ID: 1152238138

View in Genome Browser
Species Human (GRCh38)
Location 17:79149056-79149078
Sequence TAGAGTGCGCTGTTCGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152238138_1152238143 17 Left 1152238138 17:79149056-79149078 CCACTGACGAACAGCGCACTCTA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1152238143 17:79149096-79149118 GGAGATCCTCCAGGGCATGGAGG 0: 1
1: 0
2: 1
3: 32
4: 237
1152238138_1152238140 8 Left 1152238138 17:79149056-79149078 CCACTGACGAACAGCGCACTCTA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1152238140 17:79149087-79149109 GAAGCACAAGGAGATCCTCCAGG 0: 1
1: 0
2: 4
3: 14
4: 163
1152238138_1152238141 9 Left 1152238138 17:79149056-79149078 CCACTGACGAACAGCGCACTCTA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1152238141 17:79149088-79149110 AAGCACAAGGAGATCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 163
1152238138_1152238139 -4 Left 1152238138 17:79149056-79149078 CCACTGACGAACAGCGCACTCTA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1152238139 17:79149075-79149097 TCTAAAGCTTAAGAAGCACAAGG 0: 1
1: 0
2: 0
3: 20
4: 208
1152238138_1152238142 14 Left 1152238138 17:79149056-79149078 CCACTGACGAACAGCGCACTCTA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1152238142 17:79149093-79149115 CAAGGAGATCCTCCAGGGCATGG 0: 1
1: 0
2: 3
3: 21
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152238138 Original CRISPR TAGAGTGCGCTGTTCGTCAG TGG (reversed) Intronic
1082259953 11:50071195-50071217 GAGAGTGCGCTGTTAGGCAGAGG + Intergenic
1083951289 11:65957881-65957903 TAGAGTGCTCTCTTCATGAGTGG + Intronic
1088337836 11:108728278-108728300 TTGAGTGCTCTGTTCTTGAGGGG + Intronic
1096806255 12:54142983-54143005 AAGAGGGCACTGTTCCTCAGCGG + Intergenic
1107596979 13:41973375-41973397 TGGAGTTCCCTGTTAGTCAGGGG - Intergenic
1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG + Exonic
1115308415 14:31955831-31955853 TAGAGTGTCTTGTTCTTCAGAGG + Intergenic
1120897892 14:89550566-89550588 CAGAGTGTGCTGTTTGTCAAGGG - Intronic
1136576744 16:31129852-31129874 TCCAGTTCCCTGTTCGTCAGAGG + Intronic
1136627914 16:31472915-31472937 TAGAGGGCGCTGCTCGGTAGGGG + Intronic
1152238138 17:79149056-79149078 TAGAGTGCGCTGTTCGTCAGTGG - Intronic
1154337316 18:13476014-13476036 TAGAATGGGGTGTTTGTCAGGGG + Intronic
929328453 2:40648109-40648131 GAGAGTTCGCTGATCTTCAGAGG - Intergenic
932049749 2:68386769-68386791 TATAGAGCGCTGTTAGGCAGCGG + Intronic
937771837 2:125728484-125728506 TAGATTCAGCTGTTCCTCAGGGG - Intergenic
941648837 2:168070986-168071008 CAGAGTGGGATGTTTGTCAGAGG - Intronic
942725192 2:178998669-178998691 CAGAGTGCACTGGTAGTCAGTGG - Intronic
942799456 2:179860306-179860328 TAGGGAGTGCTGTTCTTCAGGGG - Intronic
962915644 3:139901072-139901094 TTGAGTGCTCTGTTGATCAGTGG + Intergenic
963561879 3:146876055-146876077 TTGAGTGCGCTGGAAGTCAGAGG + Intergenic
974061675 4:57041482-57041504 TGGAGTGCTGTGTGCGTCAGGGG + Intronic
980442876 4:132870697-132870719 CAGAGTGCTCTGTCCCTCAGTGG - Intergenic
1004003066 6:11613529-11613551 TAGAATGTGCAGTTCATCAGTGG + Intergenic
1005639113 6:27777716-27777738 TAGAGTGAGCTGATCTTAAGAGG + Intergenic
1016310095 6:142724933-142724955 TAAACTGTGCTGTTCTTCAGAGG - Intergenic
1018789831 6:167139604-167139626 TAGAAGGGGCTGTTCTTCAGTGG + Exonic
1187046010 X:15647726-15647748 TAGAGGTCACTGTTCCTCAGTGG - Intronic
1187051989 X:15704028-15704050 TAGAGGTCACTGTTCCTCAGTGG - Intronic
1195571600 X:106403239-106403261 TGGAGTGGGCTGCTTGTCAGGGG - Intergenic
1199730689 X:150629242-150629264 TAGACTGAGATGTTCGCCAGTGG + Intronic