ID: 1152230582

View in Genome Browser
Species Human (GRCh38)
Location 17:79112322-79112344
Sequence GTTGAGGGGTGCATCCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152230570_1152230582 30 Left 1152230570 17:79112269-79112291 CCAGGAACCCCATGTTTCTCTCT 0: 1
1: 0
2: 3
3: 28
4: 321
Right 1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 92
1152230575_1152230582 21 Left 1152230575 17:79112278-79112300 CCATGTTTCTCTCTGCAGGGTCA 0: 1
1: 1
2: 2
3: 24
4: 272
Right 1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 92
1152230573_1152230582 23 Left 1152230573 17:79112276-79112298 CCCCATGTTTCTCTCTGCAGGGT 0: 1
1: 0
2: 0
3: 7
4: 256
Right 1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 92
1152230574_1152230582 22 Left 1152230574 17:79112277-79112299 CCCATGTTTCTCTCTGCAGGGTC 0: 1
1: 0
2: 1
3: 17
4: 207
Right 1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152230582 Original CRISPR GTTGAGGGGTGCATCCCACC TGG Intronic
901855415 1:12041536-12041558 CTAGAGGGGTCCACCCCACCTGG + Intergenic
904300372 1:29550024-29550046 GTTGAGGGATCCGTCCCACAGGG + Intergenic
907232336 1:53011658-53011680 GTTGAGGGCTGAGTCCCACCAGG - Intronic
910574869 1:88750021-88750043 GTTGTGTGGTGTATACCACCTGG + Intronic
911637826 1:100255442-100255464 CTTGAGAAGTACATCCCACCTGG + Intergenic
915905274 1:159872652-159872674 GTTGGGGGGTGCAGGCCCCCAGG - Intronic
916946091 1:169729219-169729241 CTTGAGTGGTGCATTCAACCTGG + Exonic
917965539 1:180176276-180176298 GTGCAAGGGTCCATCCCACCAGG + Intronic
918081507 1:181211199-181211221 ACTGAGGGCTGCATCTCACCAGG - Intergenic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1063811966 10:9721876-9721898 TTTGAGTGGCCCATCCCACCTGG - Intergenic
1064480692 10:15737578-15737600 GATGGTGGGTTCATCCCACCTGG - Intergenic
1064903013 10:20314912-20314934 GTTGAGGGCTCAATCCCACAAGG + Intergenic
1065182522 10:23140739-23140761 GCAGAGGGGGGCATCCCACAAGG + Intergenic
1067039250 10:42940255-42940277 GGTGATGGATGCAGCCCACCAGG + Intergenic
1067327394 10:45282287-45282309 GTTGATGGGTGCATTACAGCAGG + Intergenic
1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG + Intronic
1074942250 10:118247018-118247040 CTTGCTGGGTGCTTCCCACCGGG + Intergenic
1076811058 10:132886574-132886596 ACTGAGGGTTCCATCCCACCAGG - Intronic
1078388287 11:10912411-10912433 GTTGGGGTGTGCCTCCCTCCTGG - Intergenic
1087964723 11:104398455-104398477 GTTGAGAGGTGAAGCCCACTAGG - Intergenic
1089554979 11:119311258-119311280 GGTGAGGGCTGCATCCCTGCAGG - Exonic
1089689140 11:120175689-120175711 GTTGAGGGTTTCATCCCAGCTGG - Intronic
1099755927 12:86847724-86847746 GTTAATGGGTGCAGCACACCAGG + Intergenic
1108347222 13:49558267-49558289 GTCCAGGGCTGCTTCCCACCTGG + Intronic
1112991055 13:105514469-105514491 GTTGAGGGATTCATTCTACCTGG - Intergenic
1115046878 14:29005326-29005348 GTTAATGGGTGCAGCACACCAGG + Intergenic
1118761703 14:68884237-68884259 GTTGAAGGGTGCAGCCCGCTTGG + Exonic
1119784300 14:77300953-77300975 GTTGGGGGGTCCAGCCCACCTGG + Intronic
1123720904 15:23061327-23061349 TTTGCTGGGTGCAGCCCACCTGG + Intergenic
1126500022 15:49335167-49335189 CTGGAGGGGTGCACCCCAACAGG - Intronic
1128705459 15:69834760-69834782 GTTTAGGGGTCCAGCCCCCCGGG - Intergenic
1129342230 15:74893505-74893527 GTTGAGTGCTGCTTCCCAACTGG + Intronic
1130711028 15:86281244-86281266 GTCTATGGGTGCATGCCACCAGG - Intronic
1132724856 16:1334151-1334173 GCTGGGGGGTGCAGCCCGCCCGG - Intronic
1132996757 16:2827452-2827474 GGAGGGGGGTGCCTCCCACCAGG + Intergenic
1133207382 16:4241617-4241639 GTTGAGGTGACCCTCCCACCTGG - Intronic
1135159232 16:20078831-20078853 GGTGAGGGGAGCATCCCAGGTGG + Intergenic
1141710469 16:85695989-85696011 GCTGAGTGCAGCATCCCACCAGG + Intronic
1142495803 17:305701-305723 GTTGAGGAGAGGAGCCCACCAGG - Intronic
1144769033 17:17748933-17748955 TTTGAGGTGTGCCTGCCACCAGG - Intronic
1150162914 17:62914467-62914489 GAGGTGGGGTGGATCCCACCTGG - Intergenic
1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG + Intronic
1160685649 19:435306-435328 CCAGAGGGGTGCACCCCACCTGG + Intronic
1162872636 19:13598053-13598075 GGTGAAGGGTGCTTCCCACAGGG + Intronic
1163024787 19:14504542-14504564 GATTACGGGTGCATACCACCAGG + Intergenic
1163577886 19:18121486-18121508 GTTGAGGGGTGATTCCCTCCTGG + Intronic
1167671908 19:50858414-50858436 GTTGTGGGCTGGACCCCACCTGG - Intronic
1167753397 19:51394678-51394700 GTTGAGGGGAGAATCCCTCTCGG + Intergenic
927847815 2:26480408-26480430 GATGGTGGGGGCATCCCACCCGG + Intronic
930237727 2:48903808-48903830 GTTGAGGGGTTCATGCCTCAGGG + Intergenic
935744802 2:106181105-106181127 GTTCATGGGGGCATCCCACAGGG + Intronic
936642176 2:114326125-114326147 GCTGGGTGGTGCATGCCACCAGG + Intergenic
937247993 2:120505881-120505903 GTGGACAGGGGCATCCCACCTGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
946171944 2:217900756-217900778 GCTGAGGAGTGCACCCCACTGGG + Intronic
948145901 2:235707885-235707907 GCTGGGGAGTGCATCTCACCAGG - Intronic
1170634379 20:18092167-18092189 GTGTAGGGGTGCATGCCACGGGG - Intergenic
1171743426 20:28933226-28933248 GTTAATGGGTGCAGCACACCAGG - Intergenic
1174495265 20:50936845-50936867 GGTGATAGGTGAATCCCACCAGG - Intronic
1175403346 20:58712756-58712778 GTTGAGGGGCCCATGGCACCTGG + Intronic
1179580378 21:42339555-42339577 GTTGAGGGGGACATCACACTGGG + Intergenic
1180179641 21:46112176-46112198 GTGGAGGTGTTCAGCCCACCGGG + Exonic
1184021389 22:41824154-41824176 GTTGAAGGGAGCACACCACCAGG + Intronic
952831661 3:37570193-37570215 CTTGAGAGGTGCATCCTACTGGG - Intronic
952973324 3:38671114-38671136 GTTGAGGGCTGCTCCCCACTTGG + Intergenic
954678922 3:52331009-52331031 GCAGAGGGGGGCATCCCAGCGGG + Intronic
955692689 3:61605987-61606009 GGTGAGGGGTGCCACCAACCAGG - Intronic
960139689 3:114140094-114140116 TCTGAGGGCTGCATCCCTCCTGG - Intronic
960308174 3:116088029-116088051 GATGATAGGTGCATGCCACCAGG + Intronic
960827061 3:121799235-121799257 GTTGATGGCTGAATCCCATCAGG - Exonic
961993778 3:131219451-131219473 GTTGATGGGTGCAGCAAACCTGG + Intronic
967025362 3:185559798-185559820 GTTGATGGGTGCAGCAAACCAGG + Intergenic
969178685 4:5420705-5420727 GCTGAGGGGGACATCCCACAGGG + Intronic
976441128 4:85076022-85076044 GTTCAGGGTTGGGTCCCACCTGG - Intergenic
986515147 5:8553772-8553794 TTTTAGGGGTGCATCTCTCCAGG - Intergenic
989107271 5:37875334-37875356 GCTGAGAGCTGCACCCCACCGGG - Intergenic
996525657 5:124476611-124476633 GTTGAGGGATGCATTCGAGCAGG - Intergenic
1002441167 5:179265284-179265306 GTTCAGGGGTGGAGCCGACCAGG - Intronic
1005109297 6:22262001-22262023 GTTAATGGGTGCAGCACACCAGG - Intergenic
1013155492 6:107489129-107489151 GGGGAGGGGAGGATCCCACCGGG + Intergenic
1023023508 7:36031411-36031433 TTTGAGGGGTGCATCAAACAGGG + Intergenic
1024764701 7:52644155-52644177 GTTAATGGGTGCAGCACACCAGG - Intergenic
1032079381 7:128851085-128851107 GTGGAGGTCTGCTTCCCACCAGG - Intronic
1034054244 7:148018238-148018260 GTTGAGGTGTTCATCCCAGGTGG + Intronic
1034699199 7:153082129-153082151 GATTATGGGTGCATACCACCAGG + Intergenic
1036490549 8:9221243-9221265 GTTGAGGTATGCCTCCCTCCCGG - Intergenic
1040482866 8:47842142-47842164 GATGGGGAGTGCAGCCCACCAGG + Intronic
1041510387 8:58649073-58649095 TTTGAAGGGTGCAGCCCACTTGG - Intronic
1045979895 8:108172312-108172334 GTTAATGGGTGCAGCACACCAGG + Intergenic
1050368459 9:4896162-4896184 GTTGATGGGTGCAGCAAACCAGG - Intergenic
1052465220 9:28821408-28821430 GTTGGGGTGAGCATCCCACCAGG - Intergenic
1060657227 9:125380464-125380486 TGTGAGGGGTGGTTCCCACCAGG + Intergenic
1060659418 9:125395231-125395253 GTTGAGGAGCGCATGCCACCAGG + Intergenic
1060779284 9:126399731-126399753 CTAGAGGGCTGCAGCCCACCAGG - Intronic
1186033178 X:5392022-5392044 GGTGAGGGGTGCAGCACAGCAGG - Intergenic
1189656585 X:43251106-43251128 TTTGCAGGGTGCATCCCACTTGG + Intergenic
1190493467 X:51005212-51005234 GTTGAGGTGTGCCACCCTCCTGG - Intergenic
1193360101 X:80571475-80571497 GCTGGGGGATGCACCCCACCTGG + Intergenic
1195215161 X:102691910-102691932 GGTAACGGGTGCATCTCACCAGG - Intergenic
1201016093 Y:9603551-9603573 GTTAATGGGTGCAGCACACCAGG - Intergenic