ID: 1152237608

View in Genome Browser
Species Human (GRCh38)
Location 17:79146746-79146768
Sequence CCACGTGACCAGCAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 195}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152237608_1152237615 8 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237615 17:79146777-79146799 CTGGGAGGTCCTGCAGAAGCTGG 0: 1
1: 0
2: 4
3: 38
4: 340
1152237608_1152237619 17 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237619 17:79146786-79146808 CCTGCAGAAGCTGGGGAAGATGG 0: 1
1: 0
2: 3
3: 54
4: 622
1152237608_1152237621 21 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237621 17:79146790-79146812 CAGAAGCTGGGGAAGATGGTGGG 0: 1
1: 0
2: 1
3: 87
4: 797
1152237608_1152237613 -10 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237613 17:79146759-79146781 GGTCACGTGGGTCTGCTGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 154
1152237608_1152237616 9 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237616 17:79146778-79146800 TGGGAGGTCCTGCAGAAGCTGGG 0: 1
1: 0
2: 3
3: 35
4: 236
1152237608_1152237617 10 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237617 17:79146779-79146801 GGGAGGTCCTGCAGAAGCTGGGG 0: 1
1: 2
2: 5
3: 47
4: 370
1152237608_1152237614 -7 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237614 17:79146762-79146784 CACGTGGGTCTGCTGCTGGGAGG 0: 1
1: 0
2: 1
3: 24
4: 276
1152237608_1152237620 20 Left 1152237608 17:79146746-79146768 CCTGCAGCCTGCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1152237620 17:79146789-79146811 GCAGAAGCTGGGGAAGATGGTGG 0: 1
1: 0
2: 6
3: 77
4: 793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152237608 Original CRISPR CCACGTGACCAGCAGGCTGC AGG (reversed) Intronic
900569292 1:3350535-3350557 CCCCTTGTCCTGCAGGCTGCTGG - Intronic
901111716 1:6802435-6802457 CTAAATGATCAGCAGGCTGCTGG - Intronic
901795099 1:11675355-11675377 CCAAGTGACGAACAGGCTCCAGG + Intronic
902220182 1:14959547-14959569 CCCGGTGACCAGCATGCGGCTGG + Intronic
902542444 1:17164654-17164676 CCAGACGACCAGGAGGCTGCTGG + Intergenic
902721110 1:18304604-18304626 CCCCCTGACCTGCAGCCTGCTGG + Intronic
905010848 1:34746138-34746160 CCACTGGACCAGCAGGTTTCTGG - Intronic
905249680 1:36639895-36639917 CCCAGTGACCAGCTGGCTGGTGG - Intergenic
912337594 1:108877079-108877101 CCACGTGACCTGCCGGGGGCGGG + Exonic
914244169 1:145873373-145873395 CCTTCTGACCAGCAGGCAGCTGG + Exonic
918120665 1:181536954-181536976 CCAGGTGACCAACAGGGTGATGG - Intronic
919929170 1:202210037-202210059 CCACCAGAGCAGCAGGCTTCTGG - Intronic
921372159 1:214435052-214435074 GCATGTGGCCCGCAGGCTGCGGG + Intronic
1063536296 10:6886941-6886963 GCATGTGTCCTGCAGGCTGCGGG - Intergenic
1064297232 10:14089459-14089481 CCCTGTGCCCAGCATGCTGCGGG - Intronic
1067522154 10:47016091-47016113 CAACATGACCTGCAGTCTGCGGG + Intergenic
1071473360 10:86003538-86003560 CCACATGTCCTGCTGGCTGCTGG - Intronic
1074327594 10:112467550-112467572 ACCCATGGCCAGCAGGCTGCAGG - Intronic
1074888832 10:117718018-117718040 CCACATGACCAGAAGCCTGGAGG + Intergenic
1075483083 10:122798920-122798942 CCACGTGGTCTGCAGGCAGCTGG + Intergenic
1076429490 10:130391637-130391659 CCATGAGCCCTGCAGGCTGCAGG - Intergenic
1076483112 10:130797703-130797725 CCGTGTGACAAGCATGCTGCGGG - Intergenic
1080772996 11:35360061-35360083 CTACGTGACCAGCACGTTCCTGG - Intronic
1084179370 11:67438808-67438830 CTACGTGCCCAGCAAGCAGCGGG - Exonic
1084925429 11:72507604-72507626 ACATGCGGCCAGCAGGCTGCAGG - Intergenic
1085507721 11:77069656-77069678 CCAGCTGCCCAGGAGGCTGCTGG - Intronic
1088744752 11:112796086-112796108 CCTCGGAGCCAGCAGGCTGCGGG - Intergenic
1088794279 11:113254484-113254506 CCAGGTGATCAGCATGCTGCTGG + Intronic
1088832568 11:113549980-113550002 CCAAGTGACCAGCCTGCTGTGGG - Intergenic
1089129083 11:116198476-116198498 CAAGGTGACCAGCAGGATTCAGG + Intergenic
1089493562 11:118897859-118897881 CCACCTGGCCAGCCGCCTGCAGG + Exonic
1089644582 11:119870306-119870328 GGAGGTGACCAGCAGGCAGCTGG - Intergenic
1090203040 11:124869466-124869488 CCACGTTTCCAGGAGACTGCCGG - Exonic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1096561121 12:52436680-52436702 CCACGTGGGAAGCAGGCTCCAGG + Intergenic
1099956063 12:89353538-89353560 CCGCAAGACCTGCAGGCTGCGGG + Intergenic
1103488012 12:121296184-121296206 CCCCGAGACAGGCAGGCTGCGGG + Intronic
1105968329 13:25404758-25404780 GCAGGTGTCCAGCAGGCAGCTGG + Intronic
1107592783 13:41925937-41925959 TCAGGTGACCCCCAGGCTGCTGG - Intronic
1111520090 13:89390111-89390133 ACATGTGGCCTGCAGGCTGCAGG - Intergenic
1113375622 13:109762725-109762747 GGACCTGACCAGCAGGCTGCTGG - Intronic
1113522293 13:110949519-110949541 CCAGGGGACAAGCAGGCTGAGGG - Intergenic
1114086141 14:19237970-19237992 CCAGCTGAACATCAGGCTGCAGG + Intergenic
1115648720 14:35387904-35387926 TCCAGTGACCAGCAAGCTGCTGG + Intergenic
1117504690 14:56390399-56390421 GCATGTGACCTGCAGGCTGCGGG - Intergenic
1118442090 14:65821434-65821456 CCACCTGAGCAGCAGGCTGTGGG - Intergenic
1119484949 14:74981088-74981110 ACAGGAGACCAGCAGGCAGCAGG - Intergenic
1121067311 14:90980477-90980499 CCATGTGACACACAGGCTGCTGG + Intronic
1122978953 14:105182460-105182482 CCCCGAGACCACCATGCTGCAGG - Intergenic
1122984183 14:105204766-105204788 CCACGTGGGCTGCTGGCTGCTGG - Intergenic
1202896851 14_GL000194v1_random:15328-15350 CCAGGTGGACATCAGGCTGCAGG + Intergenic
1202897679 14_GL000194v1_random:19589-19611 CCAGCTGAACATCAGGCTGCAGG + Intergenic
1124251751 15:28110871-28110893 CCACGGGACCAGCTGGTGGCAGG - Intergenic
1124631220 15:31338730-31338752 CCAGGATCCCAGCAGGCTGCTGG - Intronic
1127007619 15:54588106-54588128 TCCCCTGACCAGCAGACTGCTGG + Intronic
1127007623 15:54588114-54588136 CCATGCAACCAGCAGTCTGCTGG - Intronic
1127246964 15:57187598-57187620 CCACGTAACCCACAGGCTGTGGG + Intronic
1128997163 15:72305769-72305791 CCATGTTACCAGCTGCCTGCTGG + Intronic
1129365570 15:75051904-75051926 GCACCTGACCAGCGGGGTGCAGG - Intronic
1131197538 15:90367528-90367550 CAAGCTGACCAGCAGGCTTCTGG - Intronic
1131574993 15:93579943-93579965 GCATGTGGCCTGCAGGCTGCAGG - Intergenic
1132516066 16:366580-366602 CCACCTGACCTGCAGGGTGGAGG - Intergenic
1132706052 16:1243963-1243985 GGACGTGACAGGCAGGCTGCTGG + Intergenic
1135977456 16:27118277-27118299 GCATGTGGCCTGCAGGCTGCAGG - Intergenic
1136605705 16:31331771-31331793 CGACGTGTCCAGCAGCCTGGGGG - Exonic
1137396527 16:48119376-48119398 CCATGTGCCCTGCATGCTGCAGG + Intronic
1137483297 16:48870317-48870339 CCTGGTCTCCAGCAGGCTGCTGG + Intergenic
1138431598 16:56972532-56972554 CCGCGGGATCAGGAGGCTGCAGG + Intronic
1140456584 16:75109290-75109312 CCCCGTGCCCAGCGGGCTCCCGG + Exonic
1142027095 16:87820167-87820189 CCACGTGACCTGCAGACCCCAGG - Intergenic
1142310534 16:89309910-89309932 CCAGGTGGCCGGCAGGCTGGTGG - Intronic
1142551807 17:745402-745424 CCAGCTGACCAGGAGACTGCTGG - Exonic
1142810899 17:2395101-2395123 CCCCCTGCCCAGCAGGCCGCAGG - Exonic
1143069466 17:4278518-4278540 ACATGTGGCCCGCAGGCTGCAGG + Intronic
1143779355 17:9221283-9221305 CCACGTGACCAGCGAGGTGCTGG + Intronic
1143904761 17:10199223-10199245 CCACGCTGCCACCAGGCTGCTGG - Intergenic
1143920601 17:10328345-10328367 CCAGGTGACCAGGAGCCCGCAGG - Intronic
1144732665 17:17537493-17537515 CCCCGTGCCCAGCAGCCTGCAGG + Intronic
1145347274 17:22049016-22049038 ACAGGTGAGCATCAGGCTGCAGG - Intergenic
1145878955 17:28340223-28340245 CCACCTGACAAGCTGGCGGCAGG - Intronic
1148319002 17:46733291-46733313 CCACTGGTCCTGCAGGCTGCAGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152237608 17:79146746-79146768 CCACGTGACCAGCAGGCTGCAGG - Intronic
1152259985 17:79261632-79261654 CCAGGTGACACGGAGGCTGCTGG + Intronic
1152392197 17:80009668-80009690 TCACGTGCCCAGTGGGCTGCAGG + Intronic
1153662339 18:7336206-7336228 CCATGTGGCCTGCAGGCTGTGGG + Intergenic
1154383892 18:13876184-13876206 ACACGTGGCCAGCATTCTGCTGG - Intergenic
1155166640 18:23237407-23237429 CCAGGTGGCCAGCAGGATTCTGG - Intronic
1156187186 18:34676908-34676930 CCAAGTGTCCAGTAGGCTGCAGG + Intronic
1157176831 18:45459601-45459623 CCCCGGGAATAGCAGGCTGCAGG - Intronic
1161013567 19:1971628-1971650 CCCCGTGACCTGCAGCCTGCGGG + Intronic
1163666158 19:18605027-18605049 GCACCTGACCAGCAGGCGGGTGG - Intronic
1164794676 19:31016063-31016085 CCACCTGACCAGCAGGGGACAGG - Intergenic
1166759785 19:45217566-45217588 CCGCGTGGCCGGCAGGCTCCGGG - Exonic
1166856891 19:45786656-45786678 CCACTTGGCCAGCGGGTTGCGGG + Exonic
1167587623 19:50383960-50383982 TCAGGTCACCAGCTGGCTGCTGG + Intergenic
1168329964 19:55562299-55562321 ACATGTGGCCTGCAGGCTGCAGG - Intergenic
928034490 2:27809115-27809137 CCACATCACCATAAGGCTGCTGG - Intronic
928916040 2:36471809-36471831 TCATGTGGCCCGCAGGCTGCAGG + Intronic
932900641 2:75695788-75695810 CTATGTGACTAACAGGCTGCTGG + Intronic
936501798 2:113072539-113072561 CCACCAGCCCAGCAGGCTCCAGG - Exonic
938772915 2:134516006-134516028 CTACGTGTCCTGCAGGGTGCTGG + Intronic
948619995 2:239228230-239228252 CCAGGTGAGGAGCAGCCTGCTGG + Intronic
1169867874 20:10219514-10219536 CCACGTCAACTGCAGGCTGGCGG + Intronic
1170469753 20:16656610-16656632 CCAGCTCACCAGCAGCCTGCAGG - Intergenic
1170471242 20:16670193-16670215 CTCAGTGGCCAGCAGGCTGCAGG + Intergenic
1171174800 20:23043596-23043618 CCATGTGACCAGCAGGTTTCAGG + Intergenic
1171520285 20:25770497-25770519 ACAGGTGAGCATCAGGCTGCAGG + Intronic
1171556634 20:26085996-26086018 ACAGGTGAGCATCAGGCTGCAGG - Intergenic
1172036969 20:32018040-32018062 CCAGGTGAGCAGCAGGCAGCGGG - Exonic
1173460755 20:43241471-43241493 CCAGGGAGCCAGCAGGCTGCAGG - Intergenic
1174582117 20:51579445-51579467 CCAGGTGACCCGCCAGCTGCCGG - Intergenic
1175221614 20:57420649-57420671 TCACGTGAGCAGCAGGGTGCTGG + Intergenic
1175894371 20:62329561-62329583 CACCCTGACCAGCAGGGTGCAGG + Intronic
1176089820 20:63313794-63313816 CCAGCTGACCTGCAGGCTGTCGG - Exonic
1176169670 20:63691124-63691146 CCACCTCACCCACAGGCTGCTGG + Intronic
1176616539 21:9031324-9031346 CCAGGTGGACATCAGGCTGCAGG + Intergenic
1176617363 21:9035578-9035600 CCAGCTGAACATCAGGCTGCAGG + Intergenic
1176654421 21:9576784-9576806 ACAGGTGAGCATCAGGCTGCAGG + Intergenic
1176707778 21:10128091-10128113 CCAGCTGAACATCAGGCTGCAGG - Intergenic
1177807690 21:25890168-25890190 CCAAGAGAACAGCAGGCAGCAGG - Intronic
1179617805 21:42593304-42593326 CCACCAGCCCAGCAGGCTGCAGG - Intergenic
1179982273 21:44901726-44901748 CCATGTGCCCTGCAGGCTTCGGG - Exonic
1180291826 22:10855223-10855245 CCAGCTGAACATCAGGCTGCAGG - Intergenic
1180494630 22:15884645-15884667 CCAGCTGAACATCAGGCTGCAGG - Intergenic
1180640271 22:17292592-17292614 CCAAGTGGCCAGCAGGATCCAGG + Intergenic
1180786872 22:18552495-18552517 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1180940994 22:19659404-19659426 CCAGGTGGACACCAGGCTGCAGG + Intergenic
1181054929 22:20256396-20256418 CCAGGAGACCAGCTGGGTGCTGG - Intronic
1181243783 22:21492016-21492038 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1181395672 22:22619475-22619497 GCATGTGGCCTGCAGGCTGCAGG + Intergenic
1182972535 22:34591248-34591270 CCAAGTAACCAGTAGGCTGTAGG + Intergenic
1185058966 22:48595650-48595672 CAACCTGCCCATCAGGCTGCAGG + Intronic
956869332 3:73401271-73401293 TCACGTGACTGGCAGGCTCCGGG - Intronic
960836244 3:121909725-121909747 GCATGTGGCCTGCAGGCTGCAGG - Intronic
961269873 3:125680625-125680647 CCAGGTGAACATCAGGCTTCAGG + Intergenic
961552408 3:127676868-127676890 CCACCTGGCCACCTGGCTGCAGG - Intronic
961681712 3:128604067-128604089 CCACCTGACCAGGAGGCCCCCGG + Intergenic
968698674 4:2044596-2044618 CCAGGTGAACAGCAGGCTGGAGG + Intergenic
968931465 4:3581706-3581728 CAGAGTGACCAGCAGGCTCCTGG - Intronic
969441116 4:7217280-7217302 CCAGGGCACCAGCAAGCTGCGGG - Intronic
969608384 4:8213462-8213484 CTATGTGTCCAGCAGCCTGCAGG - Intronic
971332827 4:25696437-25696459 CCAGGTGATCTGCAGGCTCCAGG - Intergenic
975332941 4:73139771-73139793 CCATCTGAGCAGCAGTCTGCTGG + Exonic
986543866 5:8874192-8874214 TCAGGTGTCCAGGAGGCTGCAGG - Intergenic
988092697 5:26563309-26563331 CCACGTGACCAGCAGGAACAAGG + Intergenic
988611946 5:32735155-32735177 CCAAGTGACCACCAGGCTAGAGG - Intronic
990873773 5:60462108-60462130 CCATGGAACCAGCAGTCTGCAGG + Intronic
992270661 5:75059562-75059584 CAACCTGACCGGCAGGCTGATGG + Intergenic
995966332 5:117911756-117911778 CCTCGTGTGCAGCAGCCTGCCGG - Intergenic
997605665 5:135174146-135174168 CCAGGTGACCCGCAGCCTCCGGG + Exonic
997629971 5:135360098-135360120 CCCCAGGACAAGCAGGCTGCCGG + Intronic
998008879 5:138677027-138677049 CCATGCTTCCAGCAGGCTGCAGG + Intronic
1002517933 5:179773482-179773504 GCGCCTGGCCAGCAGGCTGCAGG - Intronic
1003329108 6:5114830-5114852 GCACGTGGCCCGCAGGCTGTGGG + Intronic
1004294240 6:14395551-14395573 GCACGGGAACAGCAGGCAGCTGG + Intergenic
1005718978 6:28582162-28582184 GCAAGTGGCCTGCAGGCTGCAGG - Intronic
1006795185 6:36727688-36727710 CCAGGTGAGCAGATGGCTGCTGG + Exonic
1007107542 6:39294131-39294153 CCACTCCCCCAGCAGGCTGCAGG + Intergenic
1007109451 6:39304506-39304528 CCACTGGGCCAGCAGGCTGGGGG - Exonic
1007737420 6:43990380-43990402 CCGTGTGACGAGCATGCTGCTGG - Intergenic
1015681621 6:135814817-135814839 GCATGTGGCCTGCAGGCTGCAGG - Intergenic
1015811425 6:137165296-137165318 CCACTTGACCCAGAGGCTGCGGG + Intronic
1016935830 6:149448889-149448911 CCTCTGCACCAGCAGGCTGCAGG + Intronic
1017103275 6:150866331-150866353 CCACGTGCGCAGCCGGCCGCCGG + Intronic
1017112870 6:150949152-150949174 CCACCTGGCCATCAGCCTGCTGG - Intronic
1017719413 6:157234550-157234572 CCACGTGCCCAGCCGGCCACTGG + Intergenic
1019187871 6:170231505-170231527 CCACTTGGCCAACAGGCTGCTGG + Intergenic
1019357883 7:590452-590474 CCAAGAGACCAGCAGGGTGGGGG + Intronic
1019368947 7:650796-650818 TCACGTGGCCAGCAGGCAGCAGG + Intronic
1023833986 7:44057871-44057893 CCACGTGCCCAGCATGCCCCGGG - Intronic
1023861875 7:44221492-44221514 CCACGTGCGGCGCAGGCTGCAGG + Intronic
1024219763 7:47278340-47278362 CCACGTGCCCAGCACCCTGCTGG + Intronic
1024219765 7:47278348-47278370 ACAGGTGGCCAGCAGGGTGCTGG - Intronic
1024671766 7:51602216-51602238 CTCCATGACCTGCAGGCTGCTGG + Intergenic
1025280780 7:57625452-57625474 ACAGGTGAGCATCAGGCTGCAGG + Intergenic
1025303950 7:57840055-57840077 ACAGGTGAGCATCAGGCTGCAGG - Intergenic
1029113041 7:98223206-98223228 CAAGGTGACCACCAGGCTCCAGG + Intronic
1029284643 7:99457290-99457312 CCACATGCCCAGCAGGTTGCAGG - Exonic
1029695314 7:102209098-102209120 CCATCTGAACAGCAAGCTGCTGG + Intronic
1030043163 7:105469954-105469976 GCATGTGGCCCGCAGGCTGCAGG + Intronic
1033245618 7:139714411-139714433 CCTGGTGCCCAGCAGGCTGAGGG + Intronic
1033422045 7:141212234-141212256 CCCCGGGACCAGCAGACAGCAGG - Intronic
1034493573 7:151407384-151407406 CCAAGTGCCCACCAGGCTACCGG + Intronic
1034721717 7:153299653-153299675 CCAGGTGGTCAGCAGGCTCCTGG + Intergenic
1038348781 8:26757356-26757378 CCACCTGCCTAGAAGGCTGCTGG + Intronic
1038893671 8:31756325-31756347 CCAGGTGACTAGCAGGAAGCAGG + Intronic
1041245042 8:55880897-55880919 CCACATGACAGGCAGGCTGTTGG - Intronic
1041464763 8:58146767-58146789 CCACGTGGGCAGGAGACTGCTGG + Exonic
1049028258 8:140012634-140012656 CGGCCTGACCAGCAGGATGCAGG - Intronic
1049300427 8:141866760-141866782 GCAGGTGAGCAGCAGGCTGGAGG + Intergenic
1049497358 8:142942531-142942553 CCCCCTAACCAGCAGGCTCCTGG - Intergenic
1053561342 9:39198405-39198427 CCACGGCTCCAGCAGGATGCTGG + Intronic
1053761010 9:41350023-41350045 CCAGCTGAACATCAGGCTGCAGG + Intergenic
1054135777 9:61420542-61420564 CCACGGCTCCAGCAGGATGCTGG - Intergenic
1054458665 9:65450223-65450245 CAGAGTGACCAGCAGGCTCCTGG + Intergenic
1056121449 9:83492777-83492799 CCACCCCACCAGAAGGCTGCTGG - Intronic
1059326766 9:113508464-113508486 CCCCGTGTCCAGCAGCCTCCTGG + Intronic
1061698072 9:132393028-132393050 CCACAGGCCCAGGAGGCTGCTGG + Intronic
1061715668 9:132517275-132517297 CCCCGGGAGCAGCAGACTGCTGG + Intronic
1061861884 9:133472502-133472524 CTGCGTGCCCACCAGGCTGCAGG - Intronic
1062076504 9:134592806-134592828 CCCCGGCTCCAGCAGGCTGCAGG - Intergenic
1062100954 9:134728315-134728337 CCATGTCTCCAGCAGGCTCCCGG - Intronic
1062429316 9:136519967-136519989 ACATGGGGCCAGCAGGCTGCTGG + Intronic
1202792523 9_KI270719v1_random:96971-96993 CCAGCTGAACATCAGGCTGCAGG - Intergenic
1203632142 Un_KI270750v1:80242-80264 ACAGGTGAGCATCAGGCTGCAGG + Intergenic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1187006829 X:15240650-15240672 CCTTGTGACCAGCTGGCTGGCGG - Intronic
1187285041 X:17897132-17897154 CCAGTTGACAACCAGGCTGCTGG - Intergenic
1190393294 X:49954256-49954278 GCACGTGACCCACAGGCCGCGGG - Intronic
1191670604 X:63745146-63745168 CTCCGTGCCCAGCTGGCTGCAGG - Intronic
1200146432 X:153928539-153928561 GCACGTGACCAGCAGGCAGCCGG - Intronic
1200219064 X:154381797-154381819 GCACGCTACCAGCAGTCTGCGGG + Intergenic
1201150759 Y:11094415-11094437 CCAGCTGAACATCAGGCTGCAGG + Intergenic