ID: 1152236819

View in Genome Browser
Species Human (GRCh38)
Location 17:79143261-79143283
Sequence CTGTAAGGACAGAGGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 499}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152236819_1152236841 29 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236841 17:79143313-79143335 CTGGGGGACCTGGATATTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 140
1152236819_1152236832 12 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236832 17:79143296-79143318 GTTCCCCAAGCCTGTTCCTGGGG 0: 1
1: 0
2: 4
3: 27
4: 285
1152236819_1152236831 11 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236831 17:79143295-79143317 AGTTCCCCAAGCCTGTTCCTGGG 0: 1
1: 0
2: 3
3: 32
4: 228
1152236819_1152236830 10 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236830 17:79143294-79143316 GAGTTCCCCAAGCCTGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1152236819_1152236837 19 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236837 17:79143303-79143325 AAGCCTGTTCCTGGGGGACCTGG 0: 1
1: 0
2: 4
3: 22
4: 248
1152236819_1152236840 28 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236840 17:79143312-79143334 CCTGGGGGACCTGGATATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 183
1152236819_1152236833 13 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236833 17:79143297-79143319 TTCCCCAAGCCTGTTCCTGGGGG 0: 1
1: 0
2: 1
3: 22
4: 238
1152236819_1152236842 30 Left 1152236819 17:79143261-79143283 CCACCCTGCCTCTGTCCTTACAG 0: 1
1: 0
2: 2
3: 65
4: 499
Right 1152236842 17:79143314-79143336 TGGGGGACCTGGATATTCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152236819 Original CRISPR CTGTAAGGACAGAGGCAGGG TGG (reversed) Intronic
900322819 1:2093489-2093511 CTGGAAGGCGAAAGGCAGGGTGG + Intronic
900860194 1:5223394-5223416 CTGGCAGGACACAGGGAGGGAGG + Intergenic
900993545 1:6108637-6108659 GTGGAAGGACAGAGGCATGGAGG + Intronic
900993606 1:6108863-6108885 GTGGAAGGACGGAGGCATGGAGG + Intronic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901207844 1:7507622-7507644 CAGGAAGGAGGGAGGCAGGGTGG + Intronic
901234729 1:7661703-7661725 CTGTGAAGAGAGAGGCAGGGGGG - Intronic
902381004 1:16052175-16052197 CTGCAAGGGCAGAGTCAGGCAGG - Intronic
902533357 1:17104815-17104837 ATGCCAGGATAGAGGCAGGGTGG - Intronic
902696884 1:18146134-18146156 CTGTAAGGAAACAGGCAGAGAGG + Intronic
902792457 1:18778544-18778566 CTGCAAGGACTGGGGCACGGAGG - Intergenic
902814283 1:18907409-18907431 CTGGCAGGAGAGAAGCAGGGTGG - Exonic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903537632 1:24077450-24077472 CAGCAAGGGCAAAGGCAGGGAGG - Intronic
903670289 1:25031324-25031346 CTGTAAGGATAGGGGCTGGAGGG + Intergenic
904836323 1:33339579-33339601 CTCTAGAGGCAGAGGCAGGGAGG + Intronic
905110275 1:35589729-35589751 CAGCCAAGACAGAGGCAGGGGGG - Intronic
906146164 1:43561913-43561935 CTGTGAGTATAGGGGCAGGGGGG - Intronic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
906928066 1:50140333-50140355 CAGTAAGTACAGAGGCTGGCTGG - Intronic
907061746 1:51433822-51433844 CTAAAAGGACAGAGACAGGAAGG + Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907437537 1:54459108-54459130 AAGGAAGGACAGAGGGAGGGAGG + Intergenic
907774106 1:57496224-57496246 GTGTGAGTGCAGAGGCAGGGTGG - Intronic
908646513 1:66284138-66284160 CTGGAAGGACACAGGAAGGCAGG + Intronic
909959549 1:81823290-81823312 CGGGAAGGAGAGAGGAAGGGAGG - Intronic
910079952 1:83329765-83329787 ATGTAAGGACAGAGGGAGTGAGG - Intergenic
910485672 1:87710926-87710948 CTGTCAAGACAGAGCCAGGGAGG - Intergenic
911070405 1:93827688-93827710 CTAAAAGGAAAGAGGGAGGGAGG + Intronic
911357305 1:96838225-96838247 CACTAAGCACAGAGGCAGGCTGG + Intergenic
912308550 1:108595753-108595775 CTGGAGGGAGAGAGGAAGGGAGG + Intronic
913311125 1:117495506-117495528 CTGTAAGGATAGGGGAAGGTAGG - Intronic
913360346 1:117973819-117973841 CTGAAAGGAGGGAGGAAGGGAGG - Intronic
914912290 1:151797293-151797315 CTGTAAGGACATTGGGAGAGGGG + Intergenic
915808388 1:158879033-158879055 GTTTAGGGACAGTGGCAGGGAGG - Intergenic
916763839 1:167841373-167841395 ATGTAAAGACAGAGGAAGTGAGG - Intronic
917600675 1:176570767-176570789 CTGTAAGCAGAGAGCCAGAGGGG - Intronic
917660133 1:177170248-177170270 CTGTAAGGACAAAGGCAAAGAGG - Intergenic
917722965 1:177803516-177803538 CTGTGAGGCCAGAAGCAAGGTGG - Intergenic
917968965 1:180195240-180195262 CTGAGAGGCCAGAAGCAGGGTGG + Intronic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
919935178 1:202246221-202246243 ATGGAAGGAGAGAGGGAGGGAGG - Intronic
919935224 1:202246342-202246364 ATGGAAGGAGAGAGGGAGGGAGG - Intronic
920177670 1:204113145-204113167 GTGTGAGGATGGAGGCAGGGCGG - Intronic
920502266 1:206492884-206492906 CTGGCAGGGCAGAGGCAGCGAGG + Exonic
921702119 1:218280609-218280631 GGGAAAGGCCAGAGGCAGGGTGG - Intergenic
922216779 1:223526430-223526452 CTGTAAGGACACATCCTGGGTGG + Intergenic
923363228 1:233233711-233233733 CTTGAAGGAGAGAGGCAGGGAGG + Intronic
923800663 1:237205561-237205583 CAGAAAGGTCAGAGGCAGGATGG + Intronic
923909052 1:238418975-238418997 TTGTAAAGTCAGAGGCAGGAAGG - Intergenic
924033271 1:239908806-239908828 CTTGAAGGACAGAGGTAGAGTGG - Exonic
924372088 1:243361594-243361616 CTGAATGGACAGGGGAAGGGTGG - Intronic
924610629 1:245570579-245570601 TTGTGGGCACAGAGGCAGGGAGG + Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063570839 10:7213371-7213393 CTGAAATCACAGAGCCAGGGAGG + Intronic
1063940278 10:11121430-11121452 CAGCAAGGACAGAGGGAGAGAGG - Intronic
1063951835 10:11230529-11230551 CTGGAAGGAAACAGGGAGGGTGG - Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064509221 10:16071525-16071547 CTGTGAGGGCAGAGGAAGTGAGG - Intergenic
1065133752 10:22648109-22648131 CTGAAAGGACAGAGACTGGAAGG - Intronic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066232456 10:33449568-33449590 ATGTGAGCACAGAGGCAGGCAGG + Intergenic
1067337934 10:45379432-45379454 CTGTGAGGACAGAGGGAGAGTGG - Intronic
1068566072 10:58577020-58577042 CTGTCGGGCCAGAGGCAGAGGGG + Intronic
1069281689 10:66662583-66662605 CAGAAAGGACAGAGGAAGGAAGG - Intronic
1070085921 10:73237007-73237029 ATGTAAAGACAGAGGCAGGCTGG - Intronic
1072386902 10:94939950-94939972 GTGTAAGGACAGTGCCAGGCTGG - Intronic
1072913445 10:99522889-99522911 AGGTCAGGACAGAGGCAGGAGGG + Intergenic
1073143553 10:101264620-101264642 CAGTAAGGACAGGGGCCTGGGGG + Intergenic
1074749137 10:116567023-116567045 AGGAAAGGACAGAGGGAGGGAGG - Intronic
1074983594 10:118639036-118639058 CTGAAAGGACTGGGCCAGGGAGG - Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1075686195 10:124366944-124366966 CTCCAAGGGCAGAGGCAGGGAGG - Intergenic
1075995993 10:126876644-126876666 CTTTGAGGGCAGGGGCAGGGTGG + Intergenic
1076021436 10:127076944-127076966 CTTTGAGAACAGAGGCAGGGAGG + Intronic
1076048290 10:127312576-127312598 GGGTAAGGACAGAGACAGAGTGG - Intronic
1076880016 10:133235568-133235590 CTGGGAGGAAGGAGGCAGGGGGG + Intergenic
1077080827 11:724063-724085 CTGTCAGGACATGGCCAGGGTGG - Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1078737749 11:14036093-14036115 ATGTGAGGCTAGAGGCAGGGAGG + Intronic
1078757445 11:14224294-14224316 TTGGAAGCACAGAGGAAGGGTGG + Intronic
1079226304 11:18608538-18608560 CTGTAAGTACAGAGGCTTAGGGG - Exonic
1079466598 11:20736744-20736766 ATGAAAGGAGAGAGGAAGGGAGG - Intronic
1081776689 11:45680570-45680592 TTGGAAGGACAGAAACAGGGAGG + Intergenic
1083346496 11:61997049-61997071 CTGGGAGGACATTGGCAGGGAGG - Intergenic
1083633693 11:64108924-64108946 TCCTAAGGACAGAGGCAGGCAGG + Intronic
1084142953 11:67245851-67245873 CTGGAAGCATGGAGGCAGGGTGG - Intronic
1084729540 11:71064581-71064603 CTGGAAGGAAAGAGGCTGGATGG + Intronic
1084769216 11:71331818-71331840 CTGTGAAGAAACAGGCAGGGTGG + Intergenic
1085616231 11:78001195-78001217 CTGTTAGGAAAGAGGAAGGGAGG + Intergenic
1085745217 11:79109335-79109357 CTGTGAGGGCAGAGGCAGCCAGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086569130 11:88262912-88262934 CTGTAGAGACAGTGGCAGAGAGG + Intergenic
1087826562 11:102771137-102771159 CTGTAAGGAAGGAAGGAGGGAGG + Intronic
1088904410 11:114143401-114143423 CTTAAAAGACAGAGGCTGGGGGG + Intronic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1089959238 11:122600999-122601021 AAGGAAGGAAAGAGGCAGGGAGG + Intergenic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1090905741 11:131073190-131073212 AAGTGAGGACTGAGGCAGGGAGG - Intergenic
1091405694 12:207991-208013 ATGACAGGACAGAGGCAGGGTGG + Intronic
1091705433 12:2690243-2690265 CAGAAAGGAGAGAGGCAGGCTGG + Intronic
1091966498 12:4746652-4746674 CTGTGAGTACAGAAGCAGGCTGG - Intronic
1092736158 12:11585027-11585049 CAATGGGGACAGAGGCAGGGAGG + Intergenic
1092942861 12:13426773-13426795 CTGAGAGGCCAGAGGCAGTGAGG + Intergenic
1092950563 12:13499370-13499392 CTGTAAGGAGGGTGGCAGTGGGG + Intergenic
1094541070 12:31363704-31363726 CTGTAAGGAGGGACGGAGGGAGG - Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096069852 12:48768845-48768867 CTGCTAGGACAGGGGTAGGGTGG - Intronic
1096194089 12:49637710-49637732 CTGTAAGGAGGGAGGGAGGGGGG - Exonic
1097242513 12:57585350-57585372 CTTTAAAGAAAGGGGCAGGGTGG + Exonic
1097688427 12:62712263-62712285 TTGTAGAGACAGGGGCAGGGGGG - Intronic
1098171624 12:67752922-67752944 CGATAAGGACAGAGTCAGAGGGG + Intergenic
1100679644 12:96905662-96905684 CAGTGAGGACAGAGGAATGGAGG + Intergenic
1101029608 12:100646221-100646243 CTGAAAGGACAGGGAAAGGGGGG - Intergenic
1101423493 12:104568328-104568350 TTGCAAGGACAGTGGGAGGGGGG - Intronic
1101702237 12:107185002-107185024 CTGTAAGGACACAGTCAGATAGG - Intergenic
1101710009 12:107256475-107256497 CTGCAAGGATAGACCCAGGGAGG - Intergenic
1102231630 12:111266526-111266548 GTGTAAAAACAGAGGCACGGTGG + Intronic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1102825105 12:115942507-115942529 CTGTGAGGTCAGAGGCAGAGGGG - Intergenic
1102970531 12:117162551-117162573 CTGTATGGACATAGAGAGGGCGG - Intronic
1103792184 12:123479551-123479573 CTGTGAGCCCAGAGGCTGGGAGG - Intronic
1103851823 12:123938430-123938452 GTGTTAGGGCAGGGGCAGGGAGG - Intronic
1103872114 12:124099542-124099564 CTCCAAGGACACAGGCAGGTTGG + Intronic
1104427498 12:128690124-128690146 CTGTAAGGACCCAGGGACGGTGG - Intronic
1104547265 12:129723594-129723616 CAGTGAGGACAGAGCCATGGAGG - Intronic
1105447372 13:20469534-20469556 CAGAAAGGCCAGAGGCTGGGAGG + Intronic
1106129952 13:26931909-26931931 CTTTAAGGACAGAGGGAAGCTGG - Intergenic
1106305145 13:28503195-28503217 CTTTGAGGAAAGAGGCAGCGAGG + Intergenic
1107400380 13:40063539-40063561 CTGTGAGGTCACAGGCAGGAAGG + Intergenic
1107516541 13:41134825-41134847 CTGTAAGGACTTAAACAGGGGGG - Intergenic
1107866575 13:44709021-44709043 CTATAAGGACAGTTGCTGGGGGG - Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1112166541 13:96926445-96926467 CTATAAGGCAAGAGGCATGGGGG - Intergenic
1112212884 13:97398564-97398586 ATGTAATGACAGAGACAGAGTGG - Intergenic
1112381699 13:98896988-98897010 ATGTGAGGCCAGAGGCAGAGTGG + Intronic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113574224 13:111382737-111382759 CTGTGATGATAGAGACAGGGTGG + Intergenic
1113791545 13:113031462-113031484 CTGTAGGGACAGAGTCTGGGAGG + Intronic
1113823923 13:113235630-113235652 AGGCAAGGACAGAGGCAGAGGGG + Intronic
1114528240 14:23379451-23379473 CTGTGAGGATAGAGCCAGGTAGG - Intronic
1114638709 14:24204455-24204477 ATGTAGGGACTGAGGCAGGAGGG + Intronic
1119045857 14:71318314-71318336 CTATAAGGAAAGAGGGAGGGAGG - Intergenic
1119080579 14:71689837-71689859 CTGTAAGGAAGGAGGGAGGGAGG - Intronic
1121267458 14:92613690-92613712 GTGGAAGGACAGAGGCACTGAGG + Intronic
1121764912 14:96478167-96478189 AAGGAAGGACAGAGGGAGGGCGG + Intronic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122647915 14:103207331-103207353 CTGTCCGGGCAGGGGCAGGGAGG - Intergenic
1122840873 14:104461949-104461971 CAGCGAGGACAGCGGCAGGGGGG + Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1124623841 15:31297068-31297090 CAGAAAGTGCAGAGGCAGGGTGG + Intergenic
1125470689 15:40000263-40000285 CTGGAAGGAGAGTGGTAGGGGGG + Intronic
1125911796 15:43446591-43446613 CTGAAAGAAGTGAGGCAGGGAGG + Intronic
1125969379 15:43899647-43899669 CTGGAAGGAAAGAGGGAGGGAGG - Intronic
1126313305 15:47340794-47340816 CAGAAAGGACAGAGTGAGGGTGG - Intronic
1126702871 15:51383517-51383539 CTGTTGGGACAGATGCGGGGAGG + Intronic
1126923535 15:53555290-53555312 CACGGAGGACAGAGGCAGGGCGG + Intronic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1128346920 15:66859875-66859897 AGGGAAGGACAGGGGCAGGGTGG - Intergenic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128796373 15:70469634-70469656 CTGTAAGGGCAGGGCCATGGAGG - Intergenic
1129149999 15:73682646-73682668 CTGTAAGGCCAGACCCAGGCTGG + Intergenic
1129966828 15:79743450-79743472 CTGTTAGAACAGAGGCAAGTGGG - Intergenic
1132543858 16:524176-524198 CTGCCAGGCCAGAGCCAGGGAGG + Intergenic
1132563576 16:610207-610229 CTCAGGGGACAGAGGCAGGGAGG - Intronic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1132958919 16:2611642-2611664 CTGGAAGGACGGAGGCAGGAGGG - Intergenic
1133040353 16:3057287-3057309 CTGTGAGGAAAGAGTCAGGCAGG - Intronic
1133172906 16:3992768-3992790 CTGTCAGGGCACAGGCAAGGTGG + Intronic
1133396378 16:5450657-5450679 CTCTGAGGTCAGAGTCAGGGAGG + Intergenic
1133670436 16:8013608-8013630 ATTAAAGGAGAGAGGCAGGGAGG + Intergenic
1133758648 16:8781031-8781053 CTCAAAGGAGAGAGGGAGGGAGG + Intronic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135224107 16:20640619-20640641 CTGAATGCACAGAGCCAGGGTGG - Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136504478 16:30694139-30694161 CTGTAAGGCTAAAGACAGGGAGG - Intergenic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1138135433 16:54517232-54517254 CTTGAAGGTCAGTGGCAGGGAGG - Intergenic
1138578509 16:57924093-57924115 ATGTCAGGCCAGAGGCAGGTTGG - Intronic
1138633619 16:58319353-58319375 GGGTGAGGACAGAGGCGGGGTGG - Intronic
1139016265 16:62692475-62692497 AGGGAGGGACAGAGGCAGGGAGG + Intergenic
1139231519 16:65287514-65287536 CAGGAAGGACAGGGACAGGGAGG - Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1139661755 16:68425599-68425621 CTGTGATGACAGGGGCAGGGAGG + Intronic
1140201324 16:72897107-72897129 CTGTCAGGCCAAAGGCAGGCAGG + Intronic
1140275849 16:73507954-73507976 ATGTTAGGACCAAGGCAGGGGGG + Intergenic
1140550401 16:75859413-75859435 CTGAAAGGGAAGAGGAAGGGAGG + Intergenic
1141137220 16:81474289-81474311 CAGTAGGGAGAGAGGGAGGGAGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142720910 17:1775203-1775225 CTGTAGGGATAGGGGCAGGGTGG + Intronic
1143964254 17:10745347-10745369 ATGTGTGGACAGAAGCAGGGGGG - Intergenic
1144439524 17:15268886-15268908 ATGGAAGGAGAGAGGGAGGGAGG + Intergenic
1144655081 17:17030013-17030035 CAGAAAGGACAGAGGCAGTGAGG - Intergenic
1144704825 17:17361577-17361599 AGGGGAGGACAGAGGCAGGGAGG + Intergenic
1144704841 17:17361619-17361641 GGGGGAGGACAGAGGCAGGGAGG + Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1146499846 17:33354854-33354876 GTGTGGGGACAGAGGCAGAGGGG - Intronic
1146675883 17:34773535-34773557 TGGTAAGGACAGATGGAGGGAGG + Intergenic
1147182723 17:38696856-38696878 ATGCAAGGTCAGAGGAAGGGTGG - Intergenic
1147382404 17:40063363-40063385 CTGGCCGGACAGAGGCCGGGCGG - Intronic
1147645069 17:42028394-42028416 ATGAAAGGACAGAAGCTGGGAGG - Intronic
1148268627 17:46245460-46245482 GTGTTGGGACAGGGGCAGGGCGG - Intergenic
1148712444 17:49691650-49691672 ATGGAAGGAAGGAGGCAGGGTGG + Intergenic
1148778528 17:50109208-50109230 CTGCAGGGACTGATGCAGGGAGG - Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151322487 17:73360197-73360219 ATGAAAGGACAGCGGCTGGGTGG + Intronic
1151386826 17:73760172-73760194 CTGTAAGGTCTGGGGCAGTGGGG + Intergenic
1151659160 17:75509517-75509539 AGGTAAAGACAGAGCCAGGGAGG + Intronic
1151712350 17:75813915-75813937 AAGTAAGGAGAGAGGCAGGCAGG + Intronic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1151934933 17:77255706-77255728 CTTTCAGGGCAGAGGCAGGGTGG + Intergenic
1151967710 17:77440024-77440046 CTGTTAGTACATATGCAGGGAGG + Intronic
1152236819 17:79143261-79143283 CTGTAAGGACAGAGGCAGGGTGG - Intronic
1152445495 17:80340355-80340377 TGGTAAGGAGAGCGGCAGGGTGG + Exonic
1152529958 17:80912291-80912313 CAGTCAGGACAGAGCAAGGGTGG - Intronic
1153767172 18:8385648-8385670 CTGGAAGGACAGTGGCTTGGGGG + Intronic
1154063725 18:11087121-11087143 CTGTGAGGACACAGCAAGGGGGG + Intronic
1154313436 18:13284916-13284938 CTGTGAGGGCAGTCGCAGGGAGG + Intronic
1155400594 18:25434876-25434898 CTGTAAGGACAGTGGCAGGCAGG - Intergenic
1157524736 18:48372218-48372240 CTTCAAGCATAGAGGCAGGGAGG - Intronic
1157607543 18:48935408-48935430 CTGTAAGCACAGCCACAGGGAGG - Intronic
1157842172 18:50968409-50968431 CTGAAAGAACCGAGGCCGGGCGG - Intronic
1159567902 18:70075657-70075679 GTGTAAGGACAAAAGCAGAGTGG - Intronic
1159657693 18:71052344-71052366 CTGCAAGGGCAGAGGCCTGGAGG - Intergenic
1160037982 18:75319055-75319077 ATGCAAAGACAGAGGCGGGGTGG - Intergenic
1160211261 18:76882060-76882082 CTAGAAGCACAGAGGGAGGGCGG - Intronic
1160740156 19:681860-681882 CTGGAAGGACTGAGGAAGGGAGG + Exonic
1160861454 19:1238776-1238798 CTGCAAGGGCAGAGGCGGGGAGG - Intergenic
1161329193 19:3678330-3678352 ATGCAGGGACAGAGGCATGGAGG + Intronic
1161435391 19:4259773-4259795 CTGTAAGGACAGGGACGTGGTGG + Intronic
1161454896 19:4365210-4365232 GTGGAAGGACAGATGCTGGGGGG + Intronic
1161585609 19:5103858-5103880 CCTTAAGGACCAAGGCAGGGTGG - Intronic
1161627358 19:5335114-5335136 CTGTGGGGAGAGAGGCTGGGAGG - Intronic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162361632 19:10223950-10223972 GTGCAAGGACGGAGGCGGGGCGG - Exonic
1162559013 19:11405232-11405254 CTGGAAGGACAGGAGAAGGGTGG + Intronic
1162899032 19:13783295-13783317 CTGTGGGCACAAAGGCAGGGAGG - Intergenic
1162949140 19:14060384-14060406 GTGTCATGATAGAGGCAGGGAGG - Intergenic
1163321614 19:16577962-16577984 CTGTAAGGACACTGCCAGAGAGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164505592 19:28858465-28858487 TTGAAAGGAAAGAGGGAGGGAGG + Intergenic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1165819636 19:38666284-38666306 CTGTTAGGGGAGAGGCTGGGAGG - Intronic
1165883493 19:39060334-39060356 CTGGAAGCAGAGAGGCAGTGTGG + Intergenic
1165893786 19:39129859-39129881 CTCTCAGGAGGGAGGCAGGGAGG + Intronic
1166063362 19:40341696-40341718 CTCTGAGGACCGTGGCAGGGTGG - Intronic
1166522059 19:43487031-43487053 ATGGAAGGACAGAGGTCGGGGGG + Exonic
1167153941 19:47726638-47726660 ATGTAAGGAAGGAGGAAGGGAGG - Intronic
1167614758 19:50526339-50526361 GTTGAAGGACAGATGCAGGGAGG - Intronic
1168168875 19:54573538-54573560 CTGGAAGGGCAGACGCAGGAGGG + Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168428055 19:56255457-56255479 CTGTGAGCACTGAGGCAGGTTGG - Intronic
925024721 2:598787-598809 CTTTGAGGCCAGAGGCATGGCGG - Intergenic
925071750 2:974533-974555 CAGCAAAGACTGAGGCAGGGAGG - Intronic
925561782 2:5203909-5203931 CTGAAAAGACAGAGACAGTGTGG - Intergenic
926244664 2:11113795-11113817 GAGAAAGGACAGAGGGAGGGAGG - Intergenic
926460014 2:13117517-13117539 ATGAAAGGAAAGAGGCAGTGAGG - Intergenic
926737475 2:16084314-16084336 CGGTAAAGACAGAGTAAGGGGGG + Intergenic
928058091 2:28078893-28078915 ATGGAAGGACAGAGGAAGGGAGG - Intronic
928393045 2:30923948-30923970 GTGTAAGCACAGTGGCAGAGTGG + Intronic
931435322 2:62240870-62240892 CTTTGAGGAGAGAGGCAGAGGGG + Intergenic
934092354 2:88563311-88563333 CTATAAGTACAGAGGCAGGCAGG - Intronic
934573013 2:95383979-95384001 CTGCATGGAGAGAGGAAGGGAGG - Intronic
935673562 2:105575667-105575689 CTGCAAGTTCAGAGGGAGGGTGG + Intergenic
936125241 2:109783703-109783725 CAGGAAGGCCAGATGCAGGGTGG + Intergenic
936219452 2:110587765-110587787 CAGGAAGGCCAGATGCAGGGTGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936298761 2:111288500-111288522 TTGTAATGAGAGAGGGAGGGTGG - Intergenic
936920459 2:117683569-117683591 CTCCAAGGACAGGGGCAGGAAGG + Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
938748162 2:134301002-134301024 CTGAATGGAAAGAGGCATGGGGG - Intronic
939167080 2:138651757-138651779 GTGTGAGGACAGAGGCAGGAAGG + Intergenic
940338892 2:152558610-152558632 CTGAAAGGACATAGGGAGGAAGG - Intronic
941600384 2:167536305-167536327 AGGAAAGGAGAGAGGCAGGGAGG + Intergenic
942145501 2:173022654-173022676 CGGTAAGGACAGAGGCTCTGGGG - Intronic
942191728 2:173477429-173477451 CTGTAAGGACAGGGAGAGAGTGG + Intergenic
942481707 2:176394955-176394977 CTGTGATGAAAGAGGTAGGGTGG + Intergenic
943593078 2:189822091-189822113 GTGAGAGGGCAGAGGCAGGGTGG + Intronic
943732858 2:191321661-191321683 ATGCAAGGAAAGAGGCTGGGAGG - Intronic
944483553 2:200180819-200180841 CTAGAAGGACTGAGGCAGGCAGG - Intergenic
944632797 2:201643540-201643562 CTGGCAGGACAGAGGCGGGCGGG - Intronic
946169446 2:217885922-217885944 CTGAAAGGACAGAGTCAGAGAGG - Intronic
946226166 2:218265182-218265204 GAGGAATGACAGAGGCAGGGCGG + Intronic
946944163 2:224802581-224802603 CTGGAAGCACAGAGGCACAGAGG - Intronic
947159130 2:227194070-227194092 AAGTAAGGAGAGAGGGAGGGAGG + Intronic
947854105 2:233311660-233311682 CAGGAAGGACAGGGGCAGGATGG - Intronic
947986954 2:234456429-234456451 ATGTGATGACAGAGGCAGAGAGG + Intergenic
948730363 2:239959689-239959711 AGGGAAGGAAAGAGGCAGGGAGG + Exonic
948730375 2:239959746-239959768 AGGGAAGGAAAGAGGCAGGGAGG + Exonic
948845336 2:240680331-240680353 AGGTAAGGGCAGGGGCAGGGTGG - Exonic
948848525 2:240694548-240694570 AGGTAAGGGCAGGGGCAGGGTGG + Exonic
948855261 2:240727356-240727378 GAGGAAGGACAGAGGCAGGGAGG + Intronic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1169586037 20:7086298-7086320 CAGGAAGGAAAGAGGAAGGGAGG - Intergenic
1169787890 20:9379896-9379918 CTTTAAGGAGAAAGGCAGGAAGG + Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171128847 20:22629464-22629486 CTGTAAGAACAAAGACAGTGAGG - Intergenic
1171481387 20:25458222-25458244 CTGTAGGGAGAGAGGCAGTGTGG - Intronic
1172034238 20:32000409-32000431 CTGCAAGGACCCTGGCAGGGTGG - Exonic
1172110959 20:32544602-32544624 CTGGAAGGAGAGAGGCAGGGAGG + Intronic
1172774392 20:37398604-37398626 CTGCAGGGACAGAGGCCTGGAGG + Intronic
1172785969 20:37469240-37469262 CAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1173305151 20:41841114-41841136 AGGGAAGGACAGAGGGAGGGAGG - Intergenic
1173989814 20:47293233-47293255 AGGGAAGGACAGAGGGAGGGAGG + Intronic
1174005426 20:47407065-47407087 CAGCAAGGAGAAAGGCAGGGAGG + Intergenic
1174005434 20:47407114-47407136 CAGCAAGGAGAAAGGCAGGGAGG + Intergenic
1174406531 20:50306585-50306607 GGGCCAGGACAGAGGCAGGGGGG + Intergenic
1174570347 20:51496956-51496978 CTGGAAGGCCCCAGGCAGGGTGG + Intronic
1175130109 20:56782419-56782441 GGGAAAGGAAAGAGGCAGGGAGG + Intergenic
1175438042 20:58968384-58968406 CAGGAAGGACAGAGTCATGGTGG + Intergenic
1175553557 20:59832129-59832151 CTGGGAGGGCTGAGGCAGGGAGG - Intronic
1175553730 20:59833079-59833101 CTGTAAGTAGAGAGGCAGGTTGG + Intronic
1175781053 20:61682310-61682332 ATGGAAGGAGAGAGGGAGGGAGG + Intronic
1175926125 20:62472439-62472461 CGGCAAGGACAGCGGCAGGAGGG + Intronic
1175942413 20:62543585-62543607 CAGTTGGGAGAGAGGCAGGGTGG - Intergenic
1176015913 20:62932160-62932182 TTGGAATGAAAGAGGCAGGGTGG - Intronic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1178930774 21:36816808-36816830 ATGTAAGGCAAGAAGCAGGGAGG - Intronic
1179149419 21:38797093-38797115 GTGTGAGGACGGAGGCAGTGAGG - Intergenic
1180128609 21:45809629-45809651 CTGTAGTGGCAGCGGCAGGGGGG - Intronic
1181392195 22:22591662-22591684 ATTTGAGGACAGGGGCAGGGAGG - Intergenic
1182109918 22:27715655-27715677 CTGGGAGGGAAGAGGCAGGGAGG + Intergenic
1182160883 22:28120385-28120407 GTCTAGGGACAAAGGCAGGGTGG + Intronic
1183249893 22:36723000-36723022 CTGCAGGGGCAGAGGCATGGAGG - Intergenic
1183321119 22:37165781-37165803 CCAGAAGGACAGAGGCGGGGAGG + Intronic
1183413742 22:37671115-37671137 CTGTCTGGACAAAGGCTGGGAGG + Intergenic
1183589948 22:38774243-38774265 CTGGAAGGACAAACGCAGTGTGG + Intronic
1184108621 22:42382814-42382836 GAGCAAGGAGAGAGGCAGGGAGG - Exonic
1184276077 22:43410557-43410579 CTCTAAAGACAGAGGTAGAGGGG - Intergenic
1184515315 22:44958261-44958283 GTGTAGGGAGAGAGTCAGGGAGG - Intronic
1184614760 22:45630534-45630556 CTGGAAGAAGAGAGGCAAGGGGG + Intergenic
1184992835 22:48182246-48182268 CTGTAGGGAGAGAGGCCTGGCGG - Intergenic
1185011336 22:48316345-48316367 CTGTAAGGCCACAGCTAGGGTGG - Intergenic
1185174919 22:49321079-49321101 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174934 22:49321135-49321157 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174949 22:49321191-49321213 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185341325 22:50292601-50292623 CTGGGAGGACAGAGGCCAGGGGG - Intronic
949189180 3:1231100-1231122 CTCTTAGGAGAAAGGCAGGGAGG - Intronic
949677741 3:6476412-6476434 CTGAAAGGAAAGAATCAGGGAGG + Intergenic
950120037 3:10475715-10475737 CTCAGAGGACAGAGCCAGGGTGG + Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950363753 3:12468561-12468583 GTGAGAGGGCAGAGGCAGGGAGG + Intergenic
950586598 3:13896513-13896535 CAGTAAGCACACAGGCACGGTGG - Intergenic
951689877 3:25384309-25384331 CTCTTAGGAGAGAGGGAGGGAGG - Intronic
952345131 3:32476662-32476684 AGGAAAGGACAGAGGGAGGGAGG + Intronic
954055193 3:48017384-48017406 CTGCAAGGAGGGAGGCAGGCAGG + Intronic
954059890 3:48058270-48058292 TTGTACGGAGAGAGGGAGGGAGG + Intronic
954107910 3:48419211-48419233 CTGCAAGGACAGCGGCAGGCAGG + Intronic
954614237 3:51961346-51961368 ATGTAAGGGCAGGGGCAGGGTGG - Intronic
954618071 3:51980420-51980442 AGGCAAGCACAGAGGCAGGGCGG + Exonic
955029110 3:55199391-55199413 CAGCAAGGACAGAGGCCTGGAGG + Intergenic
955408762 3:58642539-58642561 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955441994 3:58966259-58966281 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955519327 3:59759697-59759719 CTGAAAGGACAGTGCCAGGGAGG - Intronic
955996546 3:64685710-64685732 CCCTAGGGACTGAGGCAGGGCGG - Intronic
956256130 3:67284981-67285003 CTCTAGGGACAGAGTCAGGCTGG + Intergenic
957512070 3:81201867-81201889 CTGAAAGGACAGAGGAACAGAGG + Intergenic
959444985 3:106427773-106427795 CTGGAAGTCCAGAGGCAGAGTGG - Intergenic
959540054 3:107526112-107526134 TTGAAAGGGCAGAGGCTGGGGGG - Intronic
960393934 3:117113026-117113048 TTGTAAAGAAAGATGCAGGGAGG - Intronic
960683727 3:120275776-120275798 CTGTGAGGAGAAAGGAAGGGAGG - Intronic
960991464 3:123314323-123314345 CTGGAAGGAGAGAGGAGGGGAGG + Intronic
961186333 3:124918331-124918353 CTGTGAGCTCAGAGGCATGGAGG - Intronic
962956126 3:140268483-140268505 GTGCAAGGACACAGGCAGGCAGG + Intronic
963872062 3:150427766-150427788 AAGTAAGGAAAGAGGGAGGGAGG - Intronic
966772442 3:183516135-183516157 TTATGAGGACAGAGGCAGGTGGG + Intronic
966985872 3:185179858-185179880 ATGTGAGCACAGATGCAGGGAGG + Intergenic
967166175 3:186781811-186781833 CTGTAAGGTTACAGGCAGTGTGG + Intergenic
967579016 3:191129871-191129893 CTGTTGGAAGAGAGGCAGGGAGG + Intergenic
968279673 3:197466863-197466885 TTTTAAGGGCAGAGGCAGAGAGG + Intergenic
968392902 4:207362-207384 CTCTGGGGCCAGAGGCAGGGAGG - Intergenic
968511950 4:999717-999739 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968511971 4:999803-999825 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968511992 4:999889-999911 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968512015 4:999976-999998 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968512059 4:1000149-1000171 CTGCAAGTGCAGTGGCAGGGTGG + Intronic
968588923 4:1448217-1448239 CTGCCAGGACAGAAGGAGGGTGG + Intergenic
968947820 4:3674893-3674915 AGGAAGGGACAGAGGCAGGGAGG - Intergenic
969111521 4:4847245-4847267 GTGAAAGGACAAAGGCAGGGGGG - Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969292804 4:6251628-6251650 CTTTAAGGATAGAGGCACGCGGG - Intergenic
969572051 4:8014861-8014883 CCGGAAGGAGAGAGGGAGGGAGG - Intronic
969791185 4:9494847-9494869 CTGGTAGGACAGAGGCTGGCTGG + Intergenic
969932311 4:10642500-10642522 CCATAAGGATAGAAGCAGGGAGG + Intronic
970716818 4:18936255-18936277 CTGTGAAGAGAAAGGCAGGGCGG + Intergenic
971954837 4:33403449-33403471 AAGGAAGGAGAGAGGCAGGGAGG - Intergenic
972125617 4:35761168-35761190 CTGTAATGACAGTAGCAGAGGGG - Intergenic
972607424 4:40626693-40626715 CTGTATGGGGAGAGGCAGTGGGG - Intronic
975928261 4:79486468-79486490 ATGTGAAGACAGAGGCAGAGTGG + Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
979389571 4:120112238-120112260 CTGTAAGGACAGGGGAAGCAAGG + Intergenic
980485769 4:133456080-133456102 CTGAAAGCACAGAGGCCAGGTGG + Intergenic
982980238 4:162124491-162124513 CTTTAAGAACAGAGGAAGGGAGG - Intronic
984926926 4:184815262-184815284 CTGTGAGCAAAGAGGCAGGGAGG + Intronic
985714549 5:1448097-1448119 CAGGAAGTGCAGAGGCAGGGGGG - Intergenic
985965168 5:3333932-3333954 CAGTCAAGGCAGAGGCAGGGTGG + Intergenic
986026654 5:3857642-3857664 GGGCAATGACAGAGGCAGGGAGG + Intergenic
986210461 5:5666893-5666915 ATGTAAGAAGAGAGGCAGGTAGG + Intergenic
986319395 5:6615678-6615700 CTGGAAGGACAGCAGCAGGTGGG + Intronic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986742294 5:10714745-10714767 CTGTGAGGACAGTACCAGGGGGG - Intronic
987054213 5:14176173-14176195 CTTTAAAGACAGAGTCAGGCTGG + Intronic
987088214 5:14488292-14488314 CTGGCGGGACAGAGGCAGGGGGG - Intronic
987379097 5:17267379-17267401 CTGTAAGGAATGAGTCAGGATGG - Intronic
987884412 5:23794959-23794981 CTGTAAGGACAGGGTCAAGCTGG + Intergenic
988514906 5:31895839-31895861 AAGAAAGGACAGAGGCAGGGTGG - Intronic
990328924 5:54706171-54706193 CTGTGAGGACAGAGACTGGCAGG - Intergenic
990511679 5:56494658-56494680 CTGTAAGGACAGTCCCCGGGAGG + Intergenic
991106601 5:62851208-62851230 CTGTGATGACAGTGGCAGGGTGG + Intergenic
991745222 5:69732607-69732629 CATTCAGGACATAGGCAGGGTGG + Intergenic
991796790 5:70312336-70312358 CATTCAGGACATAGGCAGGGTGG + Intergenic
991802102 5:70379351-70379373 CATTCAGGACATAGGCAGGGTGG - Intergenic
991831803 5:70697744-70697766 CATTCAGGACATAGGCAGGGTGG - Intergenic
991978708 5:72209783-72209805 GTGTAAGGACAGAAACTGGGAGG + Intergenic
992143301 5:73820609-73820631 CTGTAGGGTAAGAGCCAGGGTGG - Intronic
992324613 5:75648554-75648576 CTGTAAGGACAGGGGCAATATGG - Intronic
993207719 5:84905751-84905773 TTGTAAGGACAGGGGTAGAGTGG - Intergenic
995376675 5:111481920-111481942 CTGTAAGGAAAGAGCCTGAGGGG + Intronic
996059977 5:119022483-119022505 GTGTAAGTAAAGAGGAAGGGAGG + Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997714122 5:136029348-136029370 GTGGAAGGAGAGAGGGAGGGAGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
997780478 5:136652728-136652750 ATATAAGGAGAGAGGCTGGGTGG - Intergenic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998600791 5:143582689-143582711 CTCTAAAGAGAGATGCAGGGAGG + Intergenic
1000687476 5:164270212-164270234 CTGGCAGGAGAGAGGGAGGGAGG - Intergenic
1001820436 5:174705952-174705974 ATGTGTGGAGAGAGGCAGGGAGG - Intergenic
1001995710 5:176156013-176156035 CAGCAGGGACAGAGGAAGGGCGG - Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002321762 5:178380699-178380721 CGGCCGGGACAGAGGCAGGGAGG + Intronic
1004238150 6:13893896-13893918 ATGTGAGGACAGAGTGAGGGGGG + Intergenic
1004962140 6:20801826-20801848 CTATAGGGACAAAGACAGGGAGG - Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1006447160 6:34086112-34086134 CTGTACGGCCAGAGCCAAGGGGG - Intronic
1006499463 6:34448652-34448674 CTTTCAGGCCAGAGACAGGGAGG - Intergenic
1006838381 6:37013105-37013127 CTGCAAGGCCTGAGGCAGGCAGG - Intronic
1006918256 6:37610157-37610179 CTGCAATGAAAGAAGCAGGGAGG - Intergenic
1007105478 6:39280510-39280532 CTGTACGGACAGAGGCAATGGGG - Intergenic
1007115703 6:39341716-39341738 CTGAAATGAGAAAGGCAGGGAGG - Intronic
1007139361 6:39555397-39555419 CCGTAAGGCCAGAGGGTGGGGGG - Intronic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007440997 6:41860250-41860272 TTGCAAGGAGAGAGGGAGGGAGG + Intronic
1007548779 6:42713276-42713298 CTGAAAAGACAGAGTCAGTGAGG + Intronic
1007593378 6:43036926-43036948 CTGCAAGGACAGAGAAGGGGTGG + Intergenic
1007825189 6:44594855-44594877 CTGTGAGGACTGAAGCTGGGAGG + Intergenic
1008211451 6:48729604-48729626 CTGTAAAGGCAGTGGCAGAGAGG - Intergenic
1011202762 6:84855382-84855404 CAATAAGAACAGAGACAGGGAGG - Intergenic
1011374708 6:86676480-86676502 CTGAAAGAAAAGTGGCAGGGTGG + Intergenic
1013657918 6:112264639-112264661 AGGTAAGGAAAGAGGCAGGGAGG + Intergenic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1015737978 6:136421734-136421756 CTGAAATTGCAGAGGCAGGGCGG + Exonic
1015919575 6:138253587-138253609 CTTTAAGGACAGAGTCATGTTGG + Intronic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1016905986 6:149151363-149151385 TTGGAAGGTCAGAGGCAAGGGGG + Intergenic
1017046297 6:150350045-150350067 CTGCAAGGACAAAGGGAGTGTGG - Intergenic
1017569655 6:155731092-155731114 CTATAAGAACAGGGGCAGGATGG + Intergenic
1017705367 6:157117856-157117878 TGGGAAGAACAGAGGCAGGGGGG - Intronic
1017710971 6:157167565-157167587 CTGGAAGGGCAGAGCAAGGGGGG + Intronic
1018055428 6:160048147-160048169 CTGTCAGTGCAGAGGCACGGGGG + Intronic
1018437907 6:163779623-163779645 ATGAAATGACAGAGGCAGCGTGG - Intergenic
1018646451 6:165953136-165953158 CTGCAAGAACAGAGGCACTGAGG - Intronic
1018893117 6:167996517-167996539 CTGAAAGGACAAAGGGACGGAGG - Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019318063 7:400582-400604 CTGTGAGGACATGGGGAGGGGGG + Intergenic
1019344425 7:522399-522421 CTGCAAGGATCGCGGCAGGGCGG - Intergenic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1020118351 7:5488756-5488778 CTGACAGGACAGAGCTAGGGCGG + Intronic
1020659491 7:10965739-10965761 GTGTAAACAAAGAGGCAGGGAGG - Intergenic
1022046276 7:26624907-26624929 CTGAACGCACAGACGCAGGGAGG + Intergenic
1022763122 7:33379154-33379176 CTGTAGGGACAAAGGCACTGAGG - Intronic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1026962841 7:74420085-74420107 CAGAAAGGAAGGAGGCAGGGAGG - Intergenic
1026981346 7:74528667-74528689 CTGAAAGGAGGGAGGGAGGGAGG + Intronic
1027297717 7:76795044-76795066 ATGTAAGGACAGAGGGAGTGAGG - Intergenic
1029101066 7:98130380-98130402 CTGCAAGGACAGAAACAGAGTGG - Intronic
1029147468 7:98457163-98457185 CTGAAAGGCCAGAGGCAGAGTGG + Intergenic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1029668244 7:102009682-102009704 CTGTAAGGAGAGAGAAGGGGTGG - Intronic
1031471876 7:122176353-122176375 CTGGTAGTACAGAGGCATGGAGG - Intergenic
1031811493 7:126375158-126375180 GTGGAAGGACAGAGTAAGGGAGG - Intergenic
1032060128 7:128717153-128717175 CTGGAAGGACAGAGGCCAAGTGG + Intronic
1032242787 7:130177965-130177987 CTGTAAGTAGAGAGGCACAGAGG + Intronic
1033124759 7:138697980-138698002 AAGAAAGGACAGAGGAAGGGAGG + Intronic
1033362371 7:140646844-140646866 ATGGAATGAGAGAGGCAGGGGGG - Intronic
1034185692 7:149174924-149174946 CTATAAGGAAAAAGGCAGAGGGG - Intronic
1034450921 7:151136880-151136902 CTGTGAGGGCAGAGGACGGGAGG + Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034733122 7:153405129-153405151 CTGTCACGACAGAGGGAGGCAGG + Intergenic
1035289707 7:157830060-157830082 CAGAAAGGACAGTGGGAGGGAGG - Intronic
1035627685 8:1084567-1084589 CTGAAAGCACAGAAGCAGTGAGG - Intergenic
1035692275 8:1568104-1568126 CTGAATGGACAGTGGCATGGGGG - Intronic
1035971937 8:4258472-4258494 ATGGAAGGACGGAGGGAGGGAGG + Intronic
1036455518 8:8903336-8903358 ATGTTAGGACAGAGTCAGGTTGG - Intergenic
1036705003 8:11040116-11040138 CAGTAAGGACCCAGGCCGGGGGG + Intronic
1037194209 8:16167644-16167666 AGGTAAGGACAGAGGGAAGGTGG - Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037724511 8:21472339-21472361 AGGGAAGGACAGAGGGAGGGAGG + Intergenic
1038441058 8:27571189-27571211 CCGTGAGGAAAGGGGCAGGGAGG + Intergenic
1038699461 8:29836334-29836356 CTGTGAGGCTAGAGGCAGGATGG - Intergenic
1039359919 8:36864924-36864946 CTGCAAGGAAAAGGGCAGGGAGG - Intronic
1039753625 8:40499256-40499278 CTGAAAGAAAAGAGGAAGGGCGG + Intergenic
1039759935 8:40563788-40563810 CTTTAAGGACAGAGCCACTGTGG - Intronic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1042533334 8:69835476-69835498 CAGGAAGAACAGAGGCACGGGGG + Intergenic
1044427808 8:92073374-92073396 CTGTTAGGGCAGAGGCTGGGGGG - Intronic
1045370179 8:101515073-101515095 CTATAAGGAGGGAGGGAGGGAGG - Intronic
1045487836 8:102646289-102646311 AAGACAGGACAGAGGCAGGGAGG + Intergenic
1047351341 8:124077740-124077762 CTGCAATGTCAGAGGCAGGAGGG - Intronic
1048709669 8:137195219-137195241 CGGGAAGGAGGGAGGCAGGGAGG + Intergenic
1048962755 8:139594108-139594130 CTGTACAGTGAGAGGCAGGGAGG + Intergenic
1049290668 8:141799989-141800011 CTCTAGGGCCAGAGCCAGGGAGG + Intergenic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1049678215 8:143902968-143902990 CTCTGAGGACAGAGGCTGGATGG - Intergenic
1050719384 9:8568322-8568344 CTGTTAGTAGAGAGGGAGGGAGG - Intronic
1050746846 9:8885791-8885813 TTCTAAAGACAGAGGCAGGCCGG - Intronic
1052449330 9:28607648-28607670 CTGTAAGGTGAAAGGCAGGCTGG - Intronic
1052489359 9:29144586-29144608 CAGTAATTTCAGAGGCAGGGTGG + Intergenic
1053390383 9:37730930-37730952 CTGCAAGGACAAAGGCAGTTAGG + Intronic
1056841600 9:90002389-90002411 CTGCAAGCACAGAGACAGGCAGG - Intergenic
1057201817 9:93144547-93144569 CTGGAGGGAGAGAGGCAGGGAGG + Intergenic
1057446824 9:95122182-95122204 CTGGAGGGAGAGAGGCAGGGAGG + Intronic
1058887907 9:109336690-109336712 CTGAGAAGACAGAGGCAGAGAGG - Intergenic
1059019228 9:110555766-110555788 CTTTAAGGATAGAGGAGGGGTGG + Intronic
1059532814 9:115052740-115052762 CTGTAATGACAAAGGCAGTGAGG + Intronic
1059984878 9:119812172-119812194 GTGTGAGGGCAGAGGCAGGGAGG + Intergenic
1060073137 9:120568202-120568224 CGGTGATGCCAGAGGCAGGGGGG - Intronic
1060148297 9:121269866-121269888 CTGAAAGGAGGGAGGCGGGGAGG - Intronic
1060404986 9:123368671-123368693 CTCTGAGGTCAGAGCCAGGGAGG + Intronic
1060448303 9:123712657-123712679 CTGTTATAACAGAAGCAGGGAGG - Intronic
1060726356 9:126008533-126008555 CTATCAGGAGAGAGGGAGGGAGG + Intergenic
1061732725 9:132628947-132628969 CTGTGAGAACAGGGTCAGGGAGG + Intronic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1062158514 9:135067178-135067200 CGGTAGGGACACAGGCAGAGGGG + Intergenic
1185569973 X:1127529-1127551 CTGCAAGGACAGGGACGGGGAGG + Intergenic
1186246727 X:7622866-7622888 AGGGAAGGACAGAGGAAGGGAGG - Intergenic
1186743849 X:12545731-12545753 CTGCAAGAAGACAGGCAGGGAGG + Intronic
1189380887 X:40501348-40501370 CTGCAAGGAGGGAGGGAGGGAGG - Intergenic
1189865920 X:45326942-45326964 TTGGAAGAACAGTGGCAGGGTGG + Intergenic
1191595294 X:62936786-62936808 TAGTAACGATAGAGGCAGGGGGG - Intergenic
1192553257 X:72070287-72070309 CTGTCAGGGCTGGGGCAGGGTGG - Intergenic
1194487634 X:94505297-94505319 CTCTAAGAGCAGAGGCAGTGAGG + Intergenic
1195049055 X:101080215-101080237 CTTTTAGGGCTGAGGCAGGGAGG + Intronic
1195365154 X:104117466-104117488 CTAAAAGGTCAGAGGCAGAGGGG - Intronic
1195681751 X:107552483-107552505 GTGGAAGGAGAGAGGTAGGGAGG + Intronic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197548420 X:127856797-127856819 CTGTAAGGACAAAGAGAAGGTGG - Intergenic
1197728774 X:129793524-129793546 CAGTGAGGAGAGGGGCAGGGCGG + Intronic
1198243512 X:134807499-134807521 ATGTAAGGAGAGAGGCAAAGGGG - Exonic
1198446832 X:136725750-136725772 TTGTGAAGACAGAGTCAGGGAGG - Intronic
1198487410 X:137101987-137102009 CTGGTGGGAAAGAGGCAGGGTGG + Intergenic
1198578990 X:138042547-138042569 AGGTAAGGATAGAGGGAGGGAGG + Intergenic
1200091833 X:153639634-153639656 ATGCAGGGACACAGGCAGGGAGG + Intergenic
1200213909 X:154359042-154359064 CTGGAAGGACTGAGGGAGGTTGG + Exonic
1201472064 Y:14344477-14344499 CTCTAAGCACAGAGGGATGGGGG + Intergenic
1201550063 Y:15210224-15210246 AGGAAAGGACAGAGGGAGGGAGG + Intergenic