ID: 1152233256

View in Genome Browser
Species Human (GRCh38)
Location 17:79125451-79125473
Sequence AGGCCGGGTAGAGAACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152233256_1152233262 2 Left 1152233256 17:79125451-79125473 CCAGTGTGTTCTCTACCCGGCCT 0: 1
1: 0
2: 1
3: 4
4: 104
Right 1152233262 17:79125476-79125498 CCCTTGGCCAATGTGCTCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152233256_1152233266 17 Left 1152233256 17:79125451-79125473 CCAGTGTGTTCTCTACCCGGCCT 0: 1
1: 0
2: 1
3: 4
4: 104
Right 1152233266 17:79125491-79125513 CTCTCCGGTCCTGCCTGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 129
1152233256_1152233265 12 Left 1152233256 17:79125451-79125473 CCAGTGTGTTCTCTACCCGGCCT 0: 1
1: 0
2: 1
3: 4
4: 104
Right 1152233265 17:79125486-79125508 ATGTGCTCTCCGGTCCTGCCTGG 0: 1
1: 0
2: 3
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152233256 Original CRISPR AGGCCGGGTAGAGAACACAC TGG (reversed) Intronic
900467123 1:2831249-2831271 TGGACAGGTAGAGACCACACAGG - Intergenic
901038769 1:6351790-6351812 AGGCCAGGGAGAGAAGACGCGGG + Intronic
902069934 1:13725510-13725532 AGGCTGGGTAAAGAGTACACAGG - Intronic
904005791 1:27362558-27362580 AGGGCAGGGAGAGAGCACACTGG - Intronic
905249784 1:36640542-36640564 AGGCCTGGGAGAGAACATTCTGG - Intergenic
905254667 1:36672591-36672613 AGGCAAGGTAGAGGTCACACAGG - Intergenic
915345047 1:155193098-155193120 AGGCCAGCTGGAGAACAAACGGG - Intergenic
919946122 1:202320122-202320144 AGGGTGGTGAGAGAACACACAGG - Intergenic
921822093 1:219628993-219629015 AAGCTGGGTATAGAATACACAGG + Intergenic
922573328 1:226646428-226646450 AGGCAGGGCAGAGAGCAGACAGG - Intronic
1066652058 10:37665668-37665690 AGGCCAGGTGGAGAAGGCACTGG + Intergenic
1067035832 10:42915908-42915930 AGGCCAGGTGGAGAAGGCACTGG + Intergenic
1068977070 10:63021690-63021712 AGGGCTGGAAGAGAACACAGTGG - Intergenic
1074826953 10:117221538-117221560 AGGTGGGGCAGAGAACACAGGGG - Intergenic
1075049214 10:119170231-119170253 AGGCAGGTTAGAGAAAACTCAGG + Intronic
1075716293 10:124557754-124557776 AAGCAGGGTACAGAGCACACTGG + Intronic
1077299302 11:1839801-1839823 AGGACGGGGAGAGAAGACAGAGG - Intronic
1084478065 11:69400163-69400185 AGGGCCTGTAGAGAACACAGGGG - Intergenic
1085475908 11:76788803-76788825 AGGTGGGGGAAAGAACACACAGG + Intronic
1088966845 11:114731881-114731903 AAACTGGGTAAAGAACACACAGG + Intergenic
1089301672 11:117502647-117502669 AGGCTGGGCAGACCACACACGGG + Intronic
1089553626 11:119301687-119301709 ATGCCATGTAGAGAAGACACTGG - Exonic
1091786395 12:3245589-3245611 AGGCCAGGCAGAGAGGACACGGG - Intronic
1094233226 12:28132615-28132637 AGGCCGGTTACAGAATACCCTGG - Intergenic
1100201497 12:92303592-92303614 AGGCAGGGCAGAGAACACCCTGG - Intergenic
1104754804 12:131262306-131262328 AGGCAGGGCAGAGGCCACACTGG + Intergenic
1108596519 13:51954634-51954656 AGGCATTGTAGAGGACACACTGG + Intronic
1109736716 13:66495673-66495695 GTTCTGGGTAGAGAACACACTGG + Intronic
1110637777 13:77786551-77786573 AGGCAGAGTAGAGAACAATCAGG - Intergenic
1112019509 13:95359444-95359466 AGGAAGGGCAGAGAACACAGTGG + Intergenic
1122104768 14:99444174-99444196 AGGCTGGGTGCAGAACAGACAGG + Intronic
1122369406 14:101220963-101220985 AGGCCGGGCAGAGCACAGAGAGG + Intergenic
1123926921 15:25123689-25123711 AAGCTGGGTACAGAATACACAGG - Intergenic
1124189671 15:27563900-27563922 AGCCAGGGTAGAGTACACAAAGG - Intergenic
1130966994 15:88705226-88705248 AGCCCGGGCAGCGAACACTCAGG - Intergenic
1131516701 15:93083078-93083100 AGGCCTGGTGGAGAACATACTGG - Intronic
1134043266 16:11083886-11083908 ATTCCGGGTAGAACACACACAGG - Intronic
1136550096 16:30978485-30978507 TGGCTGGGGAGGGAACACACTGG - Intronic
1139494087 16:67303334-67303356 AGGCCTGGAAGAGAACATGCAGG + Exonic
1141817663 16:86423972-86423994 AGGCCGCCTAGAGAACGCCCTGG + Intergenic
1142009815 16:87708137-87708159 AGGAGGGGTAGAGAGAACACCGG + Intronic
1143719020 17:8797542-8797564 AGGCCTGGTAGAGCACAGCCAGG + Exonic
1143752276 17:9036992-9037014 AGACCAGCTAGCGAACACACTGG - Intronic
1148465993 17:47865637-47865659 TGGCCTGGAAGAGAACCCACTGG - Intergenic
1152161525 17:78671329-78671351 AGGCCAGGGAAAGAACGCACAGG + Intergenic
1152233256 17:79125451-79125473 AGGCCGGGTAGAGAACACACTGG - Intronic
1158345151 18:56508785-56508807 AGGTCAGGGAGAGAACACTCAGG - Intergenic
1162085747 19:8248111-8248133 GGGCCGGGTAGATAACAGAGTGG - Intronic
1163258962 19:16175182-16175204 AGGCCAGGTAGAGAAAACACAGG - Intergenic
1164478335 19:28592209-28592231 AGGCAGGGTGAAGATCACACAGG - Intergenic
1165811836 19:38616538-38616560 AGGCAGGGCAGAGATCTCACGGG + Intronic
1167467464 19:49657918-49657940 AGGCCGGGGAGAGAACGAGCTGG + Intronic
1168332182 19:55577352-55577374 AGGCTGGGTTGAGAAGAAACAGG - Intergenic
929285906 2:40135131-40135153 AGGCAAGGAAGAGAACAGACTGG + Intronic
929969688 2:46563459-46563481 AGGCCGGGAAGAGCCCCCACGGG + Intronic
938985358 2:136570293-136570315 AGCCCCTGTAGACAACACACAGG - Intergenic
940064437 2:149611306-149611328 AGGCAGGGAAGAGCACAGACTGG + Intergenic
941347684 2:164390135-164390157 AGCCTGAGTAGAGAGCACACAGG - Intergenic
941604497 2:167580556-167580578 AGGCTGGGTAGGGAGGACACAGG - Intergenic
946460681 2:219865806-219865828 AGGCTGTGTAGAGAACAGATTGG - Intergenic
1170783201 20:19445605-19445627 AGGCAGCGTAGAGCACACATGGG + Intronic
1173798168 20:45877227-45877249 ACACCGGGTGGAGAACACCCAGG + Exonic
1174815069 20:53680290-53680312 AGGGTGGGAAGAGAATACACGGG + Intergenic
1178551373 21:33542528-33542550 AGGCTGGTTATAGAACGCACTGG + Intronic
1181324280 22:22032757-22032779 AGGCGGGGGAGAGACCACAGTGG - Intergenic
953728545 3:45423993-45424015 AAGCTGGGTAAAGACCACACAGG - Intronic
954675338 3:52312288-52312310 AGGTTGGGAAGAGAACAGACGGG + Intergenic
961819122 3:129566307-129566329 AGGCCAGGTAGAGCAGACAGAGG - Intronic
963868522 3:150388069-150388091 AGGCAGGGTTGAAAACCCACTGG + Intergenic
975340444 4:73233756-73233778 GGGCTGGGTAGAGAAAACATAGG + Intronic
976055007 4:81053814-81053836 AGAACTGTTAGAGAACACACTGG + Exonic
987243611 5:16026405-16026427 GGGCCTGGAATAGAACACACAGG - Intergenic
990546503 5:56827077-56827099 GGGGTGGGTGGAGAACACACAGG + Intronic
990566487 5:57034758-57034780 AGGCCAGGTAGAGCAGAGACTGG - Intergenic
994048478 5:95335640-95335662 AGGATGGGTGAAGAACACACAGG + Intergenic
995180261 5:109224323-109224345 AGGAGGGGTAGACAACACACGGG + Intergenic
996520494 5:124420702-124420724 AGGCAGGGCAGGGCACACACAGG + Intergenic
998040370 5:138947509-138947531 GGGGTGGGGAGAGAACACACAGG + Intronic
1002063768 5:176642144-176642166 AGGTCAGGCAGAGAACACTCAGG + Exonic
1012974534 6:105765892-105765914 AGGAGGGGAAGAGATCACACAGG + Intergenic
1013487627 6:110612558-110612580 CTGCTGGGTAGAGAACACAGAGG - Exonic
1018494638 6:164337266-164337288 AGCCCGGGAGGAGAAAACACGGG - Intergenic
1019047177 6:169158076-169158098 AGACCGGGCAGAAAACACGCAGG + Intergenic
1019386270 7:757899-757921 AGGCCGGGCTGAGAGCACAGTGG - Intronic
1019641137 7:2104301-2104323 AGGCCCCGGAGAGAAAACACAGG + Intronic
1019720259 7:2565658-2565680 AGGCCGGGAACTGGACACACAGG - Intronic
1022343597 7:29491616-29491638 AGGCCAGGTAGAGACCAGCCTGG - Intronic
1024054501 7:45651287-45651309 CGGCCGTGCAGAGCACACACTGG - Intronic
1027489509 7:78805360-78805382 AGGAAGGGTAGAGAACAAAGAGG - Intronic
1032153749 7:129451722-129451744 GGGCCAGGTAGAGAACAGCCCGG - Exonic
1035563746 8:627918-627940 AGGCCCAGCAGAGAACACAGGGG + Intronic
1039466387 8:37788150-37788172 AGGAGGGGTAGGGAACACCCCGG - Intronic
1041087280 8:54268565-54268587 AGGCTGGCTAGAGAGGACACTGG + Intergenic
1043565964 8:81548099-81548121 AGTCCTGGTTGAGAATACACTGG + Intergenic
1048873272 8:138816189-138816211 AGGCCAGGGACAGAGCACACTGG + Intronic
1049212063 8:141391534-141391556 AGGACGGGTAGGGAGCCCACGGG - Intergenic
1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG + Intergenic
1059454131 9:114388980-114389002 GGCCCTGGTAGAGAACACATGGG + Intronic
1061192190 9:129088326-129088348 AGGCTGGGGACAGATCACACAGG + Intronic
1061263634 9:129493589-129493611 AGGCCAGGTAGGAAACACACTGG + Intergenic
1061595978 9:131629294-131629316 AGGCGGGACAGAGCACACACAGG + Intronic
1062197696 9:135283250-135283272 AGGCTGGGTAGGGAGCACATGGG + Intergenic
1186521648 X:10211781-10211803 CAGCAGGGTAGAGAACACGCTGG + Intronic
1186571803 X:10722999-10723021 AGGCCCAGTAGAAAACTCACTGG - Intronic
1187424370 X:19163888-19163910 AGTCCGGGTAGAGCAAAAACAGG - Intergenic
1192182435 X:68924612-68924634 CGGCAGGGAAGAGAAAACACAGG - Intergenic
1193134481 X:77955028-77955050 AGGCTGGGTAGTAAATACACAGG - Intronic
1196054180 X:111337267-111337289 AGTCAGGGAAGAGAACACAAAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200376735 X:155788869-155788891 ATGCCAGGTAGTGAACATACAGG - Intergenic