ID: 1152235350

View in Genome Browser
Species Human (GRCh38)
Location 17:79135594-79135616
Sequence CCCCGATGCCCCCACTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152235350_1152235363 29 Left 1152235350 17:79135594-79135616 CCAGCGCAGTGGGGGCATCGGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1152235363 17:79135646-79135668 ACCCCCATACAGGATCTCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 114
1152235350_1152235358 19 Left 1152235350 17:79135594-79135616 CCAGCGCAGTGGGGGCATCGGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1152235358 17:79135636-79135658 GTCCCATCCCACCCCCATACAGG 0: 1
1: 0
2: 1
3: 19
4: 157
1152235350_1152235355 -7 Left 1152235350 17:79135594-79135616 CCAGCGCAGTGGGGGCATCGGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1152235355 17:79135610-79135632 ATCGGGGGAGGGATTCCCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 122
1152235350_1152235365 30 Left 1152235350 17:79135594-79135616 CCAGCGCAGTGGGGGCATCGGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1152235365 17:79135647-79135669 CCCCCATACAGGATCTCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152235350 Original CRISPR CCCCGATGCCCCCACTGCGC TGG (reversed) Intronic
900096047 1:940505-940527 CCCCGCAGCCCCCACTATGCAGG - Intronic
901506747 1:9689860-9689882 CCCCCAAGCCCCCACGGCCCCGG - Intronic
903860443 1:26361292-26361314 TCCCGCTGCCCCCACTGCCTGGG - Intergenic
903996075 1:27306308-27306330 CCCCGGCACCCCCACTGCTCAGG - Exonic
904329300 1:29747472-29747494 GCCCGATGCCCACACTGCTGTGG - Intergenic
905169132 1:36099250-36099272 CCCCGAAGCCCCGGCTGCCCTGG + Exonic
908023408 1:59922030-59922052 CTGCGATGCCGCCAGTGCGCTGG - Intronic
913240439 1:116825512-116825534 CCCAGCTGCCCCCACCGAGCTGG - Intergenic
922572426 1:226642019-226642041 CCCCGAGGCCCCCACCGAGGAGG - Exonic
1068020769 10:51581031-51581053 CCACGATGCCTCCAATGCACTGG + Intronic
1069783192 10:70969606-70969628 CCCCGCAGCCCCCACTACACTGG - Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1075341043 10:121647134-121647156 CACAGATGCCCCCACTAGGCAGG + Intergenic
1076096253 10:127736885-127736907 CCCCGCAGCCCCGACTGCCCTGG - Intergenic
1076572317 10:131440888-131440910 CCCCGATGCCCACACCTTGCTGG + Intergenic
1076994944 11:293290-293312 CCCCGGTGCCCCCACTAGGCAGG + Intronic
1081981446 11:47269664-47269686 CCCCTCTGCCCCCGCTGCCCAGG + Exonic
1083736529 11:64684832-64684854 CCCAGATGCTCCCACTGGACAGG - Intronic
1083855824 11:65392596-65392618 GCCCCATGCCACCACTGCTCTGG - Intronic
1084843497 11:71878788-71878810 CCCTGTTGCCCCCACCGGGCTGG - Intronic
1092109640 12:5949946-5949968 CCCCAGTGCCCTCACTGGGCTGG + Intronic
1095327910 12:40920298-40920320 CCCCCATGCCCCCACCCCACAGG + Intronic
1104437943 12:128770880-128770902 CCACAATGCACCCACTGCTCTGG + Intergenic
1105517068 13:21100368-21100390 CCTTGATGCCCCCACGGCACAGG + Intergenic
1106761873 13:32875705-32875727 CCCAGATGCCCCCTCTGGGACGG + Intergenic
1107604032 13:42040814-42040836 CCCCGCCGCCGCCGCTGCGCCGG - Intronic
1112116375 13:96359955-96359977 CCCCTATTCCACCACTGAGCAGG + Intronic
1113968760 13:114172102-114172124 CCCCGAGGGCCCCACTGACCCGG + Intergenic
1118736332 14:68704253-68704275 CCCCGCAGCCCCCACTGGGGAGG + Intronic
1119034825 14:71220622-71220644 CCCCACTGCCCCCACTGCCTTGG + Intergenic
1122056018 14:99098899-99098921 CCCCGACTCCCCCACGGCACAGG + Intergenic
1122786147 14:104164143-104164165 TCTCGCTGCCCCCACTGCGGCGG - Intronic
1122985298 14:105209023-105209045 TCCCGGTGCCCACACTGCGCTGG + Intergenic
1123108359 14:105853381-105853403 CCCCGGTGCCAGCACAGCGCAGG + Intergenic
1124270773 15:28278330-28278352 CCATGATGGCCCCACTGCCCTGG + Intronic
1124369300 15:29094372-29094394 CCCCCCAGCCCCCACTGCCCAGG - Intronic
1124848330 15:33311939-33311961 CCCCAATGCCCCCACCCCTCCGG - Intronic
1125728275 15:41879231-41879253 TCCCAATGCCACCACTGCGCTGG + Intronic
1128521103 15:68375472-68375494 CCCCGGGGTCCCCACTGGGCAGG - Intronic
1128841493 15:70854290-70854312 CTCCGAGGCCCCGCCTGCGCGGG - Intronic
1130352909 15:83107461-83107483 CCCCGTCGCCCCAAGTGCGCAGG - Exonic
1132500444 16:282523-282545 CACCGCTGCCCTCACCGCGCAGG - Exonic
1132666384 16:1083039-1083061 CCCACAGGCCCCCACTGCCCCGG - Intergenic
1132942405 16:2514571-2514593 CCTCGAAGGCCCCAGTGCGCGGG + Intronic
1133231954 16:4371106-4371128 CCCCTATGCCTCCACAGCTCAGG + Intronic
1133239443 16:4405594-4405616 CCCTGGTGCCCTCACTGCCCGGG - Intronic
1138278242 16:55751680-55751702 CCCCCTTGCCCCCACTGCTCAGG - Intergenic
1138290437 16:55842265-55842287 CCCCCTTGCCACCACTGCTCAGG + Intergenic
1139356033 16:66367472-66367494 CCCCAAGGCCCCCACAGCCCAGG + Intronic
1141167138 16:81668420-81668442 CCCCAAGCCCCCCACTGGGCTGG + Intronic
1142014235 16:87735458-87735480 CCCCGCTGCCCTAACTGCGCTGG + Intronic
1142243426 16:88957453-88957475 CCACGATGCCCCCTCAGCCCAGG + Intronic
1144958641 17:19032676-19032698 CCCCTGTGCCCCCACTTTGCTGG + Intronic
1144976518 17:19141848-19141870 CCCCTGTGCCCCCACTTTGCTGG - Intronic
1145910076 17:28537286-28537308 CCCCGGAGCCACCACTGCCCGGG - Exonic
1147918053 17:43900391-43900413 CCCAGATGCCCCGACTCTGCTGG + Intronic
1147977901 17:44258509-44258531 CACCGATGCCCCCTCCGAGCAGG - Exonic
1150839132 17:68591725-68591747 CCCCCATCCTCCCAGTGCGCAGG - Intronic
1152235350 17:79135594-79135616 CCCCGATGCCCCCACTGCGCTGG - Intronic
1152321018 17:79608941-79608963 CCCCCACGCCCCCACCCCGCCGG + Intergenic
1154195246 18:12260949-12260971 TCCCCATGCCCCCACAGAGCAGG - Intronic
1160517645 18:79487307-79487329 CCACGATGCCCCGACTGCAGAGG - Intronic
1160817295 19:1042079-1042101 AGCCGATGCCCGCACTGTGCTGG + Exonic
1160868413 19:1266333-1266355 CCCAGCTGGCCCCACTACGCGGG - Intronic
1161494628 19:4580627-4580649 CCCCCAGGCCCCCACTGCAGCGG + Intergenic
1161850895 19:6737515-6737537 AGCCGCTGCCCCCACTCCGCGGG + Exonic
1164437044 19:28239517-28239539 CCCTGAAGCCCCCACAGCACAGG + Intergenic
1164456131 19:28408532-28408554 CCCCGATGCCCCCGATGAGAGGG - Intergenic
1166780613 19:45340756-45340778 CCCCGCCGCTCCCGCTGCGCCGG - Exonic
927488246 2:23503943-23503965 CCCAGATGAACCCACTGGGCTGG + Intronic
927812505 2:26187797-26187819 CCCAGGTGTCCCCACTGCTCTGG - Exonic
934608840 2:95719826-95719848 CCCAGAGGCCCCCACTGTGCTGG - Intergenic
936281285 2:111142082-111142104 CCCTGATGCCCCCACTTTCCAGG - Intronic
938305751 2:130253056-130253078 CTCCGATGCCCCCGCTCCTCGGG - Intergenic
938318967 2:130349881-130349903 CCCCTCTGCCCCCACTGCCCCGG + Intergenic
940037985 2:149330318-149330340 CCCGGGTGCCCCACCTGCGCCGG + Intronic
941159276 2:162017588-162017610 CCCCGCTGCCCCCACTCCCATGG + Intronic
948153627 2:235764662-235764684 CCCAGATGCCCCCACCCCACGGG - Intronic
948153638 2:235764689-235764711 CCCAGATGCCCCCACCCCACGGG - Intronic
948153649 2:235764716-235764738 CCCAGATGCCCCCACCCCACGGG - Intronic
948153660 2:235764743-235764765 CCCAGATGCCCCCACCCCACGGG - Intronic
1171499952 20:25585590-25585612 CCCCTGTTCGCCCACTGCGCCGG - Intergenic
1171524646 20:25799385-25799407 CCCCGAAGCCTCCACCGCCCAGG + Intronic
1171552181 20:26056498-26056520 CCCCGAAGCCTCCACCGCCCAGG - Intergenic
1171793299 20:29547790-29547812 CCCCGAAGCCTCCACCGCCCAGG - Intergenic
1171855155 20:30336589-30336611 CCCCGAAGCCTCCACCGCCCAGG + Intergenic
1172630004 20:36371852-36371874 CACCCATGCCCCCACTTCCCAGG - Intronic
1173330655 20:42073710-42073732 CCCAAGTGCCCCCACTGAGCAGG - Exonic
1173807256 20:45934303-45934325 CCACGATGCCTCCCCTGGGCCGG + Intergenic
1173819250 20:46010104-46010126 CCCCGCTGCCCCCACGGCCCCGG - Intronic
1174734883 20:52956485-52956507 TCCAGATGCCTCCACTGCCCAGG - Intergenic
1175267882 20:57713553-57713575 TCCTGATGCCCCCACTGGCCTGG - Intergenic
1175878449 20:62242676-62242698 CCCCCAGGCCCTCAGTGCGCAGG - Intronic
1178377284 21:32076983-32077005 CCCTGAGGCCCGCACTGTGCGGG + Intergenic
1179449742 21:41460293-41460315 GCCTGATGCCCCCACTGCCTGGG - Intergenic
1180982832 22:19886948-19886970 CCCAGAAGCCCCCACTCAGCTGG - Intronic
1181053086 22:20246823-20246845 CCCCAATGCCGCCCCTGGGCTGG + Intronic
1183617452 22:38954321-38954343 CCCCCATACCCCCACTGGGGTGG - Intronic
1184476974 22:44727235-44727257 CCCCGCTGGCCTCACTGTGCAGG + Intronic
1185272370 22:49935294-49935316 CCCCCAAGCCCGCTCTGCGCAGG - Intergenic
950707777 3:14793638-14793660 CCCCGAGGCCCCGCCTGGGCGGG - Intergenic
954397960 3:50303020-50303042 CTCCGATTCCCCCACTGCTCAGG + Exonic
959439755 3:106360776-106360798 CCGCGATGCCGCCAATGCACTGG + Intergenic
960939046 3:122921872-122921894 TCCCGAGGCCTCCACTGCGGAGG - Intronic
961379122 3:126486020-126486042 CTCCCATGGCCACACTGCGCTGG - Intronic
961563999 3:127750332-127750354 GCCCGAGGCCCCCAGTGAGCCGG - Intronic
966858227 3:184211155-184211177 CCCAGATCCCGCCACTGCACTGG + Intronic
967924790 3:194637669-194637691 CCACGCTGCCCCAACTGCTCAGG - Intergenic
968445515 4:650355-650377 CCCCCCTGTCCCCACTGCCCAGG + Intronic
968754769 4:2409547-2409569 CCCCCTCGCCCCCACTCCGCTGG + Intronic
969365948 4:6694362-6694384 CGCCCCTGCCCCCACTGCACAGG - Intronic
969663698 4:8544994-8545016 CCCTGGTGCCCCCACTGCCGGGG - Intergenic
985671933 5:1211137-1211159 CCCCGCTGGCCCCGCTGTGCTGG - Intronic
986264822 5:6182495-6182517 CCCCGAGGCCCCCACCCCTCTGG + Intergenic
987245168 5:16041531-16041553 CCCCTCTGCCCCCACAGCCCTGG + Intergenic
999318891 5:150601226-150601248 CCCCGAGGCCCCCTCTCCCCTGG - Intronic
999742733 5:154568852-154568874 CCTCGGTGCCCCCATTGGGCAGG - Intergenic
1003155827 6:3593104-3593126 GCCCGTTGCCCCCACTCCCCCGG - Intergenic
1004118706 6:12797586-12797608 CCCCTATGCTCCCACTGTACTGG - Intronic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1013272592 6:108558205-108558227 CCCCGACGCCTCCTCTTCGCTGG + Intergenic
1015181503 6:130366231-130366253 CTCCGGTGCCCCCCCGGCGCGGG + Intronic
1015918097 6:138238690-138238712 CCCCGGGGCCCCCACTGCCAGGG + Intronic
1016538280 6:145133831-145133853 CCACGATGCCGCCAATGCACTGG - Intergenic
1018060904 6:160088949-160088971 TCCCGAGGCCCCCACTCCCCGGG - Intronic
1019437563 7:1029866-1029888 CCCCGCTGCCACCACAGAGCAGG - Intronic
1019552651 7:1610758-1610780 CCCCGCTGCCCCCACCCCCCAGG - Intergenic
1020099779 7:5388479-5388501 CGCGGATGCCCCCACGGTGCGGG - Exonic
1023243790 7:38178637-38178659 CCCCGCTGCTCCCACGGCGTGGG + Intronic
1024654013 7:51434082-51434104 CCCTGATGCCCCCGCTTAGCAGG + Intergenic
1025300842 7:57818794-57818816 CCCCGAAGCCTCCCCTGCCCAGG - Intergenic
1026360448 7:69598083-69598105 CCCCACCGCCCCCAGTGCGCAGG + Intergenic
1029409662 7:100400764-100400786 CCCAGATGCCTGCACTGTGCAGG + Intergenic
1029642428 7:101829568-101829590 ACCCGATGACCCCACTGCTTCGG - Intronic
1032151707 7:129434711-129434733 CCCGCAGGCGCCCACTGCGCGGG - Intronic
1032322087 7:130894837-130894859 CTCCGCTGCCCCCACTCTGCAGG + Intergenic
1036834442 8:12049268-12049290 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1036856285 8:12295832-12295854 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1039548626 8:38427972-38427994 CCCCAAACCCCACACTGCGCTGG - Exonic
1039677455 8:39685162-39685184 CCCAGATGCCCTCACAGCACAGG - Intronic
1039899865 8:41743895-41743917 CCCCGATGAGCCCATTGCTCCGG - Intronic
1040969241 8:53115569-53115591 GCCTGCTGCCCCCACTGCACAGG + Intergenic
1049096303 8:140550302-140550324 CCCTGCTGCCCCCACAGAGCGGG + Intronic
1049212169 8:141391889-141391911 CCCCGAGGCCGCCCCTGGGCTGG - Intergenic
1049399819 8:142419984-142420006 CCCCACTGCCTCCACTGCCCAGG - Intergenic
1049745444 8:144261262-144261284 GCCTGATGCCCCCACTTCACAGG + Exonic
1051350283 9:16192386-16192408 CCCCGTTGCCTGCACTGCGCGGG - Intergenic
1053792987 9:41699878-41699900 CCCCGAAGCCTCCACCGCCCAGG + Intergenic
1054152190 9:61614947-61614969 CCCCGAAGCCTCCACCGCCCAGG - Intergenic
1054181397 9:61911899-61911921 CCCCGAAGCCTCCACCGCCCAGG + Intergenic
1054471962 9:65546090-65546112 CCCCGAAGCCTCCACCGCCCAGG - Intergenic
1057915707 9:99053638-99053660 CCCCATGGGCCCCACTGCGCAGG + Intronic
1060553985 9:124499021-124499043 GCCCGTTGCCCCCACTGCTGGGG - Intronic
1060797515 9:126522636-126522658 CCTCGCTGCCCCCACTGCTGTGG + Intergenic
1061631520 9:131875068-131875090 TCCCGTTTCCCCCACTGAGCAGG - Intronic
1062033157 9:134371180-134371202 CCCAGCAGCCCCCACTGGGCCGG - Intronic
1062162264 9:135087154-135087176 CCCCGACGCCCCCCTGGCGCTGG + Intronic
1062446861 9:136598821-136598843 CCCCGCTGCCCACACTGCCCCGG - Intergenic
1185455023 X:305034-305056 CAGCGATGCCCCCACCCCGCAGG + Exonic
1188975033 X:36662763-36662785 CCACGATGCCACCAATGCACTGG - Intergenic
1192560731 X:72126301-72126323 CCTCTCTGCCCCCACTCCGCTGG - Intergenic
1193399030 X:81020671-81020693 CCCTGCTGCCCCCACTGAGGTGG - Intergenic
1196547985 X:116987399-116987421 CCCCTATTCCCACACTGCTCTGG - Intergenic
1196652125 X:118178607-118178629 ACCCTATGCTCCCAGTGCGCAGG - Intergenic
1202584712 Y:26410103-26410125 CCCCTATACCCCCACTCCCCGGG - Intergenic