ID: 1152233897

View in Genome Browser
Species Human (GRCh38)
Location 17:79128561-79128583
Sequence GCTCCTAACTCCAAGGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152233889_1152233897 14 Left 1152233889 17:79128524-79128546 CCTCCGCCCAGAAACAGGCCACC 0: 1
1: 0
2: 0
3: 17
4: 223
Right 1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 167
1152233895_1152233897 -7 Left 1152233895 17:79128545-79128567 CCTCTACAGCTCACAGGCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 167
1152233891_1152233897 8 Left 1152233891 17:79128530-79128552 CCCAGAAACAGGCCACCTCTACA 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 167
1152233890_1152233897 11 Left 1152233890 17:79128527-79128549 CCGCCCAGAAACAGGCCACCTCT 0: 1
1: 0
2: 1
3: 20
4: 201
Right 1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 167
1152233894_1152233897 -4 Left 1152233894 17:79128542-79128564 CCACCTCTACAGCTCACAGGCTC 0: 1
1: 0
2: 1
3: 19
4: 264
Right 1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 167
1152233892_1152233897 7 Left 1152233892 17:79128531-79128553 CCAGAAACAGGCCACCTCTACAG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152233897 Original CRISPR GCTCCTAACTCCAAGGTCTG TGG Intronic
900623956 1:3599763-3599785 GCTCCTCACTCCAGGGCCTGAGG + Intronic
901670219 1:10851667-10851689 GCTCCTCACCCCAGGGGCTGGGG - Intergenic
902150273 1:14437283-14437305 GCTCTTAACTCCTAAGACTGGGG + Intergenic
906366317 1:45213049-45213071 GCTCAGAACTCTAAGGACTGAGG - Intronic
912390278 1:109297904-109297926 CCTTCTAACTGCAAGCTCTGAGG + Intronic
917675999 1:177320300-177320322 GCTCCTAACTCCAAAGAGTCAGG - Intergenic
917979431 1:180259918-180259940 GCTGGTAACAACAAGGTCTGGGG + Intronic
920094403 1:203476802-203476824 GGTCCTAATTCCCAGCTCTGGGG + Intronic
920365975 1:205448620-205448642 GGTCCTCACTCCAGGGTATGAGG + Intronic
922858229 1:228793336-228793358 GCTCTTGACTCCAAGGCCTTCGG + Intergenic
924817195 1:247452743-247452765 GCTCAAAATTCCATGGTCTGGGG - Intergenic
1064540833 10:16403464-16403486 GCTCCTACCTCAAAAGTCTAAGG + Intergenic
1065965162 10:30764938-30764960 GCTCCTAAGGACAAGGTGTGTGG + Intergenic
1066343138 10:34555951-34555973 TGTCCTACCTCCAAGTTCTGTGG - Intronic
1068856952 10:61807625-61807647 GCTCCTAACGCCCAGGCCTATGG + Intergenic
1069163292 10:65116760-65116782 TCTCCTAACTCCTGGCTCTGAGG + Intergenic
1073665746 10:105531715-105531737 GCTCCCATTTCCAAGTTCTGAGG - Intergenic
1074759722 10:116658148-116658170 GACCCTAACTCTAGGGTCTGGGG - Intergenic
1074971867 10:118545522-118545544 ACTACTAAACCCAAGGTCTGGGG - Intergenic
1076527993 10:131124397-131124419 GCTCCGAAGGGCAAGGTCTGCGG - Intronic
1076812839 10:132898236-132898258 GCTCCTGGCTCACAGGTCTGTGG - Intronic
1077215193 11:1392478-1392500 GCTCCTCCTTCCAAGGTCTCAGG - Intronic
1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG + Exonic
1077747157 11:4919481-4919503 TCTCTTATCTCCAGGGTCTGAGG - Intronic
1081573503 11:44305751-44305773 GCTCTCAGCGCCAAGGTCTGGGG - Intronic
1084326962 11:68406086-68406108 GCTCCTACCTCCAAGGTGAATGG + Intronic
1085454487 11:76657982-76658004 GCTCATGACTCCATGGTATGAGG + Exonic
1085507406 11:77068180-77068202 GCTCCTGTCCCCAGGGTCTGGGG + Intronic
1089120139 11:116128137-116128159 CCTCCTACCTCCAAGGACAGTGG + Intergenic
1090661753 11:128887418-128887440 ACTCCTAACTTCCAGGGCTGTGG - Intergenic
1091980551 12:4860741-4860763 GTGTATAACTCCAAGGTCTGTGG + Intergenic
1094284007 12:28772226-28772248 GTTCCTAACTCAAAGGGCTCTGG + Intergenic
1095762400 12:45854331-45854353 TCTCCTCACTCCCTGGTCTGTGG + Intronic
1102950414 12:117027314-117027336 GCTCTGAACTCCCAGGCCTGCGG + Intronic
1103069221 12:117926936-117926958 GTTCCTACCTCCCAGGACTGTGG + Intronic
1103195711 12:119042154-119042176 TCTCCTGACTCCCAGGTCAGTGG + Intronic
1103405415 12:120671558-120671580 TCTCCACACTCCAAGGTCTGCGG - Intergenic
1105836627 13:24217775-24217797 GCTCCTCCCTCCCAGGTCCGAGG - Intronic
1108704743 13:52974862-52974884 GCTCCAAGCTCCTGGGTCTGTGG - Intergenic
1119639851 14:76306361-76306383 GTTCTTAACCCCTAGGTCTGGGG - Intergenic
1122914625 14:104852611-104852633 GCTCCTGGCTCCATGGTCAGTGG + Intergenic
1123667063 15:22616256-22616278 TCTTCTGACTCCAAGCTCTGAGG + Intergenic
1124320905 15:28710824-28710846 TCTTCTGACTCCAAGCTCTGAGG + Intronic
1124481589 15:30084531-30084553 TCTTCTGACTCCAAGCTCTGAGG - Intronic
1124488046 15:30136627-30136649 TCTTCTGACTCCAAGCTCTGAGG - Intronic
1124522002 15:30412665-30412687 TCTTCTGACTCCAAGCTCTGAGG + Intronic
1124536663 15:30553553-30553575 TCTTCTGACTCCAAGCTCTGAGG - Intronic
1124543135 15:30605604-30605626 TCTTCTGACTCCAAGCTCTGAGG - Intronic
1124563086 15:30793046-30793068 TCTTCTGACTCCAAGCTCTGGGG - Intergenic
1124755481 15:32401694-32401716 TCTTCTGACTCCAAGCTCTGAGG + Intronic
1124761990 15:32454039-32454061 TCTTCTGACTCCAAGCTCTGAGG + Intronic
1124776639 15:32595029-32595051 TCTTCTGACTCCAAGCTCTGAGG - Intronic
1126072301 15:44875691-44875713 GCTCCTAACTCCAAAGAGTTGGG + Intergenic
1126112110 15:45181309-45181331 GCTCCCAACTCCCAGCCCTGTGG - Intronic
1126812015 15:52416424-52416446 GCTTATAACACCAAGGTCTCAGG + Intronic
1127141426 15:55981643-55981665 GCTCCTAAATCCAAGGATTCTGG - Intronic
1129036987 15:72656274-72656296 TCTTCTGACTCCAAGCTCTGGGG - Intronic
1129212899 15:74080951-74080973 TCTTCTGACTCCAAGCTCTGGGG + Intronic
1129397502 15:75260135-75260157 TCTTCTGACTCCAAGCTCTGGGG - Intronic
1129401112 15:75284412-75284434 TCTTCTGACTCCAAGCTCTGGGG - Intronic
1129474712 15:75777120-75777142 TCTTCTGACTCCAAGCTCTGGGG - Intergenic
1129730038 15:77925268-77925290 TCTTCTGACTCCAAGCTCTGGGG + Intergenic
1129745735 15:78019412-78019434 GCTCTTAGCTCCATGGTCTCAGG + Intronic
1129838482 15:78728720-78728742 TCTTCTGACTCCAAGCTCTGGGG - Intergenic
1129921242 15:79320878-79320900 GCTCCTACCTGGAAGCTCTGGGG + Intronic
1130484228 15:84389486-84389508 TCTTCTGACTCCAAGCTCTGGGG - Intergenic
1134219778 16:12344807-12344829 CCTTCTAACTCCCAGGTCTTGGG + Intronic
1136561536 16:31042075-31042097 GCTCTGACCTCCAAGGTCTGGGG + Intronic
1139936117 16:70572425-70572447 GCTCCCCACCCCCAGGTCTGTGG + Exonic
1140969177 16:79996510-79996532 GCTCTTATCTCCAGGCTCTGGGG + Intergenic
1142004883 16:87684966-87684988 GCTCCTAACCCCATTCTCTGGGG - Intronic
1149771962 17:59329683-59329705 TCTCCTGACCCTAAGGTCTGGGG + Intergenic
1150288364 17:63966697-63966719 GCTCCAAGTTCCAAGGTCTCTGG + Intronic
1150463351 17:65371295-65371317 TTTCCTAACTCCTAGGGCTGTGG - Intergenic
1151680233 17:75619227-75619249 GCTCCCAACTCCATGGTCCCTGG - Intergenic
1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG + Intronic
1152290699 17:79438453-79438475 GCTCCCAACTCCCAGGTCCATGG + Intronic
1152588395 17:81199246-81199268 GCCCCTAACTCCGAGGACTGGGG + Intronic
1154160927 18:11980853-11980875 GCTCCTCCCTCCCAGCTCTGCGG + Intergenic
1155497801 18:26459770-26459792 GATCCTTTCTCCGAGGTCTGGGG + Exonic
1156024133 18:32631927-32631949 GCTCCTAATTCTAAGGCCTTTGG - Intergenic
1156301686 18:35841740-35841762 GCTGCTTACCCCAAGGTCTATGG + Intergenic
1156657373 18:39304959-39304981 GCTCCAATATCCAACGTCTGAGG - Intergenic
1157445466 18:47743370-47743392 GGCCCTAAGTCCAAGGACTGGGG + Intergenic
1159701996 18:71640647-71640669 TCTCTTAGCTCCAATGTCTGTGG + Intergenic
1164155932 19:22597064-22597086 TCTTCTGACTCCAAGATCTGGGG - Intergenic
1164872330 19:31656476-31656498 GCTCATGACTCCCAGGCCTGGGG + Intergenic
1166360938 19:42252783-42252805 GCTCCTGGCTCCAAGGCCTGGGG - Intronic
1167234088 19:48303436-48303458 CCTCCTAACTCCTGGGCCTGGGG - Intronic
1167432095 19:49461038-49461060 GGTCTGAACTCCTAGGTCTGAGG + Intronic
1167659102 19:50785615-50785637 GGTCCGGACTCCAGGGTCTGAGG - Intergenic
925743828 2:7028421-7028443 GATACTGACTCCGAGGTCTGAGG - Intronic
925796137 2:7544864-7544886 GCACGTTACTCCAAGGTCAGAGG - Intergenic
926082499 2:9999374-9999396 GCTCCACACTCCAGGGTGTGTGG + Intronic
927722926 2:25398371-25398393 GATCCTAACGCCAAGGGCTGGGG - Intronic
928217168 2:29371420-29371442 GCTCCTCACACCAGGATCTGTGG - Intronic
928400112 2:30971676-30971698 GATGCTAACCCCAGGGTCTGGGG + Intronic
929026063 2:37603631-37603653 TCTCCCAACTCCAAGTTCTGAGG + Intergenic
930538235 2:52670952-52670974 CCTCCTACCTCCAAGTTCTGAGG + Intergenic
930604430 2:53478208-53478230 TCTTCTAACTTCAAGTTCTGTGG - Intergenic
933649477 2:84838757-84838779 CCTCCCAAGTCCAAGGCCTGGGG - Intronic
933815962 2:86069083-86069105 GCACCTACCTCCAAGGACTGTGG + Intronic
934133271 2:88970165-88970187 CCTCCTCACTCCAGGGCCTGAGG + Intergenic
934234291 2:90216425-90216447 CCTCCTCACTCCAGGGCCTGAGG - Intergenic
934815140 2:97319051-97319073 GCTCTTTACTCTTAGGTCTGAGG + Intergenic
934822555 2:97389432-97389454 GCTCTTTACTCTTAGGTCTGAGG - Intergenic
934962145 2:98685787-98685809 GATCCTGATTCCATGGTCTGAGG + Intronic
937249477 2:120514597-120514619 GCTCCTAACACCAAGTCCTCTGG + Intergenic
937961538 2:127463870-127463892 ACTCCTACCTCCTAGGTTTGTGG - Intronic
940823716 2:158386610-158386632 GCTCCAAACTCCATGATCTTTGG + Intronic
941210036 2:162625987-162626009 GCCCCTAAGTCCTAGCTCTGTGG - Intronic
944104400 2:196063716-196063738 GCTGCTAAGTACAATGTCTGTGG - Intronic
947836356 2:233178844-233178866 TCTCCTTGCTCCAAGGACTGGGG - Intronic
948739534 2:240033657-240033679 GCTCCTGGCTTCAGGGTCTGTGG + Intergenic
1169551671 20:6707684-6707706 GGTCCGAACTACAGGGTCTGTGG + Intergenic
1172019969 20:31907122-31907144 GCTCCAGAGTCCAAGCTCTGTGG - Intronic
1172068237 20:32236820-32236842 GCTCCTATTTCCCAGGGCTGGGG - Exonic
1175790475 20:61737339-61737361 TCTCCTCACCCCAAGGTGTGGGG - Intronic
1176996741 21:15563537-15563559 TCTCCTCACTCCCAGATCTGAGG + Intergenic
1181801769 22:25352346-25352368 GCTCCTAACTCCAAGGTGGATGG - Intronic
1183476374 22:38038337-38038359 GCTGCTTGCTCCAAGCTCTGGGG - Intronic
1185379684 22:50502703-50502725 GCTCCACACTCCAAGGTCGGTGG - Intergenic
950497442 3:13342224-13342246 TCTCCTGATTCCCAGGTCTGTGG - Intronic
952035575 3:29196409-29196431 AGTCCTAAATCCAGGGTCTGTGG + Intergenic
956997945 3:74849744-74849766 GCTCCTAACCAAAAGTTCTGGGG + Intergenic
957843901 3:85705615-85705637 GCTCCTAATTATAAGTTCTGTGG + Intronic
960063411 3:113347210-113347232 GCTCCCAACTCCAGAGTCGGGGG - Intronic
963976055 3:151481440-151481462 GGTCCTAAATTCAAGGCCTGAGG + Intergenic
968437723 4:602711-602733 GCACCTGCCTCCAAGGTCTGTGG - Intergenic
970510725 4:16779148-16779170 GCTCCCAAAGCCAAGTTCTGCGG - Intronic
975184885 4:71389785-71389807 GCCACTAATGCCAAGGTCTGAGG + Intronic
978370043 4:108020673-108020695 GGTCCTAATTACAGGGTCTGAGG + Intronic
982653953 4:158122455-158122477 GCTCTTCCCTCCCAGGTCTGTGG - Intergenic
985875633 5:2591816-2591838 GCTCCCAAGTCCAAGGTCTAGGG - Intergenic
989149434 5:38283941-38283963 GCTCCAAACTACAGGGTCTGTGG + Intronic
995870779 5:116741126-116741148 ACTCCTAACTTCAAGGCCTGTGG - Intergenic
998176588 5:139905169-139905191 GCTCCTCTCTGCAAGGCCTGCGG + Intronic
998909767 5:146946387-146946409 GCTCCTCCTTCCAAGTTCTGGGG + Intronic
1002399603 5:178984261-178984283 GCTCCCCACTCCACGGGCTGCGG - Intronic
1002620251 5:180483128-180483150 GATTCTTACTCCAGGGTCTGTGG - Intergenic
1004271924 6:14203285-14203307 TCTCCTGATTCCAGGGTCTGTGG - Intergenic
1008629820 6:53352613-53352635 GGAACTGACTCCAAGGTCTGAGG - Intergenic
1009035926 6:58117060-58117082 TCTCCTTACACCTAGGTCTGAGG - Intergenic
1009211747 6:60870661-60870683 TCTCCTTACACCTAGGTCTGAGG - Intergenic
1010540788 6:77089539-77089561 GATCATAATTCCAAGGTCTGTGG - Intergenic
1014740916 6:125146918-125146940 GCTCCTCCCTCCAGGGTGTGGGG + Intronic
1017101030 6:150850071-150850093 GCTCCCAACTCCAAAGAGTGGGG - Intergenic
1021849889 7:24797037-24797059 ACTCATAACTAAAAGGTCTGCGG + Exonic
1023636216 7:42213568-42213590 GCTCCATTTTCCAAGGTCTGGGG + Intronic
1026326075 7:69311920-69311942 GCTCGTAACTCCAAGAAATGAGG + Intergenic
1028843956 7:95459554-95459576 GCTCCTTCCTCCAGGGTCTGTGG - Intergenic
1029712183 7:102305800-102305822 CCTCCTACCTCCAAGCCCTGAGG - Intronic
1034150063 7:148908356-148908378 CCTCTTATTTCCAAGGTCTGGGG - Intergenic
1034562471 7:151889959-151889981 GCTCCTAACTCCAAGGTGCCAGG - Intergenic
1035106034 7:156442054-156442076 GCTCCCACCTCCAAGAGCTGAGG + Intergenic
1035295423 7:157864545-157864567 GCCACTTTCTCCAAGGTCTGGGG + Intronic
1038911268 8:31967432-31967454 GCTTCTGACTCCACTGTCTGAGG - Intronic
1038968915 8:32609072-32609094 GCTCCTCTCTTCAAAGTCTGGGG + Intronic
1039648555 8:39314824-39314846 GCCCCTTGCTTCAAGGTCTGTGG + Intergenic
1040293181 8:46135903-46135925 GCTCCCTACTCCAAAGCCTGGGG + Intergenic
1040293890 8:46139336-46139358 GCTCCCTGCTCCAAGGTTTGGGG + Intergenic
1042026090 8:64425482-64425504 GCTCCTAGCTTAAGGGTCTGGGG - Intergenic
1045346890 8:101301448-101301470 GTCCCTAACTCCAGGCTCTGGGG + Intergenic
1045362102 8:101442313-101442335 CCTCTGAGCTCCAAGGTCTGGGG - Intergenic
1048990804 8:139759099-139759121 GCTTCTAACTCAGAGGGCTGTGG - Intronic
1049786624 8:144454021-144454043 GCTCCTGCCTCCCAGCTCTGAGG - Intronic
1050463420 9:5896213-5896235 ATTCCTAACTCCGAGGACTGTGG + Intronic
1051903300 9:22065695-22065717 GCTCATTACTCCAAGGGATGTGG - Intergenic
1056092510 9:83218512-83218534 GGTCCTACCCCCACGGTCTGTGG - Intergenic
1056106512 9:83352536-83352558 TCTCCTCACTTCAAGCTCTGAGG + Intronic
1057150334 9:92790998-92791020 GCTACTACCTACCAGGTCTGGGG - Intergenic
1057750251 9:97787145-97787167 CCTCCTAACTCTAATGTTTGAGG + Intergenic
1059852638 9:118361619-118361641 GCTCTTAACTCCAAGGGCCTTGG - Intergenic
1061065285 9:128274176-128274198 TCTTCTGACTCCAAGCTCTGGGG + Intronic
1061952110 9:133942458-133942480 GCTCCCAGCTCCAGTGTCTGGGG - Intronic
1062040175 9:134400898-134400920 GCCCCTAGCTCCATGCTCTGAGG - Intronic
1062167694 9:135116195-135116217 GCTCCTTATCCCAAGGCCTGTGG + Intronic
1062407064 9:136401790-136401812 GCCCCTAACCCCAAGGGCTGAGG + Intergenic
1185489505 X:510323-510345 GCCCCTAGCTCCAGTGTCTGCGG + Intergenic
1186558384 X:10584931-10584953 GCTCATAACTCTAAGGTGGGGGG + Intronic
1187429144 X:19205730-19205752 ACTTCTAAATCCAGGGTCTGGGG + Intergenic
1190863311 X:54363649-54363671 CCTCCTACCCCCTAGGTCTGAGG - Intergenic
1192845590 X:74904040-74904062 ACTCCTCACTCCATGGACTGGGG + Intronic
1196909099 X:120468257-120468279 CCTCCTAACTGAAACGTCTGGGG + Intronic
1201273712 Y:12279934-12279956 GCTCCTTACTGAAAGCTCTGAGG + Intergenic
1202373855 Y:24215805-24215827 TCTTCTGACTCCAAGCTCTGGGG + Intergenic
1202496926 Y:25454315-25454337 TCTTCTGACTCCAAGCTCTGGGG - Intergenic