ID: 1152232991

View in Genome Browser
Species Human (GRCh38)
Location 17:79124290-79124312
Sequence TCACCTTGCTGTGTGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152232991_1152232997 11 Left 1152232991 17:79124290-79124312 CCTTCAATCACACAGCAAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1152232997 17:79124324-79124346 GCCCCGGAGGCCTGAACGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 113
1152232991_1152232994 -2 Left 1152232991 17:79124290-79124312 CCTTCAATCACACAGCAAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1152232994 17:79124311-79124333 GACCACCATGGCTGCCCCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1152232991_1152232993 -5 Left 1152232991 17:79124290-79124312 CCTTCAATCACACAGCAAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1152232993 17:79124308-79124330 GGTGACCACCATGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 27
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152232991 Original CRISPR TCACCTTGCTGTGTGATTGA AGG (reversed) Intronic