820733-107820755 CTGGCCCCCACCTGGTGTCCTGG + Intergenic
1102243192 12:111338331-111338353 CCGTGTCTGACCTGCTGTCCCGG + Exonic
1102554650 12:113719040-113719062 CCAGGGCCCAGCTCCTGTCCTGG + Intergenic
1103116755 12:118340915-118340937 CAGGGTCTCACTTGCTGCCCAGG - Intronic
1103119821 12:118371929-118371951 CCTGCTCCCACCCGCTGTCCCGG + Intronic
1103342102 12:120226142-120226164 CAGGGCCACACCTGCTGTCTTGG + Intronic
1103562669 12:121800484-121800506 CCGGGTCCCACCGGCTCCTCCGG - Intronic
1103822924 12:123712703-123712725 GCGGGCCGCACCTGCTCTCCTGG + Intronic
1103942152 12:124506939-124506961 CCAGGTCCCACCGCCTCTCCAGG - Intronic
1104729582 12:131097615-131097637 CCTGGTCACTCGTGCTGTCCAGG + Intronic
1104927532 12:132321520-132321542 CCGGGGCCAACAGGCTGTCCTGG + Intronic
1105068696 12:133220735-133220757 CAGGATCCCACCTGCTGGGCTGG + Intronic
1106413236 13:29525305-29525327 CAGGGTCCCACTGGCTGGCCTGG + Intronic
1106911085 13:34464328-34464350 CCAGGTGACAACTGCTGTCCAGG - Intergenic
1110662395 13:78072460-78072482 CCGGGTCCCACCTCCAATACTGG + Intergenic
1110706839 13:78607389-78607411 CCGGGCCCCACTTGCAGGCCCGG + Intergenic
1112041749 13:95553712-95553734 CCCGGTGCCTGCTGCTGTCCTGG + Intronic
1113421985 13:110178081-110178103 CCAGGAGCCCCCTGCTGTCCAGG + Exonic
1113768177 13:112893896-112893918 CGGGGTCCCACCTGCCCCCCTGG - Intergenic
1117875703 14:60248913-60248935 CCGGGTCCTGGCTGCTATCCGGG + Intronic
1119600476 14:75972675-75972697 CTGGCTCCCACCTGCTGTTTCGG - Intronic
1119665583 14:76482756-76482778 CCTGGTCCCACATGCTCACCTGG - Exonic
1120609099 14:86618430-86618452 CAGTCTCCCAGCTGCTGTCCTGG - Intergenic
1121411428 14:93751073-93751095 CTGCTTCCCACCTGCTGGCCGGG + Intronic
1121473796 14:94175335-94175357 CTGGGTCCCAGCTACAGTCCTGG - Intronic
1121518468 14:94569710-94569732 CCGGCCAGCACCTGCTGTCCTGG - Exonic
1122481513 14:102050351-102050373 CCGGGCCCCATCAGCTGTCCCGG + Intronic
1122783424 14:104153344-104153366 CCGGGTCCCAGCTGGTGTGATGG + Intronic
1122840846 14:104461869-104461891 CCCGGGTGCACCTGCTGTCCGGG - Intergenic
1122917427 14:104865502-104865524 GCGCGTCCTACCTGCTGTTCGGG - Exonic
1123020678 14:105396406-105396428 CAGGGTCCCACCTGTTGCCGGGG - Exonic
1123499619 15:20867558-20867580 CTGGGACCCTCCTGCTGTGCAGG + Intergenic
1123556871 15:21441288-21441310 CTGGGACCCTCCTGCTGTGCAGG + Intergenic
1123593094 15:21878524-21878546 CTGGGACCCTCCTGCTGTGCAGG + Intergenic
1123937112 15:25199350-25199372 GCGGGACCTACCTGTTGTCCTGG + Intergenic
1124250218 15:28102092-28102114 CCCGGGGCCACCTGCTGTGCAGG + Intergenic
1124595882 15:31091203-31091225 CCGGGCCTCGCCTGCTGTGCTGG + Intronic
1125535019 15:40437648-40437670 CCAGGTCCCACCTTCTTTCCTGG - Intergenic
1127373318 15:58360005-58360027 CCTGGTTCCCTCTGCTGTCCTGG + Intronic
1127984733 15:64060870-64060892 CCGGTTCCCACCCGCAGCCCCGG - Intronic
1129243620 15:74266812-74266834 GTGGTTCCCACCTGCTCTCCCGG - Intronic
1129320842 15:74773816-74773838 CTGGTTCCCACCTGGAGTCCTGG - Intergenic
1131075472 15:89492566-89492588 CCAGGGCCTACCTGCTTTCCAGG - Intronic
1202965214 15_KI270727v1_random:168477-168499 CTGGGACCCTCCTGCTGTGCAGG + Intergenic
1132482318 16:172759-172781 CCGGGACTCCCCTGCGGTCCAGG + Intergenic
1132483166 16:176563-176585 CCGGGACTCCCCTGCGGTCCAGG + Intergenic
1132878064 16:2149004-2149026 CCGGGCGCCACCTGCTGCGCTGG - Intronic
1133769942 16:8861875-8861897 ACTGCTCCCATCTGCTGTCCTGG - Intronic
1134560457 16:15204769-15204791 TCTGGTCCCAGCTGCTCTCCAGG + Intergenic
1134920996 16:18116383-18116405 TCTGGTCCCAGCTGCTCTCCAGG + Intergenic
1136664884 16:31801828-31801850 ATGGGACCCACCTGCCGTCCAGG - Intergenic
1137275245 16:46929218-46929240 CCTGGTCACACCTGCTGAGCAGG - Exonic
1137598993 16:49743620-49743642 CCTGGTCCTGCCTGCTGCCCCGG + Intronic
1139340846 16:66267033-66267055 CCCCATCCCACATGCTGTCCAGG + Intergenic
1139513526 16:67440486-67440508 CCTGGTCCCATCTGCTGGCATGG + Intronic
1140517553 16:75555497-75555519 CCGGGTCACACCCGCGGGCCTGG - Intronic
1141160939 16:81628731-81628753 CCGGCTCCCACCTGTTCTCGTGG + Intronic
1141942840 16:87289813-87289835 CCGGGTCCCAACTGCCTGCCAGG + Intronic
1142407710 16:89900355-89900377 GAGGGTCCCACCTGCCGCCCAGG - Intronic
1142511268 17:394981-395003 CTGGGTCCCTCCAGCTGGCCCGG - Intergenic
1142694694 17:1627443-1627465 CAGAACCCCACCTGCTGTCCAGG - Intronic
1143018338 17:3903725-3903747 CCGGGACCCGCCTGCAGCCCTGG + Intronic
1143260825 17:5597005-5597027 CCTGGTCCCATCTGCTGCCTTGG - Intronic
1143400189 17:6638451-6638473 CCGGGGCACATCTGCTGCCCTGG + Intronic
1144641791 17:16941290-16941312 CTGGTTGGCACCTGCTGTCCTGG - Intronic
1145938176 17:28726931-28726953 GCGGGTCACTCCAGCTGTCCCGG - Intronic
1145999237 17:29121493-29121515 CCTGGTCCCACCCCCTGCCCTGG - Intronic
1146866318 17:36337904-36337926 CCGGGTCCAACTCGCTCTCCTGG + Intronic
1146887574 17:36482881-36482903 CCGCGTGCCACTGGCTGTCCGGG - Intergenic
1147069188 17:37938516-37938538 CCGGGTCCAACTCGCTCTCCTGG + Intergenic
1147080716 17:38018053-38018075 CCGGGTCCAACTCGCTCTCCTGG + Intronic
1147096659 17:38142013-38142035 CCGGGTCCAACTCGCTCTCCTGG + Intergenic
1148838892 17:50482217-50482239 CACGGCCCCACCTGCTGTGCCGG - Exonic
1148867301 17:50635161-50635183 CCGGGTCCCACGCGGTGTCGGGG + Intronic
1151207644 17:72519596-72519618 GCTGGTCCCACCCGCTGGCCCGG + Intergenic
1151625040 17:75271133-75271155 CCGGGACCCACCTGCCGGGCCGG + Exonic
1152045101 17:77930273-77930295 CCGGCTCCCTCCTGCTGCCCTGG - Intergenic
1152206249 17:78976216-78976238 CCAGGCCCCATATGCTGTCCTGG + Intronic
1152230189 17:79110449-79110471 CCGGGTCCCACCTGCTGTCCAGG - Intronic
1152244234 17:79176974-79176996 GGAGGTCCCAGCTGCTGTCCCGG + Intronic
1152307814 17:79531361-79531383 CCTGGGCCCACCTGCTCGCCTGG - Intergenic
1152457157 17:80423090-80423112 CCGAGTCACACTTGCTGGCCAGG - Intronic
1152763507 17:82122261-82122283 CCTGGTCCCAGCAGCTGGCCTGG - Intronic
1152919850 17:83060768-83060790 CCGGGTCCCACAGGCTGTACAGG - Intergenic
1153482085 18:5556965-5556987 CCGGGGCCCCCCAGCTGTGCTGG - Intronic
1153598596 18:6755681-6755703 CCAGGTTATACCTGCTGTCCAGG - Intronic
1154070266 18:11147268-11147290 GTGGGTCCCTCCTGCTGCCCCGG + Intronic
1154457676 18:14544433-14544455 CTGGGACCCTCCTGCTGTGCAGG + Intergenic
1155963947 18:32018926-32018948 CCGGGTCCCTCCTGCGCTCCAGG - Exonic
1156239877 18:35242873-35242895 TCCGTTCCCACCTGCTGCCCTGG - Exonic
1157167591 18:45372284-45372306 CAGGGTCTCACTTGTTGTCCAGG - Intronic
1157609949 18:48950010-48950032 CCGGGCCCAGCCTGCAGTCCAGG + Exonic
1160029807 18:75249165-75249187 CCAGGCCCCACCTGCTACCCGGG + Intronic
1160727304 19:623015-623037 CTGGGTCCCACCAGCTGCCACGG - Intronic
1160818620 19:1047682-1047704 CCGGGTCGCACCTGCTTTGCGGG + Intronic
1161307103 19:3574214-3574236 CCGTGTCCCGACTGCTGACCGGG + Intronic
1161313885 19:3608985-3609007 CCGAGGTCCACCTGGTGTCCTGG - Intergenic
1162028675 19:7908218-7908240 CCGTGCCCCTCCCGCTGTCCTGG - Intronic
1163617744 19:18339960-18339982 CAGGGGCCCTCCTCCTGTCCTGG - Intergenic
1163690186 19:18734491-18734513 CAGGGTCCCCCATGTTGTCCAGG - Intronic
1165461159 19:35945068-35945090 CCAGGTCCCACAGGGTGTCCGGG - Exonic
1166784127 19:45357619-45357641 CAGGGTCCCACCTGAAGTGCAGG + Exonic
1166974919 19:46600480-46600502 CCCGTTCCCACAGGCTGTCCTGG + Intronic
1167270288 19:48502263-48502285 CCTGGTCCCGCCTCCTCTCCTGG + Intronic
928330470 2:30354359-30354381 CAGGGCCTCACGTGCTGTCCTGG - Intergenic
929237305 2:39619412-39619434 CGGGGTTTCACCTGCTGGCCAGG + Intergenic
931838859 2:66128045-66128067 CCTGAGCACACCTGCTGTCCAGG + Intergenic
933966698 2:87435823-87435845 CCCAGTCCCACCTGCTTTGCTGG + Intergenic
934616815 2:95776472-95776494 CAGGGTCCCACTTGTTGCCCTGG + Intergenic
934843342 2:97645568-97645590 ACGGGACCTACCTGCAGTCCTGG - Intergenic
937466780 2:122139776-122139798 CCAGCTCCCACCCGCTTTCCAGG - Intergenic
938115651 2:128601618-128601640 TAGGGTCACACCTGCTGTCTCGG - Intergenic
940991181 2:160098176-160098198 CTTGGTCCCACCTGCCTTCCAGG - Intergenic
942742178 2:179193873-179193895 AAGGGTCCCACCTGGTGGCCGGG - Intronic
944329333 2:198446776-198446798 TGGTGTCCCACCTGGTGTCCTGG - Intronic
944894703 2:204152144-204152166 GCGGGTACCACCTGCAATCCAGG + Intergenic
946313272 2:218894636-218894658 CCTGGCCCCACCTGCTCCCCGGG - Intronic
948595287 2:239075876-239075898 CCAGCACCCACCTGCTATCCCGG - Intronic
949019517 2:241733573-241733595 CCAGGACCCATCTGCTGTCACGG + Intergenic
1168965218 20:1894670-1894692 CCGGGCCCCGGCTGCTGTCCCGG - Intronic
1172614561 20:36274776-36274798 CCGGGTCCCACCTGCTGCAAGGG + Intergenic
1172636959 20:36416469-36416491 CCGGGTTCCACCAACTGTCCTGG - Intronic
1173026391 20:39311114-39311136 CCTGCTCCCACCTCCTTTCCTGG + Intergenic
1175913010 20:62413608-62413630 AGGGGTCCCACCGGCTGTCCAGG - Intronic
1176173659 20:63707799-63707821 CCGCGTCCCACCTCGAGTCCTGG + Intronic
1176196265 20:63837478-63837500 CCTGGTCCCACCTCCGGTGCTGG + Intergenic
1176231533 20:64035702-64035724 CCGGGCCCCCGCTGCTGGCCCGG - Intronic
1176816482 21:13608905-13608927 CTGGGACCCTCCTGCTGTGCAGG - Intergenic
1177939515 21:27391405-27391427 CCGAATTCCACCTGCTGTCCTGG + Intergenic
1180022241 21:45135823-45135845 ACTGGGCCCACCTGCAGTCCAGG - Intronic
1181993947 22:26860013-26860035 CAGGGTTTCACCTGTTGTCCAGG - Intergenic
1183638933 22:39081769-39081791 CTGCCTCCCACCTGCTTTCCTGG + Intronic
1183916648 22:41125915-41125937 CTGGCTCCAATCTGCTGTCCAGG - Exonic
1185416230 22:50711974-50711996 CCCTTTCCCTCCTGCTGTCCGGG - Intergenic
950160982 3:10761193-10761215 CAGGGTCCCATGTGCTCTCCAGG - Intergenic
950400688 3:12767315-12767337 CCTTTTCCCCCCTGCTGTCCTGG - Intronic
950669525 3:14517784-14517806 CTGGGCCACACCTGCTGGCCAGG - Exonic
952337595 3:32417845-32417867 CAGGTTCTCACCTGGTGTCCAGG + Intronic
952878921 3:37970938-37970960 CCGGCTGCCACCTTCTGTTCTGG - Intronic
956414598 3:69013321-69013343 CCGGGGCCCGCCTGCGCTCCGGG + Intronic
956583991 3:70844687-70844709 CCAGGTCCCACCTCCAGTACTGG - Intergenic
960088719 3:113617133-113617155 CTGGTTTACACCTGCTGTCCTGG - Intronic
960090330 3:113632126-113632148 AGGGGTCCCATCTCCTGTCCCGG + Intergenic
961795051 3:129403235-129403257 CCAGGACCCACCTGCAGGCCTGG + Intronic
962746148 3:138398621-138398643 CCTGGTCACCCCTGCAGTCCTGG + Intronic
963539432 3:146566818-146566840 CCGCCTCCCAGCTGCTTTCCTGG + Intergenic
966465643 3:180228293-180228315 CTGGGTCCCCCCGGCTGTCTTGG - Intergenic
966649608 3:182284898-182284920 CTGGGGCCCACCTGCTGAACAGG - Intergenic
968477999 4:821393-821415 CCGTGTCCCACCTGAAGCCCCGG + Intronic
968568190 4:1326031-1326053 CCGGGGGCCACCTGCCTTCCAGG - Intronic
968631895 4:1656166-1656188 CAGGGTCACACCTGCTGCCACGG + Intronic
968953286 4:3705718-3705740 CCGGGCCCCACCTCCAATCCAGG - Intergenic
969220795 4:5757164-5757186 CCGAGTGCCAGCTGCTGTCTCGG - Intronic
969615129 4:8247656-8247678 CGGGGTCCTCCCTGCTGGCCTGG - Intergenic
969715115 4:8864591-8864613 CCTGGTCCCGCTTGCTCTCCAGG + Intronic
971441624 4:26693667-26693689 CCGGGTCTCACCTGTTGCCTAGG - Intronic
972783439 4:42305937-42305959 CCGGGCCTCAACTGCTGTTCTGG - Intergenic
985146553 4:186899758-186899780 CAGGGTCTCACCTGTTGCCCAGG - Intergenic
987663185 5:20904257-20904279 CCAGGTCCCACCTGCAGTAATGG + Intergenic
988581938 5:32475964-32475986 CGGGGTCTCACCTGTTGCCCAGG - Intergenic
988759502 5:34297928-34297950 CCAGGTCCCACCTGCAGTAATGG - Intergenic
989988952 5:50738805-50738827 CCGTGGCCCACATGCAGTCCAGG - Intronic
990304361 5:54480246-54480268 CAGGGTTCCACATGCTGTACAGG - Intergenic
990938259 5:61173522-61173544 CCTGCTCTCACCTGCTGTGCTGG + Intergenic
991631480 5:68660745-68660767 CTGGGTCCCAAGTTCTGTCCTGG - Intergenic
997528985 5:134570707-134570729 CCAGGTCCCCCCTGAGGTCCTGG + Intronic
997631790 5:135374278-135374300 ACGGTTCCCATCTGCTCTCCAGG + Intronic
997724250 5:136106910-136106932 CTGGCTCTCACCTGCTGCCCAGG - Intergenic
998138149 5:139685150-139685172 CCCGGTGCCCCCTGCTGGCCAGG - Intergenic
1001653247 5:173329740-173329762 CCGGGGCTCACCTGTTCTCCAGG - Intergenic
1002576323 5:180176209-180176231 CCAGGGCCCACCTGCTCTCTGGG - Intronic
1004503581 6:16229778-16229800 CCGGGTCCCCCCTGGGGTCTTGG + Intergenic
1006179720 6:32147613-32147635 AGGGGTCACACCTGCTGTCTGGG + Intergenic
1007406032 6:41637041-41637063 CCGGGATCCGGCTGCTGTCCGGG - Intronic
1010796149 6:80119096-80119118 CCAGGTCTCACATGCTGCCCAGG - Intronic
1011786693 6:90854428-90854450 CCTGGGGCCACCTGCTCTCCTGG - Intergenic
1014018649 6:116564001-116564023 CCAGCTCCCACCTGCAGCCCTGG + Intergenic
1017902990 6:158734406-158734428 CAGGATCCCACCGGCTGTCATGG - Intronic
1018182441 6:161235855-161235877 CCAGGTCCCACCTCCAGTGCTGG + Intronic
1018715246 6:166527320-166527342 CCGGGTCACTCCTGGTGCCCTGG + Intronic
1018930848 6:168239445-168239467 CCTGCTCCCACCTGCAGGCCCGG + Intergenic
1018942474 6:168318950-168318972 CCAGGTCCCCCCTGCTGTCTTGG - Intronic
1019346898 7:535516-535538 CCGGGTGCCCCTTGCTGGCCTGG - Intergenic
1019434625 7:1015631-1015653 CTGGGTCCTCCCTGCTCTCCTGG - Intronic
1019463761 7:1175273-1175295 CCCGTTCCCACCTGCGGTCATGG - Intergenic
1019574276 7:1728799-1728821 CCGGGTCCCAGCTCCTGTCGGGG + Intronic
1020708239 7:11572532-11572554 CAGGGTCTCACTTGCTGCCCAGG + Intronic
1022549927 7:31228796-31228818 CCATGCCACACCTGCTGTCCAGG - Intergenic
1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG + Intronic
1029207407 7:98878161-98878183 CCCGGTCCCCGCTGCTCTCCTGG - Intronic
1029401878 7:100352083-100352105 CCCGGCACCCCCTGCTGTCCAGG + Intronic
1032263143 7:130352331-130352353 CCGCGACCCTCCAGCTGTCCTGG - Intronic
1035466611 7:159083616-159083638 CTGCTTCTCACCTGCTGTCCCGG + Intronic
1035579394 8:730887-730909 CCAGGCCCCACCTGGTGTCTGGG - Intronic
1036578786 8:10054276-10054298 CCGGGCCACACCCCCTGTCCAGG + Exonic
1036635772 8:10548681-10548703 CCGGGTCCCACCTTGTGCCTGGG - Intronic
1037471152 8:19212272-19212294 CCAGTTGACACCTGCTGTCCTGG + Intergenic
1039157885 8:34582363-34582385 CAGGGTCTCACCAGCTGCCCAGG - Intergenic
1039311381 8:36321471-36321493 CCTGGTTCCACCAGCGGTCCAGG - Intergenic
1040777083 8:51057990-51058012 CGGGGTCTCACCTGTTGCCCAGG + Intergenic
1042800144 8:72709705-72709727 CCAGGCCCCACCTGCAGCCCTGG + Intronic
1046687151 8:117240130-117240152 CCTGGTGCCACCTGTGGTCCTGG - Intergenic
1048451929 8:134541035-134541057 CTGGGTTCCACGTGCTGGCCAGG + Intronic
1049082965 8:140457341-140457363 CCGGCCCACACCTGCTGCCCGGG - Intronic
1049093525 8:140534548-140534570 CCGGGTCCAGCCTGCAGCCCGGG - Intronic
1049449986 8:142655401-142655423 CCTGGTGGCACCTGTTGTCCTGG - Intergenic
1049510124 8:143023061-143023083 CCGGCTCCCTCCCACTGTCCCGG - Intronic
1049529340 8:143146684-143146706 CCCTGTCCCAGCTGCTGGCCCGG - Intergenic
1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG + Intergenic
1049724993 8:144141738-144141760 CGCGGTCCCACCTTCTGGCCAGG - Intergenic
1054815925 9:69475507-69475529 CCAGTTCACACCTGTTGTCCAGG - Intronic
1054885142 9:70188794-70188816 TGGGGTCTCACATGCTGTCCAGG + Intronic
1054914879 9:70486488-70486510 CAGGGTCTCATCTGTTGTCCAGG + Intergenic
1055572608 9:77632317-77632339 TAGGGACCCACCTCCTGTCCAGG - Intronic
1056691622 9:88813145-88813167 CCTGGTCTCTCCTGTTGTCCAGG + Intergenic
1056914304 9:90731324-90731346 CTGGTTTACACCTGCTGTCCTGG + Intergenic
1057047995 9:91900485-91900507 GCGGGTCCCACGTGCAGGCCCGG - Intronic
1057083479 9:92189363-92189385 CCGGGGCCCAGCAGCAGTCCCGG + Intergenic
1057447168 9:95124724-95124746 CAGGGTGCCTCCTGCTGACCTGG + Intronic
1057547163 9:96027280-96027302 CCGTCTCCCACCTGCTTTGCCGG - Intergenic
1059465978 9:114469186-114469208 CCAGGTCGCACCTGCTGGCTTGG - Intronic
1060215397 9:121735872-121735894 CCCTGCCCCACCTGCTGGCCTGG - Intronic
1061396125 9:130344028-130344050 CCGGGCACCAGCTGCTGCCCAGG - Intronic
1061607377 9:131721290-131721312 CCGGCTTCTGCCTGCTGTCCTGG - Intronic
1061922194 9:133788321-133788343 CCGGGTCCCCCCTGCTACCCAGG - Intronic
1062057340 9:134475394-134475416 CCGGGTCCCTCCTCCTTCCCCGG - Intergenic
1062103324 9:134739492-134739514 CAGGGCCCTGCCTGCTGTCCGGG + Intronic
1062253951 9:135612397-135612419 CCAGGGCCCAGCTGCTGCCCTGG - Intergenic
1062332507 9:136050909-136050931 GCGGCCCCCACCTCCTGTCCCGG - Intronic
1203761007 EBV:13012-13034 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203761114 EBV:13306-13328 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203761936 EBV:16084-16106 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762043 EBV:16378-16400 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762865 EBV:19156-19178 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762972 EBV:19450-19472 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203763794 EBV:22228-22250 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203763901 EBV:22522-22544 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203764723 EBV:25300-25322 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203764830 EBV:25594-25616 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203765652 EBV:28372-28394 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203765759 EBV:28666-28688 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203766581 EBV:31444-31466 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203766688 EBV:31738-31760 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203767510 EBV:34516-34538 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203767617 EBV:34810-34832 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203530876 Un_GL000213v1:140562-140584 CTGGGACCCTCCTGCTGTGCAGG + Intergenic
1185431243 X:13336-13358 CCGGTTCCCATCTGCTGATCTGG - Intergenic
1185432097 X:17371-17393 CCGGTTCCCATCTGCTGATCTGG - Intergenic
1185440510 X:225733-225755 CCGGTTCCCATCTGCTGATCTGG - Intergenic
1185441413 X:230085-230107 CCGGTTCCCATCTGCTGATCTGG - Intergenic
1186334562 X:8572754-8572776 CTGGGTCCCACCTGCACTCAGGG - Intronic
1186455644 X:9708038-9708060 CCATGTGACACCTGCTGTCCCGG - Intronic
1192496977 X:71622699-71622721 CCGGGCCCCACCTGTGGTCAAGG + Intergenic
1192618457 X:72652329-72652351 CCATGTCCCTCCTGCTGCCCGGG - Intronic
1193257433 X:79366863-79366885 CCAGCTCACACCAGCTGTCCTGG - Intronic