ID: 1152231271

View in Genome Browser
Species Human (GRCh38)
Location 17:79115258-79115280
Sequence CAAGGAGCTTTGTGATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 156}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152231271_1152231286 20 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231286 17:79115301-79115323 GCTGGAAATGCCTTCACTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 156
1152231271_1152231284 18 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231284 17:79115299-79115321 GGGCTGGAAATGCCTTCACTGGG 0: 1
1: 1
2: 1
3: 9
4: 153
1152231271_1152231279 -3 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231279 17:79115278-79115300 TTGGCGCCGGGGGTCGAGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1152231271_1152231288 30 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231288 17:79115311-79115333 CCTTCACTGGGGGTGACTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 138
1152231271_1152231278 -4 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231278 17:79115277-79115299 CTTGGCGCCGGGGGTCGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 72
1152231271_1152231285 19 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231285 17:79115300-79115322 GGCTGGAAATGCCTTCACTGGGG 0: 1
1: 0
2: 3
3: 11
4: 192
1152231271_1152231281 2 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231281 17:79115283-79115305 GCCGGGGGTCGAGCAGGGGCTGG 0: 1
1: 0
2: 1
3: 45
4: 570
1152231271_1152231280 -2 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231280 17:79115279-79115301 TGGCGCCGGGGGTCGAGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1152231271_1152231283 17 Left 1152231271 17:79115258-79115280 CCTGCTCATCACAAAGCTCCTTG 0: 1
1: 1
2: 0
3: 7
4: 156
Right 1152231283 17:79115298-79115320 GGGGCTGGAAATGCCTTCACTGG 0: 1
1: 0
2: 1
3: 22
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152231271 Original CRISPR CAAGGAGCTTTGTGATGAGC AGG (reversed) Intronic
900099090 1:953391-953413 CGAGGTGCTTTGGGAAGAGCTGG - Intronic
900901952 1:5523169-5523191 CAAGGAGCTTTGAGCAGGGCTGG - Intergenic
901756904 1:11446907-11446929 CAAGGAGGTTAGTAATGGGCAGG + Intergenic
909893030 1:81031755-81031777 CAAGGAGCTTAGTGAAGAATAGG + Intergenic
912972894 1:114300610-114300632 CAGGGAGCTGTGTGATAGGCTGG - Intergenic
913259089 1:116982477-116982499 CAAGGTCCTCTGTGCTGAGCAGG + Intronic
913294907 1:117309990-117310012 CCAGGAACTCTGTGCTGAGCAGG - Intergenic
915080660 1:153349610-153349632 GCTGGAGCTGTGTGATGAGCAGG + Intergenic
915333005 1:155125310-155125332 CACTGAGTGTTGTGATGAGCTGG - Intergenic
915846131 1:159267087-159267109 CAAGTGGCTTAGTCATGAGCTGG - Intergenic
917233829 1:172868155-172868177 CAAGCTGCTGGGTGATGAGCAGG + Intergenic
919536087 1:198789447-198789469 CAATCAGCTTAGTGGTGAGCAGG - Intergenic
919615893 1:199808252-199808274 CAAAGTGCTGTCTGATGAGCAGG - Intergenic
921723541 1:218500046-218500068 CAAGGACCTTTATGAGGAGTGGG + Intergenic
921774300 1:219079324-219079346 CAAGTAGCTTTAAGATGAGGAGG - Intergenic
922453064 1:225752032-225752054 CAGGGTGCTTTCTGCTGAGCTGG - Intergenic
1063135926 10:3216178-3216200 CAAGGAGCTTCATTTTGAGCTGG + Intergenic
1065491676 10:26288563-26288585 CAAGCAGCTTTAAAATGAGCAGG + Intronic
1069521568 10:69125147-69125169 CAGTGAGCTTTGGGAAGAGCAGG - Intronic
1069681691 10:70290141-70290163 CAAGGTGCTCAGTGAGGAGCGGG - Intergenic
1072285709 10:93912438-93912460 TAAGGAGCTTTGACATGTGCTGG - Intronic
1072428595 10:95351648-95351670 CAAGAGGCTTTGGGCTGAGCCGG - Intronic
1080224224 11:29942726-29942748 CAAGGACCTTTCAGATAAGCAGG + Intergenic
1082592518 11:55030460-55030482 GAAGAAGCTATCTGATGAGCCGG - Intergenic
1083256170 11:61496642-61496664 CCAGGACCTTTGTGATGGGCAGG + Intergenic
1089596594 11:119584744-119584766 CAAGGCAATTTGTGAGGAGCAGG - Intergenic
1096111910 12:49033808-49033830 CAGGGAGCTTGGTGAGCAGCCGG + Exonic
1097192676 12:57226939-57226961 GAGGGAGCTTTGGGATGAGGGGG + Intergenic
1101707247 12:107232061-107232083 CAAGGAGCTCTGTGATGCTGTGG - Intergenic
1103701309 12:122850116-122850138 CTAGGAGCTTCGTGATGCCCTGG - Intronic
1103973648 12:124688088-124688110 GACGGTGCTTTGTGCTGAGCCGG - Intergenic
1104311594 12:127658129-127658151 CAAGGAGCCTTGGGATGACATGG - Intergenic
1104513272 12:129401076-129401098 CATGCAGCTTTGTGATGGCCAGG - Intronic
1105857356 13:24385533-24385555 GGAGGAGCTGTGTGCTGAGCCGG - Intergenic
1106533637 13:30618279-30618301 CAAGGAGCGTGGAGATGGGCAGG + Intronic
1111382937 13:87482781-87482803 CAAGGATATTTTTGAAGAGCTGG - Intergenic
1113793511 13:113043195-113043217 CAAGGGGCTGTGTGTTGGGCGGG - Intronic
1114300060 14:21367695-21367717 CAAGGTATTTTGTGATGATCTGG + Intronic
1115518306 14:34207452-34207474 CAGGCCGCTTTGTGTTGAGCTGG - Intronic
1115770753 14:36662546-36662568 CAAGGACTTTAGTGAGGAGCAGG + Intronic
1122789774 14:104179313-104179335 CAAGCACCTGTGTGAGGAGCTGG + Exonic
1123723890 15:23083494-23083516 CAAGGAAGTTTGTGATGGGTAGG + Intergenic
1123800565 15:23815468-23815490 CAAGGAGCTGTGTGGTGAGTGGG + Intergenic
1131149143 15:90036069-90036091 CAAGCAGCTTTCTCAAGAGCTGG + Intronic
1131992650 15:98105738-98105760 TAAAGAGCTTTGTGAAGATCAGG - Intergenic
1132532779 16:461560-461582 CGAGGAGCCTGGTGATGTGCAGG - Intronic
1133751460 16:8729321-8729343 CTAGGAGTTTTGTTATTAGCTGG + Intronic
1136683226 16:31979765-31979787 CCAGCAGTTCTGTGATGAGCAGG + Intergenic
1136783860 16:32923321-32923343 CCAGCAGTTCTGTGATGAGCAGG + Intergenic
1136885924 16:33930485-33930507 CCAGCAGTTCTGTGATGAGCAGG - Intergenic
1138081334 16:54093881-54093903 CAGGGGGCTTTGAGATGAGGTGG + Intronic
1139306818 16:65993671-65993693 GAAGGAGTTTTCTGATGAGATGG - Intergenic
1139573703 16:67828541-67828563 CCAGCATCTTTGTGATGATCTGG - Exonic
1140240873 16:73199019-73199041 CAAAGAGCTTTGTTTTGAACGGG - Intergenic
1203086517 16_KI270728v1_random:1187323-1187345 CCAGCAGTTCTGTGATGAGCAGG + Intergenic
1143649664 17:8255681-8255703 CCAGGAGCTTGGTGAGTAGCTGG + Exonic
1143863103 17:9905348-9905370 CCAGGAGCTTTGTGGAGGGCGGG + Exonic
1145773977 17:27513834-27513856 GGAGGACCTGTGTGATGAGCAGG - Intronic
1147144132 17:38475474-38475496 CCAGCAGTTCTGTGATGAGCAGG + Intronic
1147247623 17:39132621-39132643 GAAGGAGCATTGTGGTGAGATGG + Intronic
1151884257 17:76914315-76914337 CAAGGAGCTTGGCCAGGAGCCGG + Intronic
1151936752 17:77266575-77266597 CAAGGTGCCTTGTGATGAAAAGG + Intergenic
1152231271 17:79115258-79115280 CAAGGAGCTTTGTGATGAGCAGG - Intronic
1152899006 17:82929407-82929429 CAAGGAGCTGGGTGATGCGTGGG - Exonic
1153675465 18:7452650-7452672 CAAGGGACTTGGTGATGTGCTGG - Intergenic
1156257246 18:35410053-35410075 CTTGGAACTTTGTGATGATCTGG - Intergenic
1156869193 18:41925656-41925678 AAGGGAGCTTAGTGATTAGCTGG - Intergenic
1157302474 18:46488981-46489003 CAACAAGATCTGTGATGAGCTGG - Exonic
1158170186 18:54589308-54589330 AAAGGATCTTTGTTCTGAGCAGG - Intronic
1160120193 18:76123096-76123118 CGAGAAGTTTTGAGATGAGCAGG - Intergenic
1160345542 18:78129061-78129083 GAAGGAGCCTTGTGAAGAGGGGG + Intergenic
1164774480 19:30842338-30842360 CAAGGGGCTTGGTGGTGAGCCGG - Intergenic
1168415432 19:56164736-56164758 GAAGGAACTGGGTGATGAGCTGG - Intergenic
1168548220 19:57271526-57271548 CCAGGAGTTTTGAGAGGAGCTGG + Intergenic
925464636 2:4095974-4095996 CAAGTGGCTTTGTGGAGAGCTGG + Intergenic
926432902 2:12807747-12807769 CCATGAGTTTTGTGATCAGCGGG - Intergenic
926680378 2:15658705-15658727 CACAGAGCTTGGTGATGAGTTGG - Intergenic
926821000 2:16851753-16851775 TAAGGACCTTTGTGATTAGATGG + Intergenic
926918051 2:17912289-17912311 CAAGCAGCTTTGGAGTGAGCAGG - Intronic
928306863 2:30177488-30177510 TACAGAGCTTTGTGATCAGCAGG - Intergenic
930277933 2:49335435-49335457 GAAGCAGATTTGTCATGAGCTGG - Intergenic
931659025 2:64539876-64539898 CAAGAAGCTTGGTGGTGAGGAGG + Intronic
931894107 2:66709839-66709861 GAAGGAGCTTTGGGTTTAGCAGG + Intergenic
932312540 2:70755213-70755235 CAGGGAGATTTGAGATGAGAAGG - Intronic
932627517 2:73309392-73309414 CAAGGAGCTTGGTGTCGAGTAGG - Intergenic
933742384 2:85544755-85544777 CAATGAGCTTTCTGAACAGCTGG + Exonic
937791642 2:125968545-125968567 CCAGGAGATATGTGAAGAGCAGG - Intergenic
938450913 2:131419084-131419106 GAAGGATTTTTGTGATGAGAGGG - Intergenic
939397423 2:141649086-141649108 CAAGGAGGGTTGTGTTCAGCTGG + Intronic
940042288 2:149373132-149373154 CAAGGGGCTTTGTGGGGTGCAGG + Intronic
941893013 2:170601787-170601809 CAAGCAGCTTTGTGAAAAGAAGG - Intronic
943104359 2:183526158-183526180 CAATGAGCTTTTTGTGGAGCAGG + Intergenic
946002279 2:216492483-216492505 CCAGGGGCTTTGTGGAGAGCAGG + Intergenic
948342767 2:237268565-237268587 CAACCAGCTTTGGGCTGAGCTGG - Intergenic
1168896899 20:1330003-1330025 TAAGGAGCTGTGTGCTGAGGTGG + Intronic
1170916265 20:20628958-20628980 CACGGAGCTCTCTGAGGAGCTGG - Intronic
1173041164 20:39464320-39464342 GAAGCAGCTTTGTGAAAAGCTGG + Intergenic
1173386166 20:42589982-42590004 CGTGGACCTTTGTGATGGGCTGG + Intronic
1173878677 20:46394044-46394066 CAAGGAAGTTTGTGATGGGTAGG - Exonic
1174061049 20:47833385-47833407 CCAGAAACTTTGTGAGGAGCCGG - Intergenic
1174070726 20:47897314-47897336 CCAGAAACTTTGTGAGGAGCCGG + Intergenic
1174153337 20:48501342-48501364 CCAGAAACTTTGTGAGGAGCCGG - Intergenic
1175530081 20:59668602-59668624 GAAGGAGCTTTGAGAGGACCTGG - Intronic
1180065521 21:45410283-45410305 ACAGGAGCCTTGTGATGGGCAGG + Intronic
1181522880 22:23459602-23459624 GAGGGAGCTTTGTGGTGGGCTGG + Intergenic
1183383792 22:37503589-37503611 CAAGGAGGTGTCTGATGAGGAGG - Intronic
950330878 3:12155243-12155265 CAAGGAGCTTAGAAATGAGTAGG + Intronic
950901072 3:16498044-16498066 CAATGCCCTTTGGGATGAGCTGG - Intronic
951318942 3:21221963-21221985 ACAGAAGCTTTGTGATGACCAGG - Intergenic
951530879 3:23697012-23697034 CAAGGAGCTCAGAGGTGAGCTGG - Intergenic
953253767 3:41269165-41269187 CAAAAAGATGTGTGATGAGCAGG + Intronic
953741333 3:45541714-45541736 CTTGGAGCTGTGTGAGGAGCCGG - Intronic
955789583 3:62574394-62574416 CAAAGAGATTAGTGAAGAGCTGG + Intronic
958478365 3:94614534-94614556 CAAGGAGCTTTGTAATTTGGAGG - Intergenic
959439124 3:106355035-106355057 GAATTAGCTTTTTGATGAGCTGG + Intergenic
959997603 3:112695905-112695927 CAATGAGCTTTCTGAACAGCTGG - Intergenic
961330993 3:126137923-126137945 GAAGGAGCTGTGTGATGGCCTGG - Exonic
962371503 3:134824460-134824482 CAGGGAGCAATGTGATGAGAAGG - Intronic
964160121 3:153636549-153636571 GGAGGAGGTTTGTGCTGAGCAGG - Intergenic
968137356 3:196228726-196228748 CCAGGAGCCCTGTGAGGAGCCGG + Intronic
968706661 4:2081510-2081532 CAAGGAGGTTTGTGATGAGCAGG + Intronic
969300249 4:6293220-6293242 CACAGGGGTTTGTGATGAGCCGG + Intronic
971193316 4:24448035-24448057 CACGGTTCTTTGTGAGGAGCTGG - Intergenic
974286717 4:59878157-59878179 TAAGGTACTTTGTGATGAGCGGG - Intergenic
979393259 4:120153407-120153429 CAAGGAGCTTTTAGTTAAGCAGG + Intergenic
983373004 4:166887550-166887572 CAAGTAGCTTTTTGATTATCTGG + Intronic
984621721 4:181960917-181960939 CACAGAGCTGTGTGATCAGCCGG - Intergenic
985339950 4:188939985-188940007 CAATGAGTGTTCTGATGAGCTGG - Intergenic
986684220 5:10261399-10261421 CAAGGTGCTTTGGGTTGAACTGG + Intronic
990969948 5:61494388-61494410 CAGGCAGCTCTGGGATGAGCTGG + Exonic
991006331 5:61831975-61831997 CAAGCAGTAGTGTGATGAGCTGG - Intergenic
997256820 5:132435458-132435480 CAAGGTGCTTTGCGAGGAGCAGG - Intronic
999446650 5:151645757-151645779 CAAGGAGCTTGAGGATGAGTTGG + Intergenic
1002565369 5:180110189-180110211 CAGCGAGCTGTGCGATGAGCAGG - Intronic
1007362406 6:41368449-41368471 CAAGGTGCTTTGTTCTGAGTGGG - Intergenic
1008628762 6:53344222-53344244 GAGGGAGCTTTGTGATCAGATGG - Intronic
1012548773 6:100449186-100449208 CACGGAACTTTGTGAACAGCTGG - Intronic
1013627916 6:111955930-111955952 CAAGGAGTTTTGCTGTGAGCAGG + Intergenic
1013849327 6:114494990-114495012 CACAGAGCTTTGTGATTAGAAGG + Intergenic
1014720850 6:124916527-124916549 CAAGGAGCTTTGAGAAGAAAAGG + Intergenic
1016631535 6:146238860-146238882 CAAGGAGTTTTGTGAAAAGTGGG - Intronic
1019588446 7:1816935-1816957 GAGGGAGCTTTGTGGTGGGCCGG - Intronic
1023792763 7:43766599-43766621 GAGGGAGCTGTGTGATGGGCAGG + Intronic
1025233691 7:57219553-57219575 CCAGAAACTTTGTGAGGAGCCGG + Intergenic
1026214573 7:68336921-68336943 CAAGGAACTCTGAGATGAGAAGG - Intergenic
1029463043 7:100707142-100707164 CGTGGAGCTTGTTGATGAGCTGG + Exonic
1033800693 7:144898496-144898518 AAAGGAACTTTGTGATGAGGGGG - Intergenic
1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG + Intergenic
1036821964 8:11948050-11948072 CAAGGAGATTTGGGATGGGGTGG + Intergenic
1038212682 8:25534098-25534120 CAAGAAGCTGTGTTGTGAGCAGG - Intergenic
1038479523 8:27892302-27892324 CAAGGAGATTTGGGATAACCAGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1044930529 8:97247613-97247635 CAAAGATCTTTGGGATGAGGAGG + Intergenic
1045300292 8:100905015-100905037 GAAGGAGATTTGTAAGGAGCTGG - Intergenic
1048426764 8:134330315-134330337 CATGGAGCCCTGTGATGTGCTGG - Intergenic
1049807065 8:144545937-144545959 CAGACAGCTTTGTGGTGAGCAGG - Intronic
1186807883 X:13158395-13158417 AAAGTAGATTTGTGATGGGCTGG - Intergenic
1190258359 X:48782043-48782065 CAAAGAGATTTGTGATGGCCCGG + Intergenic
1192421743 X:71038398-71038420 ACAGGAGCATTGTGATGGGCTGG + Intergenic
1196070769 X:111519010-111519032 GAAGGAGCATTGTGAAGAGCAGG - Intergenic
1196440081 X:115711513-115711535 CAAGGACCTTTTTGAGAAGCTGG - Intergenic
1196493778 X:116299423-116299445 CTGGGAGCTTTCTGATGCGCTGG + Intergenic
1198511715 X:137358606-137358628 CAAGGAGCTTTCTTATGTTCAGG + Intergenic
1199686208 X:150267819-150267841 CAAGTTGCTCTGTGATTAGCAGG - Intergenic
1201310386 Y:12593919-12593941 AAAGGAGCTTTGTGGTCATCAGG + Intergenic