ID: 1152231778

View in Genome Browser
Species Human (GRCh38)
Location 17:79117522-79117544
Sequence GTGTGGGTGTGGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1149
Summary {0: 1, 1: 0, 2: 14, 3: 111, 4: 1023}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152231778_1152231785 -7 Left 1152231778 17:79117522-79117544 CCCGCTTCCCTCCACACCCACAC 0: 1
1: 0
2: 14
3: 111
4: 1023
Right 1152231785 17:79117538-79117560 CCCACACATCCCCCTCTGCCGGG 0: 1
1: 0
2: 6
3: 51
4: 515
1152231778_1152231793 15 Left 1152231778 17:79117522-79117544 CCCGCTTCCCTCCACACCCACAC 0: 1
1: 0
2: 14
3: 111
4: 1023
Right 1152231793 17:79117560-79117582 GCTCCTGTGTTCTCGGCCTCTGG 0: 1
1: 0
2: 2
3: 7
4: 168
1152231778_1152231783 -8 Left 1152231778 17:79117522-79117544 CCCGCTTCCCTCCACACCCACAC 0: 1
1: 0
2: 14
3: 111
4: 1023
Right 1152231783 17:79117537-79117559 ACCCACACATCCCCCTCTGCCGG 0: 1
1: 0
2: 1
3: 31
4: 232
1152231778_1152231794 16 Left 1152231778 17:79117522-79117544 CCCGCTTCCCTCCACACCCACAC 0: 1
1: 0
2: 14
3: 111
4: 1023
Right 1152231794 17:79117561-79117583 CTCCTGTGTTCTCGGCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1152231778_1152231791 8 Left 1152231778 17:79117522-79117544 CCCGCTTCCCTCCACACCCACAC 0: 1
1: 0
2: 14
3: 111
4: 1023
Right 1152231791 17:79117553-79117575 CTGCCGGGCTCCTGTGTTCTCGG 0: 1
1: 0
2: 1
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152231778 Original CRISPR GTGTGGGTGTGGAGGGAAGC GGG (reversed) Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900720839 1:4174798-4174820 GTGTGGGTGTGTGGAGAGGCTGG + Intergenic
900891840 1:5455059-5455081 GTGTGAGGGTGGATGGGAGCTGG - Intergenic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901625447 1:10622117-10622139 GTGAGGGTGTGGAGGGGTGGAGG - Intronic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
901930959 1:12595857-12595879 GAGGGGGTGAGGAGGGGAGCCGG + Intronic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902676622 1:18013185-18013207 GAGTGGGGGAGGAGGAAAGCTGG - Intergenic
902721691 1:18308434-18308456 GTGTGTGTGTGGAGGGGCTCTGG - Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902783930 1:18721082-18721104 GAGGGAGTGTGGAGAGAAGCTGG - Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903216721 1:21847520-21847542 GAGAGGGAGTGGAGGGACGCTGG + Intronic
903226630 1:21897445-21897467 GTAGGGGTGGGGAGGGAAGGGGG - Intronic
903231064 1:21922633-21922655 GTGGAGGTGTGGGGGGAAGGAGG + Intronic
903253256 1:22072475-22072497 TTGTGGGTGGGGAGGGATTCAGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903672919 1:25047020-25047042 GTGTGGGTCTGCAGAGCAGCTGG - Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904001714 1:27342506-27342528 GTCTGAGTGTGGATGGAGGCCGG - Intronic
904115734 1:28160556-28160578 GTGTGTGTGTGGGGGGTGGCGGG - Intronic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904602917 1:31683629-31683651 GTTTGGGAGTGGATGGAAGTAGG + Intronic
904605650 1:31696317-31696339 GGGTGGGTGGGGGGGGAAGGAGG - Intronic
904676352 1:32201334-32201356 GGGTGGAAGTGGAGGGATGCCGG + Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905737171 1:40337561-40337583 GTGGGGTTGGGGAGGGAAACCGG - Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906083174 1:43107575-43107597 GTGTGGGGGTGGTGGGGGGCGGG + Intergenic
906208016 1:43997311-43997333 GGGTGGGAGTGGAGGGTTGCTGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906534231 1:46543003-46543025 GTGGGGGTGGGGAGGGGGGCAGG - Intergenic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
907038200 1:51235423-51235445 GGTTGGGAGTGGAGGGAAGTGGG + Intergenic
907273758 1:53305734-53305756 GGGTGGAGGTGCAGGGAAGCTGG - Intronic
907663475 1:56414553-56414575 GTGTGTGTGTGGTGGGGGGCAGG - Intergenic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908678770 1:66635383-66635405 GTCTATGTGTGGAGGGAAACTGG - Intronic
908775042 1:67631700-67631722 CTGGGCGTGTAGAGGGAAGCTGG + Intergenic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
910158102 1:84243261-84243283 GTGGGGGTGGGGAGGGAACCAGG + Intergenic
910340999 1:86187309-86187331 GTGTGTGTGTGTAAGGGAGCTGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
911037460 1:93565995-93566017 GTGTCTGTGTGGAGGAAGGCTGG - Intronic
911137692 1:94458954-94458976 GTGGAGGAGGGGAGGGAAGCGGG - Intronic
911885243 1:103289466-103289488 GTGGGGTTGTGGTGGGAATCTGG - Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912227824 1:107755384-107755406 ATGTGGGGGTGAGGGGAAGCTGG + Intronic
912458735 1:109817406-109817428 GCCTGGGTGTGGGGTGAAGCTGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
913098847 1:115544865-115544887 GTGTATGTGTGGTGGGAGGCAGG + Intergenic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
913486563 1:119337092-119337114 GCTTGGGTGGGGAGGGAAGCTGG - Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
914986681 1:152463821-152463843 GTGTGTGTGTGTAGGAAAGGGGG - Intergenic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915069678 1:153255803-153255825 GTGAGGGTGGTCAGGGAAGCAGG + Intergenic
915117917 1:153612097-153612119 GTGTGTGTGTTGGGGGAGGCGGG - Intronic
915164301 1:153940126-153940148 GCCTGGGTGGGGAGGGAGGCTGG - Intronic
915479143 1:156173297-156173319 GTGAGTGGGTGGAGGGGAGCTGG + Intronic
915488091 1:156235993-156236015 GAGTGTGTGTGGAGGAAAGGAGG + Intronic
915586006 1:156844364-156844386 GTGAGGATGGGGAGGGATGCGGG + Intronic
915920441 1:159972211-159972233 GTGTGGGTGAGGGGCGAGGCGGG - Intergenic
915950736 1:160188417-160188439 ATGTGAGTGAGGTGGGAAGCAGG + Intergenic
915953667 1:160206189-160206211 GTGGGGGTGTGGTGGGCGGCCGG - Intronic
915974722 1:160377651-160377673 GTGTTGGTGAGGAAGGCAGCCGG + Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916744163 1:167671475-167671497 GAGTGAGTGTGGAGGAGAGCAGG - Intronic
917712362 1:177698506-177698528 GTTGTGGTGTGGGGGGAAGCGGG + Intergenic
917838725 1:178960709-178960731 GTGTGTGTGTGCAGTGCAGCAGG - Intergenic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918497581 1:185157235-185157257 GTGTGTGTGTGTTGGGAGGCGGG + Exonic
918673931 1:187258099-187258121 GTGGGGGTTTGGAGGGGAGGTGG - Intergenic
918991081 1:191697436-191697458 GTGTGAGAGTGGAGGAAAACTGG + Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919403984 1:197152793-197152815 GTGTGTGTGTGGAGGGGTGGGGG + Intergenic
919567717 1:199209589-199209611 GTGTGGGTGGGAGGGGGAGCAGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919801835 1:201359046-201359068 GAGTGGGTGTGGGGGCAGGCAGG + Exonic
920165358 1:204031796-204031818 GAGAGGGTGAGGAGGAAAGCTGG + Intergenic
920560394 1:206934480-206934502 GTACTGGTGTGGAGTGAAGCAGG - Exonic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921059924 1:211577689-211577711 GTGCGGGTGTGGACTGCAGCGGG + Intronic
921131567 1:212224320-212224342 GTGTGGCTGGGGAGGTGAGCAGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921358872 1:214312268-214312290 GGATCAGTGTGGAGGGAAGCGGG + Intronic
921584274 1:216929472-216929494 GTGCGTGTGTGGAGGGGAGCTGG + Intronic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
921939841 1:220828116-220828138 GTATGGGGGTGGGGGGCAGCTGG - Intergenic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922818890 1:228470588-228470610 GGATGGGTGGGGAGGGGAGCTGG + Intergenic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923374497 1:233347048-233347070 GTGTGTGTGTGTAGAGGAGCGGG + Intronic
923409783 1:233695554-233695576 GTGTGTGTATGGAGGTAGGCTGG - Intergenic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924885388 1:248210133-248210155 GTGTGGATGCTGAGTGAAGCTGG - Intergenic
1062974388 10:1672661-1672683 GTGCGTGCGTGGAGGGAGGCAGG - Intronic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063083400 10:2790110-2790132 GTGTGGTTTTGGAGGGATGGTGG - Intergenic
1063119457 10:3094540-3094562 GTGTTGGTGGGGAGGTGAGCAGG + Intronic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063594180 10:7418619-7418641 GTGTGTGTGTGAAGCGAAGGAGG + Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1063970345 10:11377290-11377312 GTGTGGGGGAGGATGGAAACCGG + Intergenic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1065667764 10:28081288-28081310 GTGTGGGTGAGGGAGGGAGCAGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066093510 10:32050181-32050203 GTGGGGATGTGGAGGGTAGTAGG - Intronic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1067056606 10:43056275-43056297 TTGCGGATGTGAAGGGAAGCTGG - Intergenic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1067979977 10:51074113-51074135 GTGTGCGGGTGGAGCGAGGCGGG - Intronic
1068620667 10:59177346-59177368 GTGTGTGTGTTGGGGGAAGGGGG - Intronic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1069959765 10:72072821-72072843 ATGAGGGTGTGGAGGGACACAGG + Intronic
1069994991 10:72336503-72336525 GAGTGAGTGTGGGGGGAAGGCGG - Exonic
1070957160 10:80471747-80471769 GTGGGGGTGGGGTGGGTAGCAGG + Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1072187866 10:93059944-93059966 GGGTGTGTGTGGAGGGGTGCAGG - Intergenic
1072636989 10:97184880-97184902 GGCTGGGTGTGGAGGGAGGCGGG + Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073957084 10:108884882-108884904 GTGTGTGTGTGTAAGGAGGCAGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074299990 10:112225201-112225223 GTGTGTGTGGTGAGGGAATCTGG - Intergenic
1074370555 10:112897759-112897781 GGGTGGGAGTGGATGGATGCTGG + Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074585310 10:114762618-114762640 GTAAGGGTGAGGAGGGAAGGTGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075618060 10:123905780-123905802 GTGAGGGTGGGGTGGGAGGCAGG - Intronic
1075845540 10:125542390-125542412 GTGAGGGAGAAGAGGGAAGCTGG - Intergenic
1076579422 10:131496708-131496730 GTGTTGGTGTGGGGGGCATCAGG - Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076709479 10:132324056-132324078 GTGTGGGTGTGTTGGGAGGTGGG - Intronic
1076835957 10:133021017-133021039 GTGTGTGTTTGGGGAGAAGCTGG + Intergenic
1077108420 11:851696-851718 GTGTGGGTGTGGTCTGGAGCTGG + Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077239214 11:1501934-1501956 GGCTGGGTGTGGAGGGGTGCAGG - Intergenic
1077305574 11:1867334-1867356 GTGTGGGTGTGGTGGGTGGGTGG - Intronic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077364988 11:2158061-2158083 GTGTTGGAGTGGAGGGCAGCAGG - Intronic
1077916557 11:6615413-6615435 GTGTTTGTGTGGATGGATGCAGG - Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079885308 11:25981071-25981093 GGGTGGAGGTGGGGGGAAGCAGG + Intergenic
1080949752 11:37018009-37018031 GTTTGGGGGTGGGGGGAGGCGGG - Intergenic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081577219 11:44326784-44326806 GCGTGTGTGTGGAGGGAGGGAGG + Intergenic
1081657726 11:44868448-44868470 GTATGGGTGTGGAGGGCACCTGG + Intronic
1081962811 11:47150785-47150807 GTGGGGGAGTCGAGGGAGGCAGG + Intronic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083493432 11:63030077-63030099 GTGTGGATATGGGAGGAAGCAGG + Intergenic
1083857728 11:65401369-65401391 GGGAGGCTGGGGAGGGAAGCAGG - Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084073421 11:66753205-66753227 GTGTGTGTATGCAGGCAAGCAGG + Intronic
1084144353 11:67256201-67256223 GCGTGTGTGTGGAGGGAGGGAGG + Exonic
1084265229 11:68002175-68002197 GTGTGTGTGTGTATGCAAGCGGG - Intronic
1084598163 11:70129508-70129530 GTGTGTGTGTGCATGGGAGCAGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085477630 11:76797988-76798010 GTTGGGGTGTTGGGGGAAGCTGG + Exonic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1085658394 11:78338906-78338928 GTGGGGGTGTACAGGGAATCAGG - Intronic
1085716985 11:78881246-78881268 GAGTGAGTGTGGAAGGCAGCGGG - Intronic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087651043 11:100867894-100867916 GTGTCGGGGAAGAGGGAAGCTGG + Intronic
1088190719 11:107225528-107225550 GTGTGTGTGTGTATGGAAGGAGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1089132194 11:116221529-116221551 GAGTGGGTGGGGGGGGAACCAGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089209699 11:116791764-116791786 GTGGGGGTGTGGGTGGAGGCTGG - Intronic
1089374669 11:117986100-117986122 GTGTGCATGTGCTGGGAAGCAGG - Intergenic
1089399574 11:118156678-118156700 GGGTGTGTGTGGGGGGAGGCGGG - Intergenic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089883551 11:121797630-121797652 GGTTAGGTGAGGAGGGAAGCAGG + Intergenic
1089916911 11:122165758-122165780 GTATGTGTGTGCAGGGAAGTGGG - Intergenic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090793363 11:130111976-130111998 GTCTGGGTGGGGAGTGAAGCTGG - Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091072316 11:132579409-132579431 GTGTGTGTGATGAGGGAGGCTGG + Intronic
1091174761 11:133547961-133547983 GCATGGGTGTGCAGGGATGCAGG - Intergenic
1091226182 11:133957493-133957515 GTCTGGGTGCGGAGGGAGACGGG - Intergenic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1091404055 12:197987-198009 GTGTAGGTGTGGATGGATGCGGG - Exonic
1091406570 12:213202-213224 ATGTGGGTGTGGACTGAAGCAGG - Intronic
1091408041 12:221122-221144 ATGTTGGTGATGAGGGAAGCTGG - Intronic
1091409112 12:227652-227674 TTGTAGGTGTGGATGGATGCAGG - Exonic
1091722089 12:2820898-2820920 GTGTGGGGGTGCATGGAAGCAGG + Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092105905 12:5921605-5921627 GTGTGTGTGTGCATGGATGCTGG - Intronic
1092163241 12:6327659-6327681 GGGTTGGGGAGGAGGGAAGCTGG - Exonic
1092247496 12:6871791-6871813 GTGTGGCTGAGGAAGGAAGTAGG + Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1092913749 12:13171375-13171397 GTGTGGGAATGGCAGGAAGCGGG + Intergenic
1092942594 12:13424168-13424190 GTGTGTGTGTGCAGGTAAGTAGG - Intergenic
1093549352 12:20389228-20389250 GTGTGTGTGAGGAGGAAAGGGGG + Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096284101 12:50283354-50283376 AAGAGGGTGTGGAGAGAAGCCGG + Intronic
1096359140 12:50968391-50968413 GTGTGTGTGTGGGGGGAGACAGG + Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096626887 12:52901364-52901386 GTGAGGGTGGAGAGGGCAGCTGG - Intronic
1096848623 12:54421231-54421253 GTGGGGGTGGGGAGGGGTGCAGG + Intergenic
1096889196 12:54749595-54749617 GGGTGGGTGTGGGTGGAATCTGG + Intergenic
1096988406 12:55777995-55778017 GTGTGGGTGTGGGGGAAACTGGG + Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097211291 12:57372407-57372429 GCGGGGGTGTGGGGGGAATCAGG + Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098012674 12:66071353-66071375 GTGTGGGGGTGGTGGGCCGCAGG - Intergenic
1098429936 12:70408108-70408130 GTGGGGGTGTAGATAGAAGCGGG + Intronic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100245197 12:92750728-92750750 GGCTGGGAGTGGAGGGGAGCAGG - Intronic
1100738294 12:97562456-97562478 GTGGGGGTTGGGAGGGTAGCTGG + Intergenic
1101033039 12:100678530-100678552 GTGTGGGTGTGGGTGGGAGTGGG - Intergenic
1101119182 12:101561638-101561660 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1101252667 12:102951051-102951073 TTGTGCGTGGGGGGGGAAGCAGG + Intronic
1101488712 12:105192453-105192475 GGGCGGGTGGGGAGGGAGGCAGG - Intronic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1102122173 12:110450172-110450194 GTGTGTGTGCCGAGAGAAGCGGG - Intronic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102722051 12:115024990-115025012 GTGTGTGTGTGTAGGGAATTTGG + Intergenic
1102867924 12:116388952-116388974 GTGTGTGTGTGGCGGGAGGGTGG - Intergenic
1103074166 12:117968954-117968976 ATGTCGGTGTGGAGCGAGGCAGG - Intronic
1103565877 12:121814958-121814980 GGGTGGCTGTGGAGGGGGGCAGG + Intronic
1103727254 12:123004299-123004321 GTGTGGGTGTGGACTGATGCGGG - Intronic
1103856803 12:123976328-123976350 GTGTTAGTGTGGAGGAAAGTGGG + Intronic
1103909479 12:124344470-124344492 GTTTGGATGTGGTGGAAAGCGGG + Intronic
1104294494 12:127499642-127499664 GTGAGGGCGTGGTGAGAAGCTGG + Intergenic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104843216 12:131834428-131834450 GGGTGGGCGTGGAGGGGGGCAGG + Intronic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105607315 13:21936898-21936920 GTGTGTGTGTGTAGAGAAGGTGG + Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1109399691 13:61809168-61809190 GTGTGCTTGAGTAGGGAAGCTGG + Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1111860114 13:93693491-93693513 GTGTGTGTGTGTAGGGAGACAGG + Intronic
1112030816 13:95454649-95454671 GTGTGAGTGTGGAAGGATGAAGG + Intronic
1112630027 13:101150242-101150264 GGGTGGGGGTGGCGGGGAGCGGG + Intronic
1112920694 13:104608583-104608605 TTGTGGGTGATGGGGGAAGCAGG - Intergenic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113343468 13:109448994-109449016 GTGTGCGTGTGGAGCGAGGGAGG - Intergenic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113473679 13:110564486-110564508 GTGTGTGTGTGGCGGGGGGCAGG - Intergenic
1113489773 13:110682116-110682138 GGGGCGGTGTGGAGGGTAGCAGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113932270 13:113974680-113974702 GTGTGGGTGGGGAGAGGCGCTGG - Intergenic
1113959548 13:114119055-114119077 GGGTGGGTCAGGAGGAAAGCGGG - Intronic
1113967940 13:114165149-114165171 GTGAGGGTGAGCTGGGAAGCTGG - Intergenic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114658464 14:24330112-24330134 GGGTGGATGTGGGGGGCAGCAGG - Intronic
1115398441 14:32934340-32934362 GTGTGTGTGTAGAGGGGGGCGGG + Intergenic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115730538 14:36264404-36264426 GTGGGAGTGGGGATGGAAGCAGG + Intergenic
1115888728 14:38003717-38003739 GTGTGTGTGTGGTGGGGGGCGGG + Intronic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117340862 14:54790009-54790031 GTGTGTGTGTGGAGCAAGGCTGG - Exonic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117607163 14:57441428-57441450 CTGTGGGTGGGGAGGTAATCAGG + Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1117742528 14:58833671-58833693 GACAGGGTGGGGAGGGAAGCAGG + Intergenic
1118167863 14:63355859-63355881 GTGTGTGTGTGCAGGGAACAGGG - Intergenic
1118330859 14:64815020-64815042 GTGTGTGTGTGCATGTAAGCAGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1119064591 14:71512644-71512666 TTTTGTGTGTGGGGGGAAGCCGG + Intronic
1119474220 14:74917917-74917939 GTGGGGGTGCTGTGGGAAGCGGG + Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119646809 14:76354221-76354243 GTGTGGGTGGGGGGGGGGGCGGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122371908 14:101233643-101233665 GTGTGGGTGAGGGCGGAAGGTGG - Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122649235 14:103216579-103216601 GGGTGGGTGTGGGAGGAGGCGGG + Intergenic
1122690099 14:103528219-103528241 GAGTGTGTGTGCAGGGGAGCGGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123627908 15:22239914-22239936 GGGAGGGTGGGGAGGGAGGCTGG + Intergenic
1124018005 15:25894449-25894471 GGGTTGGTGGGGAGGGCAGCAGG - Intergenic
1125079712 15:35657986-35658008 GGGTGGGTGGAGAGGGATGCAGG - Intergenic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127478242 15:59354848-59354870 GGGTAGCTGTGGAGGGAAGCTGG - Intronic
1127559085 15:60118100-60118122 GTGTGGGTGGGGAGGTAGGTGGG + Intergenic
1127998404 15:64169132-64169154 GTGTGTGTGTGTGTGGAAGCAGG + Exonic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128342530 15:66832357-66832379 GTGTGTGTGTGGTGAGAGGCAGG + Intergenic
1128406932 15:67351235-67351257 GTTGGGGGGTGGGGGGAAGCAGG - Intronic
1128746333 15:70116967-70116989 GTATGGGGGAGGGGGGAAGCAGG + Intergenic
1128814907 15:70601334-70601356 GTGTGGGGGTGGAGGTTATCTGG + Intergenic
1129152444 15:73697359-73697381 GTGTAGGAGTGGAGGGTGGCGGG + Intronic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1129933520 15:79431511-79431533 GTGTGGGGGGGGAGAGAAACAGG + Intergenic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130764743 15:86858486-86858508 GTGTGTGTGTGTAAGGGAGCAGG + Intronic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1131534152 15:93220495-93220517 GTGTGGGTGTGGTGGGGGACAGG - Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132191122 15:99861788-99861810 GTGGCGGTGTGGAGGGAGGTGGG - Intergenic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133357628 16:5148246-5148268 GTGTGGGGGTGCAGGGGTGCAGG - Intergenic
1133421437 16:5650343-5650365 GTGGTGGTGTGGAGGGAGGGAGG + Intergenic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134025482 16:10949777-10949799 GTGTTGGTGGGGCGGGGAGCAGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134661994 16:15991275-15991297 GTGTGTGTGTGGTGGGGTGCGGG + Intronic
1135274853 16:21103345-21103367 GTGTGTGTGTGGGGGGGGGCAGG + Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136632164 16:31495333-31495355 CTGTGGGTGTGGCAGGAAACTGG + Intronic
1136674995 16:31895006-31895028 GTCTGGCTGTGAAGGGGAGCCGG + Intronic
1137463993 16:48691435-48691457 GGGTGGTGGTGGGGGGAAGCAGG + Intergenic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1137731328 16:50692946-50692968 GTGTGTGAGTGTTGGGAAGCAGG + Intergenic
1138550958 16:57748247-57748269 GAGGGGGTGTGGAGGGGGGCCGG - Intronic
1139515538 16:67450419-67450441 GTGTGTGTGTGGAGTGTTGCAGG - Intronic
1139647867 16:68344923-68344945 GTGTGTGTGTGTAGAGATGCAGG - Intronic
1140608553 16:76570536-76570558 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
1140866597 16:79067618-79067640 GTGTGGGTGGGGTGGGGGGCGGG + Intronic
1141591610 16:85073051-85073073 GGCTGGGTGGGGAGGGAGGCAGG - Intronic
1141619218 16:85227980-85228002 GAGGGGGTGTGGTGGGGAGCAGG + Intergenic
1141995833 16:87635897-87635919 GAGAGGGTCTGGAAGGAAGCAGG + Intronic
1142365838 16:89649214-89649236 GTGGGGAGGTTGAGGGAAGCTGG - Intronic
1142396363 16:89833925-89833947 GTGTGGGTGTGGGTGTGAGCTGG + Intronic
1142721596 17:1779778-1779800 GTGTGTCTCTGGAGGTAAGCAGG + Exonic
1142809523 17:2388756-2388778 GACTGAGTGTGGAGGGGAGCTGG - Intronic
1143381403 17:6498516-6498538 GAGTGGGTGAGATGGGAAGCAGG + Intronic
1143406984 17:6684205-6684227 GTTTGGTTGGGGAGGGAAGTAGG - Intergenic
1143964258 17:10745351-10745373 GTGTATGTGTGGACAGAAGCAGG - Intergenic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1144713348 17:17417598-17417620 GTGTGGGTCTAGAGGGTACCTGG + Intergenic
1144833298 17:18143624-18143646 GTGTGGGTCTGGGTGGCAGCAGG + Intronic
1145251923 17:21301463-21301485 GTGTGGGTGAGCAGGGAGGCCGG + Intronic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1146538951 17:33678424-33678446 GTGTGTGTGTGGATTGAACCAGG - Intronic
1146679111 17:34794386-34794408 TTGCGGGTGTGGAGGAAATCGGG - Intergenic
1146710998 17:35041282-35041304 GTGTGTGTGTTGAGGGGAGGAGG - Intronic
1147042247 17:37727888-37727910 GAGTGGGTGTGGAGGGATTCGGG + Intronic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147927280 17:43953684-43953706 GTGGGGGTGGGGAGGCAGGCAGG - Intronic
1147980810 17:44272851-44272873 GTCTGGGGGTGGATGGAAGTGGG + Intergenic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148201799 17:45754135-45754157 GTGTGGGGGTGGTAGGAGGCTGG - Intergenic
1148217377 17:45840413-45840435 GTGGGGGTGGGGAGGGTGGCGGG + Intergenic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1150464651 17:65381823-65381845 GTTGGGTTGTGGAAGGAAGCTGG + Intergenic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151015761 17:70551006-70551028 GTGTGTGTGTGTATGGAAGCTGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG + Intergenic
1151658094 17:75504920-75504942 GGGTGGGTGCGGAGGGGAGGCGG + Exonic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151830473 17:76546322-76546344 GTGGGGGTGTGGTGGGAGCCAGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152073336 17:78144844-78144866 GCCTGGGTGTGTTGGGAAGCTGG - Intergenic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152310680 17:79547985-79548007 GATAGGGTGAGGAGGGAAGCTGG - Intergenic
1152336118 17:79701055-79701077 GTGGGGGAGAGGAGGGATGCAGG + Intergenic
1152532125 17:80924789-80924811 GTGTGCTTGTGGAGTGAGGCTGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1152721485 17:81926018-81926040 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1152851647 17:82639968-82639990 GTGTGGGTCGGGAGGGTGGCTGG + Intronic
1152889743 17:82873714-82873736 GTCTGGGTGTGGAGGGCTGGGGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153376982 18:4391854-4391876 GTGTAGATGTGGAGGGAATGAGG - Intronic
1153946042 18:10018327-10018349 GTGTGATTGTGAAGGGATGCTGG + Intergenic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1155063903 18:22252764-22252786 GTGTGGGTTTGATAGGAAGCAGG - Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1156524420 18:37753185-37753207 GTGTGTGTGTTGGGGGAGGCGGG + Intergenic
1156524925 18:37758001-37758023 GTGTGGCAGTGTAGGGAGGCAGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157234699 18:45953519-45953541 GTTTGGCAGTGAAGGGAAGCTGG - Intronic
1157304366 18:46506380-46506402 GTGTGGGTTCAGAAGGAAGCAGG + Intronic
1157469358 18:47976701-47976723 GTGTGTGTGTGGAGGGGCGGGGG + Intergenic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157632443 18:49112128-49112150 GTGGGGGTGCGGAGGGGAGGGGG - Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158319646 18:56248881-56248903 GGGTGGGGGTGGAGGGGGGCAGG + Intergenic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1159001002 18:62975079-62975101 GTGTGGTTGATGAGGGTAGCAGG + Intronic
1159039000 18:63305464-63305486 GTGTGTGTGGGGAGGAAAGTAGG + Intronic
1159556374 18:69949568-69949590 GTGTGTGTGTGAAGGGACACAGG - Intronic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1159817811 18:73098704-73098726 GAGCAGTTGTGGAGGGAAGCTGG - Intergenic
1159937192 18:74378614-74378636 GTCTGCATGTGGAGAGAAGCTGG - Intergenic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160211116 18:76880746-76880768 GTGTGGGAGAGGAGGGGGGCAGG + Intronic
1160425714 18:78777886-78777908 GTGTGGATGTGGAGGAAGACAGG - Intergenic
1160668418 19:344480-344502 GTGGGGGAGGGGAGGGACGCGGG - Intronic
1160939323 19:1612886-1612908 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1160939354 19:1613084-1613106 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1162439870 19:10686365-10686387 GGGTGGGTGAGGTGGGAGGCTGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163919242 19:20273337-20273359 GTGTGGATGTGGGGGTAAACAGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165175756 19:33928623-33928645 GTGTAGTTGTGGAGGTATGCAGG + Intergenic
1165329216 19:35132037-35132059 ATGAAGCTGTGGAGGGAAGCTGG + Exonic
1165374624 19:35432953-35432975 GTCTGGATGTGGATGGAGGCAGG + Intergenic
1165435212 19:35791542-35791564 GTGGGGGTGTGGAAGGCACCAGG - Intergenic
1165480175 19:36058676-36058698 GTGTGGGTGTTGAATGTAGCAGG + Intronic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1165591558 19:36973534-36973556 GAGTGGGTGTGGTGTGAGGCTGG + Intronic
1165808767 19:38597604-38597626 GTGTGTATGTAGGGGGAAGCAGG + Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1165959826 19:39524671-39524693 GTCTGGGAGGGGAAGGAAGCTGG + Intergenic
1166646118 19:44533038-44533060 GAGGTGGTGGGGAGGGAAGCTGG - Intergenic
1166748654 19:45154108-45154130 GCGAGGGTGTGGAGGGCACCGGG + Intronic
1166885856 19:45960689-45960711 GCGAGGGTGGGGAGGGAGGCAGG - Intronic
1166988469 19:46676651-46676673 CTGTGGGTGTTGACGGGAGCAGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167267917 19:48492795-48492817 GTGTGGGTCTGGAAGGAAAGAGG - Intronic
1167487206 19:49769605-49769627 GGGCGGGTGTGGAGGGGAGTGGG + Intronic
1167620995 19:50560617-50560639 GTGTTGGTGTTGAGGAAAACTGG + Intronic
1168103852 19:54155173-54155195 GTGTGTGCGTGCAGGGCAGCTGG + Exonic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168679947 19:58307623-58307645 GTGTGTGTGTTGGGGGGAGCGGG - Intronic
925005691 2:441463-441485 GTCAGGGTGGTGAGGGAAGCAGG - Intergenic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925398237 2:3552543-3552565 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925398248 2:3552568-3552590 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925907094 2:8546053-8546075 GCGTTGATGTGGAGGGAAGGGGG + Intergenic
926732970 2:16051087-16051109 GGGTGGGGGCGGAGGGAGGCAGG - Intergenic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927291833 2:21412357-21412379 GTGTGTGTGTGGAGGGGGGGTGG - Intergenic
927921833 2:26978424-26978446 GGGTGGGGGTGGAGGGTGGCTGG - Intronic
928078112 2:28283673-28283695 AGGTAGGTGTGGAGGGAACCAGG + Intronic
928100955 2:28437106-28437128 GGGTGGGGGTGGGGGGAGGCGGG + Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
930576086 2:53150517-53150539 GTGTGGGTGGGGAGAGAGGGAGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932156547 2:69423199-69423221 GTGTGTGTGTGGGGGGGGGCGGG + Intronic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932410165 2:71542764-71542786 GTGTCTGTGTGGAGAGAAGTGGG - Intronic
932414598 2:71566001-71566023 GTGTGTGTGTGTTGGGCAGCAGG + Intronic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932459585 2:71873610-71873632 GTATGGATGTGGTGAGAAGCTGG + Intergenic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932621303 2:73266145-73266167 GTGTGGGTGTGGGGAGGGGCTGG - Intronic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933426260 2:82115692-82115714 GAGAGGGTGTGGTGGGCAGCAGG - Intergenic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
934494382 2:94784520-94784542 GGGTGGGTGTGGACGGAAAAAGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935354061 2:102181776-102181798 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
935998343 2:108798798-108798820 GTGTAGGTGTGGAGAGGAGGAGG - Intronic
936573105 2:113632784-113632806 GTGTGGCTGTGGAGTGAAAGGGG + Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937051260 2:118893024-118893046 GTGAGTGTGTGGAGGGGACCTGG + Intergenic
937277474 2:120694676-120694698 GTGTGGGCGTGGGGGGATGCTGG - Intergenic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
938090359 2:128427327-128427349 GTGTGTGTGTGAAGGGTAGGAGG + Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938639965 2:133267276-133267298 GTGGGGGCGTGAAGGGAACCAGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
940122469 2:150282083-150282105 GTGTGGGCGTGGAGTGGATCAGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
941917985 2:170824368-170824390 GTGTGTGTGTGTAGGCAGGCAGG - Intronic
942241073 2:173964575-173964597 GTGGGGGTGGGGAGGAAGGCGGG + Intronic
942546308 2:177067643-177067665 GGGTGGGGGTGGAGGGATGGGGG + Intergenic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943212458 2:184985603-184985625 GTGTGTGTGTGGGGGGGTGCGGG + Intergenic
943720939 2:191202970-191202992 GTTTGGGGGTGGAGAGCAGCTGG + Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944517732 2:200529132-200529154 GTTTTGCTGTGAAGGGAAGCAGG + Intronic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946410616 2:219513531-219513553 GTGGGGGCGTGGAAGGGAGCAGG - Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
946976614 2:225160039-225160061 GTGTGTGTGTGGAGGGGTGGGGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947360405 2:229340272-229340294 GTGTGTGTCTGGTGGGAGGCTGG - Intergenic
947530526 2:230906191-230906213 GTGTGGGTGTGAGGAGAGGCTGG - Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
947805772 2:232966849-232966871 GTGAGGGTGGGGGGGGAGGCGGG + Intronic
948004539 2:234596425-234596447 GTGTGCGTGTGGCAGGAAGTAGG + Intergenic
948145233 2:235703571-235703593 GCGGGGGAGGGGAGGGAAGCGGG - Intronic
948264226 2:236625586-236625608 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948609825 2:239159694-239159716 GTGTGAGTGTGGAGTGTGGCCGG - Intronic
948654338 2:239467125-239467147 GTCAGGGCGTGGGGGGAAGCTGG + Intergenic
948733158 2:239979966-239979988 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948733172 2:239980008-239980030 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
948920712 2:241064728-241064750 GCGTGGGTGTGGAGGGGCGGGGG - Intronic
949033731 2:241807368-241807390 GCGTGAGGGGGGAGGGAAGCTGG - Intergenic
949071992 2:242030960-242030982 GTGTGGGTGTGGGGCCAGGCTGG - Intergenic
1168869023 20:1113347-1113369 GGGTGGCTGAGAAGGGAAGCAGG - Intronic
1168937737 20:1681420-1681442 GTGTGTGTGTGGTGGGGGGCAGG + Intergenic
1170394906 20:15915674-15915696 GTGTGGGGGTGTAGGGAGGCAGG + Intronic
1170525084 20:17228481-17228503 GTGTGGGTGCAGAGAGAAGGTGG + Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171993996 20:31718295-31718317 GTGTGCGTGTGGGGAGAAGGTGG - Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173095858 20:40027570-40027592 GTGTGTGTGTGTAGGGAGACTGG + Intergenic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1173766139 20:45611278-45611300 GAGTGGGGGTGGTGGGAGGCGGG + Intronic
1174106200 20:48164101-48164123 GTGTGCTTGTGTAGGGGAGCTGG - Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174414824 20:50359794-50359816 GAGTGGGTGAGGCTGGAAGCAGG + Intergenic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174736769 20:52972468-52972490 GTGTGTGTGTGCGAGGAAGCGGG + Exonic
1174753439 20:53135280-53135302 GTGTGACTGGAGAGGGAAGCAGG - Intronic
1175175765 20:57110986-57111008 GTGTGGGGGAGCAGGGAAGTGGG - Intergenic
1175374572 20:58515360-58515382 GTTTGGGTGTGGTGGGGAGCGGG - Intergenic
1175506810 20:59491962-59491984 GTGTAGTTGGGGAGGGAAACAGG - Intergenic
1175749223 20:61483688-61483710 GTGTGTGTGTTGGGGGCAGCGGG - Intronic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176030830 20:63010416-63010438 GGGTGGGGGAGGAGGGGAGCCGG - Intergenic
1176837846 21:13810292-13810314 GTGTGTGTGTGAAGGGATGTTGG + Intergenic
1177011806 21:15739457-15739479 GTGTGGTGGTGGAGGGGTGCTGG + Intronic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1177638387 21:23815448-23815470 GACTGGCTGAGGAGGGAAGCTGG - Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179505875 21:41839893-41839915 GGGTGGGTGTGGACGGTGGCAGG - Intronic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179659630 21:42865960-42865982 GTGTGGGTGTGGATGGTGCCTGG - Intronic
1180641606 22:17303744-17303766 GTGGAGGTGATGAGGGAAGCTGG + Intergenic
1180692862 22:17731985-17732007 GTGGGGCTGTGGAGTGAAGTAGG + Intergenic
1180840173 22:18955406-18955428 GTGTGGGTCTGGCAGGGAGCCGG - Intergenic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1181061720 22:20285008-20285030 GTGTGGGTCTGGCAGGGAGCCGG + Intergenic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181106122 22:20576711-20576733 GTGTGGCTGTGGTGGAAAGGAGG + Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181282609 22:21730634-21730656 GGATGTGTGTGGATGGAAGCTGG - Intronic
1181492302 22:23268229-23268251 GGGTGCGTGGGGAGGGGAGCAGG + Intronic
1181572096 22:23773150-23773172 CTGGGGGTGTGAAGGGGAGCCGG + Intronic
1181731432 22:24849753-24849775 GAATGGGTGGGGAGGGAACCCGG + Intronic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182378654 22:29868376-29868398 GTGGGGGTGGGGAGGTGAGCAGG + Intergenic
1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG + Intronic
1182692867 22:32176017-32176039 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1183031288 22:35108360-35108382 GTGTCAGTGTGGGGGGAATCTGG - Intergenic
1183338789 22:37266760-37266782 GTGTGGCTTTAGCGGGAAGCAGG - Intergenic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
1183642689 22:39101701-39101723 GTGGGGGGGTGGCGGGGAGCGGG + Intronic
1183781807 22:40003594-40003616 GTGTGGGGGTGGGGGCAGGCAGG - Intronic
1184240972 22:43211107-43211129 TGGTGGGTGTGGAGGGGTGCAGG + Intronic
1184261046 22:43316575-43316597 GTGGGGCTGTGGAGGTGAGCAGG - Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184292885 22:43507545-43507567 GTGTGCGGGTGGAGAAAAGCAGG + Exonic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184567815 22:45303181-45303203 GTGTGGCTGTGCAGGGGTGCAGG - Intergenic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185015872 22:48342232-48342254 GTGAGGATGAGGAGGGAAGGAGG + Intergenic
1185025528 22:48408196-48408218 GTGGGGGTGTAGAGAGAAGCAGG - Intergenic
1185119345 22:48956643-48956665 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185119353 22:48956743-48956765 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185427080 22:50778090-50778112 GTGTGGCTGTGGAGTGAAAGGGG - Intronic
949096094 3:87577-87599 TTGTGTGTGTGGGGGGACGCGGG + Intergenic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
952075654 3:29694145-29694167 GTTTGTGTGTTGAGGGAAGGGGG + Intronic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
953411972 3:42695749-42695771 GTGTGGATGCAGAGGAAAGCAGG - Intronic
953448216 3:42985577-42985599 GTGTGTGTGTGGGCGGAGGCAGG + Intronic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954060476 3:48062101-48062123 GTGTCTGTGTGGAGAGAAGTGGG + Intronic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG + Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954954518 3:54507705-54507727 GTCTGGGAATGGAGGGAGGCTGG + Intronic
955131329 3:56171933-56171955 GTGTGGAGGTGGATGGAAGGGGG + Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956159669 3:66335891-66335913 GTGGTGGTGGGGAGGGAAGGAGG + Intronic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956262672 3:67362178-67362200 GAGTGGGTGTGGAGAGCAACAGG - Intronic
956305420 3:67819125-67819147 GTGTGGGGTGGGCGGGAAGCAGG + Intergenic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957355701 3:79082856-79082878 TTGATGGTGTGGAGGGAGGCAGG + Intronic
957980246 3:87500180-87500202 GTGTGGGTGGAGGTGGAAGCTGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
960786027 3:121373515-121373537 GGGTGGATGTGGAGGGATGTTGG - Intronic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961416927 3:126765957-126765979 GCGTGGTTTTGGATGGAAGCAGG + Intronic
961431592 3:126887885-126887907 GAGTGGGTGTGGATTTAAGCTGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
961666757 3:128497600-128497622 GTGCGAGTGTGGAAGGAAGAGGG + Intergenic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962490637 3:135890756-135890778 GGGTGGGTGTGGATGGTAGTGGG - Intergenic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
962755088 3:138460478-138460500 GTGGGGGTTCGGAGGAAAGCAGG - Intronic
962914763 3:139890682-139890704 GTGTGAGAGAGGAAGGAAGCAGG - Intergenic
964824257 3:160808329-160808351 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
964824267 3:160808419-160808441 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
965381052 3:167988625-167988647 GTGTGTGTGTGGTGGGATGTGGG - Intergenic
966206574 3:177412599-177412621 GTGTCTGTGTGGAGAGAAGTGGG - Intergenic
966339369 3:178908219-178908241 GCTTAGGAGTGGAGGGAAGCTGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967095896 3:186176915-186176937 GTTTGGGCGTGGAGGCAGGCAGG + Intronic
967124826 3:186414009-186414031 GTGTGTGTGTTGAGGGGGGCCGG + Intergenic
967889190 3:194352960-194352982 GTGGGTGTGTGGAGGCGAGCAGG + Intergenic
968006783 3:195248467-195248489 GTGTTGTTGTTCAGGGAAGCGGG - Intronic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968545048 4:1194172-1194194 GGCTGGGGGTGGAGGGAGGCCGG - Intronic
968929548 4:3571447-3571469 GTGGGGGTGAGGGAGGAAGCTGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969442787 4:7227240-7227262 GTGGGGGTGTGGAGCCAGGCTGG - Intronic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970257200 4:14180796-14180818 GTGAGGGTGTTGAGGGATTCTGG + Intergenic
970517741 4:16850205-16850227 GTGTCCATGTGGAGGGAAACTGG - Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970986260 4:22162415-22162437 GTATGGGAGTGAATGGAAGCTGG - Intergenic
971195007 4:24464819-24464841 GTGGAGGGGAGGAGGGAAGCGGG - Intergenic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971846214 4:31922154-31922176 GTGTGTTTGTGGTGGGGAGCAGG - Intergenic
972137670 4:35912223-35912245 GTGTGGCAGTGTTGGGAAGCAGG + Intergenic
972197159 4:36667704-36667726 GTGGGGTTGTGGCGGGGAGCGGG - Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972446355 4:39148044-39148066 GTGTGTGTGTGGAGGGGGGGCGG - Intergenic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973068339 4:45825066-45825088 GTGTTGGGGTGGAGGGAGGGGGG + Intergenic
973561723 4:52143859-52143881 GTGTGGGTGAGAAGGGGAGGTGG - Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975101841 4:70522538-70522560 GGGATGGTGTGGAGGGAAGGGGG - Intronic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976455834 4:85246193-85246215 GCGTGGGTGTGCAGGAACGCCGG + Intergenic
976806068 4:89048457-89048479 GTGGGGGTGGGGAGGGATGGTGG + Intronic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
977758991 4:100708081-100708103 GTGAAAGTGTGGAGGGAAGGAGG + Intronic
978244628 4:106558234-106558256 GTTGTGGGGTGGAGGGAAGCGGG - Intergenic
978459139 4:108930626-108930648 GTGTGGGAGAGAAGGGAAGCAGG + Intronic
978937166 4:114391800-114391822 GTGTTTGTGTTGGGGGAAGCAGG - Intergenic
978980396 4:114937879-114937901 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979298021 4:119054671-119054693 GTGTGGGTGGGGTGGGCCGCAGG + Intronic
980106259 4:128591458-128591480 GTTTGGGTGTGGGGAGGAGCCGG + Intergenic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
980754158 4:137135870-137135892 GAATGAGTGTGGAGGGAAGGGGG - Intergenic
981566326 4:146105312-146105334 GGGTGGGTGTGGATGGAGACAGG - Intergenic
981929873 4:150177889-150177911 GGGTTGGTGGGGAAGGAAGCAGG + Intronic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984446592 4:179844617-179844639 GATGGAGTGTGGAGGGAAGCAGG - Intergenic
984533885 4:180948427-180948449 GTGGGGGATTGGAAGGAAGCAGG - Intergenic
984888865 4:184473960-184473982 GTGTGGGGGTGCAGGTCAGCTGG - Intronic
984933625 4:184870313-184870335 GTGGGGGTGTGTAGGAAAGCAGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985010442 4:185577147-185577169 GTGTGTGTGTGGAAGGATGTCGG + Intergenic
985484482 5:140796-140818 GTGGGGGTTTGTAGGGAAGGGGG - Intronic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985508103 5:296295-296317 GTGTGGGTGTGGGGCCAGGCTGG - Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985739933 5:1609374-1609396 GTGTGGGTGTGGGGCCAGGCTGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986028222 5:3871025-3871047 GGGTGAGGGTGGTGGGAAGCTGG + Intergenic
986207747 5:5641521-5641543 GTGAGGGTGTGTAGGAAAGCAGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987242541 5:16015561-16015583 GTGCTGGGGTGGAGGGAGGCTGG - Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988499427 5:31772018-31772040 GTGGGGGTGGGGAGAGGAGCAGG + Intronic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
989104149 5:37845271-37845293 GTGTGTGTGTGTATGGAAGGGGG + Intergenic
990386578 5:55269835-55269857 GTTTGGGTGGGGAGGGAATAAGG + Intronic
990555053 5:56924694-56924716 GTTTGGGTGTGGAGCCAAGGTGG - Intronic
990638924 5:57760988-57761010 GTTTTGCTGTGGAGGGAAGCAGG + Intergenic
991240875 5:64458705-64458727 GTGTGGCTATGGTGGGATGCTGG - Intergenic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
991493792 5:67208545-67208567 GAAGGGGTCTGGAGGGAAGCAGG + Intergenic
992632966 5:78699723-78699745 GTGTGGGTGTGGCAGGGAGCAGG - Intronic
992718426 5:79534447-79534469 GTGTGGCTGGGGAGTGATGCAGG - Intergenic
992775064 5:80082173-80082195 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993484208 5:88462520-88462542 ATGTGGTAGAGGAGGGAAGCAGG + Intergenic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
994727793 5:103456715-103456737 GTTAGGGTGTGGATGGAAGGAGG - Intergenic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995544672 5:113218098-113218120 GTGGGGGTGAGGTGGGAAACTGG + Intronic
995658898 5:114458937-114458959 GTGCGGGTGCTGAGGGAGGCAGG + Intronic
996228736 5:121034281-121034303 GTGAGGGTGGGGAAGCAAGCAGG + Intergenic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996336090 5:122385701-122385723 GTGTGTGTGTGTAGGGGTGCAGG + Intronic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996513201 5:124340786-124340808 ATGTGGGTTTGGAGGTAATCAGG - Intergenic
996621298 5:125506935-125506957 GTCTGGGGGTGGAGGGAAAGGGG - Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997782832 5:136677127-136677149 GTGTGAGTGTAGAGGAAAGCAGG - Intergenic
997783281 5:136681766-136681788 GTGTGAGTGTGGAAGAAGGCGGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998366677 5:141636914-141636936 GCCTGGGTGTGGATGGAGGCGGG - Intergenic
998461387 5:142312839-142312861 GTGTGGCTGTGCACAGAAGCAGG + Exonic
999037889 5:148373953-148373975 ATGTGGGCGTGGGGAGAAGCAGG - Intergenic
999191091 5:149747962-149747984 GAGTGGGTGAGGAGCCAAGCAGG + Intronic
999192403 5:149758057-149758079 GTGTGGGTTTGGAGGTGGGCAGG - Intronic
999229538 5:150053517-150053539 GTGAGGCTGTGGAGTGAAGGCGG + Exonic
999268799 5:150284471-150284493 GTGTGCTTGTGGAGGGAGGTGGG + Intronic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000260168 5:159580605-159580627 GTGTGGCTGTGGAGTGTGGCAGG - Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001701371 5:173708945-173708967 GAGTGGGTGAGGATGGAGGCCGG - Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001773537 5:174312520-174312542 GAGTGGGTGTGCGGGGAAACCGG - Intergenic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002100983 5:176857481-176857503 GTGCGTGTGTGTAGGGAGGCTGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002406989 5:179042453-179042475 GGGAGGGTGAGGAGGGAAGTAGG + Intergenic
1002426912 5:179181978-179182000 GGGTGTGTGCGGTGGGAAGCTGG - Intronic
1002451448 5:179321352-179321374 GCAAGGGAGTGGAGGGAAGCTGG - Intronic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002591285 5:180292652-180292674 GTGTGGGTGAGGCCAGAAGCCGG + Intergenic
1002807122 6:587963-587985 GTGAGGGAGGGGAGAGAAGCAGG + Intronic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1003112589 6:3261978-3262000 ATGTGGGAGTTTAGGGAAGCTGG - Intronic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1003909080 6:10727173-10727195 GTGTTGGAGAGGAGGGAAACAGG - Intronic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005042917 6:21615484-21615506 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1005379417 6:25218242-25218264 GGGTGGGGGTGGTGGGGAGCAGG - Intergenic
1005988948 6:30891561-30891583 GTGTGTGTGTGTAGGGGGGCTGG + Intronic
1006112939 6:31759759-31759781 GAGTGGGTGAGGAAGGGAGCTGG - Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006782790 6:36643464-36643486 GGGACGGTGTGGAGAGAAGCAGG - Intergenic
1006917361 6:37603145-37603167 GTGTGTGTGTGGAGGGGGGGCGG + Intergenic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1009469180 6:64010404-64010426 GTGGTGGTGTGGAGAGAAGGGGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010468740 6:76200048-76200070 GTGGGTGTGTTGAGGGAAACAGG + Intergenic
1011009908 6:82692128-82692150 GTGTGTATGTGGAGGGGAGGAGG - Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1013429589 6:110043742-110043764 GTGTGGGGGAGAAGGGGAGCTGG - Intergenic
1013609969 6:111785481-111785503 GTTTGTGTGTGTTGGGAAGCGGG - Intronic
1013820229 6:114145744-114145766 GTGGGGGTGCTGTGGGAAGCAGG + Intronic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1014120398 6:117718915-117718937 GTGTGTGTGTGAAGGGATGGGGG + Intergenic
1014461385 6:121699837-121699859 GTGTGTGTGTGGTGGGAATCAGG + Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015267740 6:131305989-131306011 GTGTGTGTGTGTAGGAGAGCTGG - Intergenic
1015367239 6:132409882-132409904 GTGTGTGTGTGGAGAGAGACAGG - Intergenic
1015891760 6:137976789-137976811 GTCTGTGTGTGTAGGGAGGCAGG - Intergenic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017113382 6:150953365-150953387 GTGTGGGGGTGGAGGCAGCCGGG - Intronic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017798528 6:157870159-157870181 GTGTGGGTGTGCATGAGAGCAGG - Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019067602 6:169315441-169315463 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019067609 6:169315480-169315502 GTGTGTGTGTGGACAGAGGCAGG - Intergenic
1019067638 6:169315757-169315779 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019067645 6:169315798-169315820 GTGTGTGTGTGGACAGAGGCAGG - Intergenic
1019135844 6:169907198-169907220 GTGTGTGTGTGCAGGTACGCAGG - Intergenic
1019381694 7:727409-727431 GTGCGGGCGTGGAGGGGGGCGGG - Intronic
1019594811 7:1853629-1853651 GTGTGGGTGTGCAGGGCGGCGGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1019913096 7:4113444-4113466 GTGGGGGTGAGAAGGGAGGCTGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1020789184 7:12604728-12604750 GTGTGTGTGTGTAAGGCAGCAGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021691766 7:23237100-23237122 GTGTGTGTGTGTTGGGCAGCAGG - Intronic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022545118 7:31180047-31180069 GTGTGAGTGAGAAGGAAAGCTGG + Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1023063207 7:36349514-36349536 GTGGGTGTGTGGAGGCAAGGAGG - Intronic
1023256755 7:38320002-38320024 GTGTTGGTGAGGAGTGAAGGTGG + Intergenic
1023259268 7:38341808-38341830 GTGTGTGTGTGGCGGGGGGCGGG + Intergenic
1023538456 7:41238931-41238953 ATGTGGCTGTGCAGGGAAACAGG - Intergenic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1024213730 7:47228814-47228836 GTTTGGAGGTGGAGGGAGGCGGG - Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1024712262 7:52029430-52029452 GTGTGGGTGTGGATGGATGGTGG - Intergenic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025034501 7:55585234-55585256 GTGTGTGTGTGTATGGAGGCTGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1027329181 7:77073498-77073520 GTGGGAGTGGGGAGGGAGGCAGG - Intergenic
1027342748 7:77226382-77226404 GTGGGTGTGTGCAGGGAACCTGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027659712 7:80974843-80974865 GTGTGAGTGAGCAGTGAAGCTGG - Intergenic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1029529719 7:101117321-101117343 GTGTAGGAGAGGAGGGGAGCAGG - Intergenic
1029580603 7:101434614-101434636 GTGTTGGTGAGGAGAGAAGGCGG + Intronic
1029786583 7:102797872-102797894 GTGGGAGTGGGGAGGGAGGCAGG + Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1031133585 7:117861540-117861562 GTCTGGGTGTGCAGGCAGGCTGG - Intronic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032084369 7:128876311-128876333 GTGTGGCTGTGAAGGCAGGCAGG + Intronic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033181331 7:139182088-139182110 GTGTGTGTGTGGAGGGGCGGGGG + Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033573432 7:142656682-142656704 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034405423 7:150899555-150899577 GGGGCTGTGTGGAGGGAAGCAGG - Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034460783 7:151196852-151196874 GTGTGGGTGTGTAGGCAAAGGGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034659838 7:152759671-152759693 GTGGGGGTGTTGGGGGAGGCGGG + Intergenic
1034749241 7:153553541-153553563 GTGTGTGTGTGGAGGTAGGGCGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034994837 7:155571037-155571059 GTGGGGGTGGGGAGGGAGGTGGG - Intergenic
1035075512 7:156174921-156174943 GGGTGGGTGTGGAGAGAGTCAGG + Intergenic
1035259736 7:157653795-157653817 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035259779 7:157653947-157653969 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035259803 7:157654023-157654045 GGGTGGGTGTGGGGAGAGGCGGG - Intronic
1035301090 7:157897573-157897595 GTGTGGGAGAGGAGAGCAGCCGG - Intronic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035404904 7:158590330-158590352 GTGTGGGGGTGTCGGGAGGCTGG + Intergenic
1035436508 7:158863776-158863798 GTGTGGGGGCGGGGGGGAGCGGG + Intronic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036999021 8:13695458-13695480 GGGTGGATGTGGAGGGATGCTGG + Intergenic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037118425 8:15253941-15253963 GTGTGTGTGTGAAGGGATGGGGG - Intergenic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1037998425 8:23369829-23369851 GTGTGGCTCTGAAGGGAATCAGG + Intronic
1038127539 8:24691342-24691364 GTGTGGGGGTGGAGGGTCGGGGG - Intergenic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1038426646 8:27468276-27468298 GTGTATGTGTGCAGGGAGGCAGG - Intronic
1038818746 8:30932717-30932739 GTGTGTCTGTGGATGGAATCAGG + Intergenic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039153767 8:34532375-34532397 ATGAGGGTGTGGCTGGAAGCAGG + Intergenic
1039435001 8:37553877-37553899 GTGTGTGTGTTGCGGGAGGCGGG - Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1040017090 8:42708525-42708547 GTGTGTGTTTGGAGGGAGGTGGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040102283 8:43516396-43516418 GTGGGAGTGTGGAGGGTAGTAGG + Intergenic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1041106204 8:54446401-54446423 GTGTGGGTGTGGCTGACAGCAGG + Intergenic
1041671843 8:60499713-60499735 GTGTGGATGTGGGGGTAAACAGG - Intergenic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1042483901 8:69331259-69331281 GTGTGGGTGTGGGGTCAGGCTGG - Intergenic
1044646492 8:94449189-94449211 GTGTGTGTGTGGTGGGGGGCGGG - Intronic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045321703 8:101086638-101086660 GTGTTGATGTGGGAGGAAGCTGG + Intergenic
1045420399 8:102008907-102008929 GTGTGTGTGTGTAGGGGGGCGGG - Intronic
1047300748 8:123611886-123611908 GTGTGCATGTGTAGGGAAGTAGG + Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048739194 8:137535792-137535814 ATGTGGGTGTGAAGGCAAACAGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1048997202 8:139801412-139801434 GCGTGGGTGTGGCAGGAATCTGG + Intronic
1049205387 8:141361215-141361237 GTGTGGGTGGGGAGCAGAGCTGG - Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049454102 8:142678305-142678327 GTGTGTGTCTGGAGGGAGACCGG - Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049509574 8:143020734-143020756 GAGTGGGTCAGGAGAGAAGCAGG + Intronic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1050348403 9:4716246-4716268 TTGTGGGTGAGGTGGGGAGCTGG - Intronic
1050820917 9:9878869-9878891 GTTTGATTGTGGAGGGAAGGAGG - Intronic
1051092905 9:13431154-13431176 GTGTGTGTGTGGTGTGTAGCGGG + Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052769090 9:32671107-32671129 GTATGGGTGAGAAGGGTAGCAGG + Intergenic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1052886038 9:33649076-33649098 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1053089346 9:35259777-35259799 GTGTGTGTGTAGGGGGATGCGGG + Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053662744 9:40295848-40295870 GGGTGGGTGTGGATGGAAAAAGG + Intronic
1053913190 9:42926023-42926045 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054374874 9:64442072-64442094 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054460730 9:65461019-65461041 GTGGGGGTGAGGGAGGAAGCTGG - Intergenic
1054521869 9:66080436-66080458 GGGTGGGTGTGGATGGAAAAAGG - Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1054888491 9:70225402-70225424 GTGTGGGTGCTGGGGGATGCTGG + Intronic
1055008282 9:71534483-71534505 GTGTGTGTGTGGAGGGGTGGTGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056884170 9:90424111-90424133 GTGTGAGTGTGCAGTGAAGGGGG - Intergenic
1056898024 9:90569247-90569269 GTGTTTGTGTGGAGGAAAACCGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057271075 9:93651817-93651839 TTGAGGGTGTGGTGGGAGGCAGG + Intronic
1057596183 9:96417882-96417904 GTGCGGCGGTGGAGGGGAGCCGG - Exonic
1057705510 9:97392368-97392390 GGGTGGATGTGGAAGGAGGCGGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1057869888 9:98709280-98709302 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058179459 9:101779139-101779161 GTGTGGGTGGGGGAGGAAGCTGG - Intergenic
1058634128 9:107019891-107019913 GTATGTGTGTGGAGGGATGTTGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1058944199 9:109841616-109841638 GTGGGGGGGTGGAGGGAAAGAGG + Intronic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1059453721 9:114386951-114386973 GTGTGGGTGGGGGTAGAAGCAGG - Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1060426825 9:123513209-123513231 GTGTGGGTGTGGGGTGAACAAGG - Intronic
1060508894 9:124218068-124218090 TTGTGGGAGTGGCGGGTAGCAGG - Intergenic
1060512296 9:124242910-124242932 GTGTGGGAGGGGTGGGAGGCAGG - Intergenic
1061186724 9:129059295-129059317 GGGTGGGCGTGGAGGGTGGCAGG + Intronic
1061431758 9:130535706-130535728 GTGGGGGTGGGGAATGAAGCTGG + Intergenic
1061681023 9:132242458-132242480 GTGTAAGTGTGGTGGGAGGCAGG - Exonic
1061724984 9:132577345-132577367 GAGTGAGTGGGGAGGGAAACAGG + Intergenic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1061895605 9:133645649-133645671 GTAGGGGTGTCGAGGGAAGAAGG + Intronic
1061937486 9:133866159-133866181 GGGTGGGTGGGGAGCCAAGCTGG + Intronic
1062286967 9:135777695-135777717 GAGTGGGTGTGGGGAGGAGCTGG - Intronic
1062391670 9:136336358-136336380 CTGGGGGTGTGGAGGGATTCGGG - Intronic
1062459097 9:136655427-136655449 GTGCTGGTGTGGAGAGATGCAGG + Intergenic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186394045 X:9189888-9189910 GTGTCTGTGTGGGAGGAAGCAGG + Intergenic
1186398184 X:9231799-9231821 GTGAGGATGTGAAGGGCAGCCGG + Intergenic
1186656713 X:11619915-11619937 GTGAGGGAGAGGAGGGCAGCAGG - Intronic
1186705798 X:12138420-12138442 GTGGGGGTGGGGAGAGGAGCAGG + Intergenic
1187887943 X:23907208-23907230 GGCTGGGTGACGAGGGAAGCTGG - Intronic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188170465 X:26918187-26918209 GTGTGTGTGTGGAGGGGGGTGGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189184198 X:39038113-39038135 GTTTGGAGGTGGATGGAAGCAGG - Intergenic
1189349761 X:40267523-40267545 GTGTTGTTTGGGAGGGAAGCTGG + Intergenic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1190322724 X:49188051-49188073 GTGGAGGTGTGGAGGGAGGGAGG + Exonic
1190464808 X:50715697-50715719 GTGAGGCTGTGGAGGAAAGGTGG + Intronic
1191902229 X:66053367-66053389 GTGTGTGTGTGGGGGGGGGCGGG - Intergenic
1192185125 X:68941584-68941606 GCGGGGGTGGGGTGGGAAGCGGG - Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195691303 X:107628253-107628275 GACTGGGGGTGGAGGGATGCTGG - Intergenic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1195935022 X:110116891-110116913 GTGTGTGTGTGAAGGGGGGCAGG + Intronic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196574011 X:117297489-117297511 GTGGGGGTGTTGTGGGAAGTTGG - Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197163508 X:123350156-123350178 GTGTGGGTGTGGGGGATTGCTGG - Intronic
1198342769 X:135731418-135731440 GTGGGGGTGTCGGGGGAAGCGGG - Intergenic
1198345220 X:135751877-135751899 GTGGGGGTGTCGGGGGAAGCGGG + Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198847585 X:140929348-140929370 GTATGTGTGTGGAGGGGAGGAGG + Intergenic
1198948671 X:142043743-142043765 TTGTAGGTGTGCAGTGAAGCAGG + Intergenic
1199668254 X:150119332-150119354 TAGTGGGTGTTGAGGGGAGCTGG + Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1200068654 X:153517412-153517434 GGGTGGGTGGGGATGGAAACTGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic