ID: 1152238615

View in Genome Browser
Species Human (GRCh38)
Location 17:79150794-79150816
Sequence GGCCACAGGGTGCCTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152238611_1152238615 8 Left 1152238611 17:79150763-79150785 CCGAGAAAAGAGGGGGGCAGGGA 0: 1
1: 0
2: 5
3: 34
4: 406
Right 1152238615 17:79150794-79150816 GGCCACAGGGTGCCTCTGACTGG 0: 1
1: 0
2: 1
3: 24
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152238615 Original CRISPR GGCCACAGGGTGCCTCTGAC TGG Intronic
900462208 1:2807114-2807136 GGCCTCAGGCTGCCCCTGAATGG + Intergenic
900616162 1:3566610-3566632 GGCCCCGGGGTCCCTCTGATGGG - Intronic
900712077 1:4120697-4120719 GGCCTCAGGGTGGCTCAGGCAGG + Intergenic
902190965 1:14762797-14762819 GGCCACAGCCTGCCTCCGTCTGG - Intronic
903238734 1:21968384-21968406 GGCCACAGGAGGCCTTTGAAGGG - Intergenic
903242659 1:21994048-21994070 GGCCACAGGAGGCCTTTGAAGGG - Intronic
904000427 1:27335652-27335674 GGGGACAGGGTGCTTCTGAGAGG - Exonic
904054093 1:27659013-27659035 GGCCATACGGAGCCTCTGAATGG + Intergenic
904058353 1:27686873-27686895 TGCCCAAGGGTGCCTCTGCCGGG - Intergenic
906177620 1:43789114-43789136 GGCCACAGGAAGCCTCTGAAGGG + Intronic
908067283 1:60420547-60420569 GGCCTCAGAGTCCCTCTAACAGG + Intergenic
911745353 1:101435854-101435876 GGCCACAGTCTGTCACTGACAGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
913533469 1:119749558-119749580 GGCCGCAGGATGCCTTTGAGAGG - Intronic
914439432 1:147690968-147690990 GGACACAGGGGACTTCTGACTGG - Intergenic
922603617 1:226875099-226875121 GGCCCCAGGGGCCCTCTGATGGG - Intronic
1062847279 10:717747-717769 GGCCATGGGCTGCCTCTGTCCGG - Intergenic
1063462350 10:6222773-6222795 GGCCACAGACTGCATCAGACCGG - Intronic
1067008730 10:42690744-42690766 GGCCACTGGGTGGCAGTGACAGG + Intergenic
1067551254 10:47237988-47238010 AGCCACACGGTGCCCCTGATGGG - Intergenic
1069689870 10:70343395-70343417 GTCCACAGGGCTCCTCTGCCAGG + Intronic
1072239547 10:93482738-93482760 AGCTAAAGGGTGCCTCTTACTGG + Intergenic
1073178175 10:101569155-101569177 GGCACCAGGGTTCCTCTGCCAGG + Intergenic
1074228719 10:111512909-111512931 GGCCACAGCCTCCCTCTGTCAGG - Intergenic
1076524843 10:131105893-131105915 GGCTCCTGTGTGCCTCTGACAGG + Intronic
1077076422 11:704424-704446 GGCCACTGGGGGCCACAGACAGG - Intronic
1078429905 11:11280788-11280810 GGCCACATGGTGCTCCTGATGGG + Intronic
1081911995 11:46705587-46705609 GGCTGCAGGGTGCCTCAGGCCGG - Exonic
1083298974 11:61730371-61730393 GGCTGCAGGGAGCTTCTGACAGG + Intronic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1084554748 11:69869004-69869026 GCCCACTGGGTGCCTGTTACAGG - Intergenic
1084672795 11:70616888-70616910 GGCCACAGGGTGCAGCAGCCAGG + Intronic
1085662522 11:78382293-78382315 GCCTACAGGATGCCTCTCACTGG - Intronic
1085803759 11:79615688-79615710 GGCCACAAGGTTGCTTTGACAGG - Intergenic
1086334280 11:85783954-85783976 GGCCACAGATTTCCTCAGACTGG + Intronic
1088760463 11:112924451-112924473 AGCCACAGGGTACCTGGGACAGG + Intergenic
1089611647 11:119672670-119672692 GGCCACAGGGAGTCTCTGAAGGG - Intronic
1090225978 11:125072531-125072553 GGCCCCAGGGTGGCTGTGACGGG - Intronic
1090718038 11:129447483-129447505 GGCCACAGGGTGCATGTGAATGG + Intronic
1091768240 12:3135815-3135837 GGACACAGGGTACGTCTGAGAGG - Intronic
1091897750 12:4118795-4118817 GACCACATGGTGCTTCTGGCAGG + Intergenic
1091897993 12:4120185-4120207 GACCACATGGTGCCTCTGGCAGG + Intergenic
1092063715 12:5572118-5572140 GGCCACAGGGTACCACTGTAGGG - Intronic
1097895077 12:64817155-64817177 ACCCACAGGGTGAGTCTGACTGG - Intronic
1099198568 12:79648765-79648787 GGCAACAGGATGGCTCTAACAGG + Intronic
1103612719 12:122133800-122133822 GCCCACAAGGGGCCGCTGACGGG - Exonic
1104412726 12:128572698-128572720 GGCCACAGTGAGCATGTGACAGG - Intronic
1105432139 13:20346181-20346203 GGGCACAGGGTCCTTCTGATGGG - Intergenic
1106502311 13:30340614-30340636 GGACACAGGGAGCCTATGGCCGG + Intergenic
1107652945 13:42562923-42562945 GGCTACAGCTTGCCTCTGGCTGG - Intronic
1107739016 13:43429119-43429141 GCCCACAGGGTACTTGTGACAGG - Intronic
1113577685 13:111405555-111405577 GGCAGCAGGTCGCCTCTGACTGG + Intergenic
1115899147 14:38125696-38125718 AGCAACAGGCTGCCTCTGACAGG + Intergenic
1117974248 14:61281526-61281548 GGCCCCGGGCTGCCTCTGAGTGG + Exonic
1119258710 14:73223268-73223290 GGCAGCAGGGTGCCTCTTAGTGG + Exonic
1120792292 14:88596409-88596431 GGCCACAAGGTGCCTTTTCCTGG + Intronic
1121553531 14:94819805-94819827 GGACACATGGTGCCTCTTCCAGG - Intergenic
1122403094 14:101479035-101479057 GGCCACAGCCTCCCTCAGACAGG + Intergenic
1122803457 14:104244766-104244788 GGCCACAGCATGCTTCTGGCCGG - Intergenic
1122803890 14:104247131-104247153 GGCCACAGGGTGCCCTGGCCGGG + Intergenic
1122809591 14:104281436-104281458 GGCCAGAGGGTGGCTCTGCTGGG - Intergenic
1124140207 15:27070879-27070901 AGCCACAGGGAGGCTCTGAGGGG - Intronic
1124899653 15:33810395-33810417 GGAGGCAGGCTGCCTCTGACAGG + Intronic
1125375274 15:39022172-39022194 GGACAATGGGTGCCTTTGACAGG + Intergenic
1125506422 15:40270281-40270303 GGCCTCAGGGAGCCTCTGGGAGG - Intronic
1125722382 15:41851506-41851528 AGCCACAGAGGGGCTCTGACGGG + Intronic
1132542259 16:516036-516058 GGCCACGGGGTGCCCGGGACAGG - Intronic
1133076172 16:3282932-3282954 GGCCACGCGGCGCCACTGACTGG + Exonic
1133599091 16:7321844-7321866 GGCAACAGAGAGCCTCTGACAGG - Intronic
1133879548 16:9768003-9768025 AGCCACAGGCTGGCTCTGTCTGG + Intronic
1134090058 16:11386781-11386803 GGCTACAGGTCGCCTCTGACCGG + Intronic
1135008025 16:18845298-18845320 GGCCACAGGCTGCCTCCTATAGG + Intronic
1135633323 16:24053391-24053413 GGCCACAGTGTGCCAATGAATGG + Intronic
1136375828 16:29864444-29864466 TGGCACGGGGTGCCTCTGCCTGG - Intergenic
1136381032 16:29895776-29895798 AGCCCCAGGGTGCGGCTGACGGG + Exonic
1136608904 16:31354587-31354609 GACCACAGGGTGCCTCACCCGGG - Intergenic
1137723941 16:50644633-50644655 GGGCCCAGGGTGACTCTGAGTGG + Intergenic
1138303739 16:55955812-55955834 AGCCACAGGGTGCTACTGCCTGG - Intronic
1139939008 16:70591370-70591392 GGACAGAGGGTGACTCTGGCAGG + Intronic
1144485960 17:15664536-15664558 GGCCACAGGTCGTCTCTGTCTGG - Intronic
1144625977 17:16844696-16844718 AGCTAGAGGGTGCCCCTGACAGG + Intergenic
1144726410 17:17504736-17504758 GGCCTCCGGGAGCCCCTGACTGG + Intergenic
1144880457 17:18428024-18428046 AGCTAGAGGGTGCCCCTGACAGG - Intergenic
1145151778 17:20516363-20516385 AGCTAGAGGGTGCCCCTGACAGG + Intergenic
1147580127 17:41623394-41623416 AGCTAGAGGGTGCCCCTGACAGG + Intronic
1147990331 17:44328769-44328791 GGCCACATGTTGCCTCTGGAAGG - Intergenic
1148232429 17:45944761-45944783 GACCCAAGGGTGCCTCTGAGAGG + Intronic
1148795137 17:50193258-50193280 GGCCACAGCGGGCATCTAACAGG - Intronic
1149777183 17:59367207-59367229 GGTCCCTGTGTGCCTCTGACAGG + Intronic
1151161032 17:72166120-72166142 GGTCACAGGCTGTTTCTGACGGG + Intergenic
1151744166 17:76002633-76002655 GGCCACAGGGTGCCACAGGCAGG + Intronic
1151766732 17:76136862-76136884 GGCCCCAGGGAGGCTCTGCCAGG + Exonic
1151882369 17:76903322-76903344 GGTCACTGGGTGCCTCACACTGG - Exonic
1152238615 17:79150794-79150816 GGCCACAGGGTGCCTCTGACTGG + Intronic
1152492429 17:80646315-80646337 TGTCACAGGATACCTCTGACCGG + Intronic
1156346007 18:36257717-36257739 TGCCACAGGGTGACTGGGACGGG + Intronic
1159048826 18:63397479-63397501 GGCCACAGTGTTCCTATGTCTGG + Intronic
1161045493 19:2132224-2132246 AGCAACAGGGTGTCCCTGACAGG - Intronic
1161415582 19:4145017-4145039 GGCCACAGGGGGACTCTGGCCGG - Intergenic
1162249642 19:9431287-9431309 GGCCACAGGGTGGTGGTGACTGG - Intronic
1163512167 19:17741771-17741793 CACCTCAGGGTGCATCTGACTGG - Intergenic
1164699640 19:30275439-30275461 GGCCACTGGCTGTGTCTGACCGG + Intronic
1165867221 19:38946219-38946241 GTCCACAGGGGGCCACTGACTGG - Intronic
1165922034 19:39305281-39305303 GGCCTCAGGGGGCCCCTGGCTGG + Intergenic
1166441927 19:42823017-42823039 GGCCACAGGGTGCAGAAGACAGG + Intronic
1166461351 19:42991299-42991321 GGCCACAGGGTGCAGAAGACAGG + Intronic
1166478645 19:43151278-43151300 GGCCACAGGGTGCAGAAGACAGG + Intronic
1166501317 19:43343614-43343636 GGCCACAGGGTGCAGAAGACAGG + Intergenic
1166508795 19:43389833-43389855 GGCCACAGGGTGCAGAAGACAGG - Intergenic
1166917269 19:46204066-46204088 GGCCTCAGGGAGCCTCTCCCAGG - Intergenic
1168642150 19:58037808-58037830 GGCCACAGTGCCCCTCTGAGGGG - Exonic
927125799 2:20011965-20011987 GTCCTCAGGCTGCCTCAGACTGG - Intronic
927136895 2:20103932-20103954 GGGCACTGGGTGCCTCTCTCTGG + Intergenic
927733551 2:25497734-25497756 GGCCACAGAATGACTCTGACTGG - Intronic
931757212 2:65384757-65384779 GGCCAGAGAGTGCCTCTGAATGG - Intronic
933515229 2:83291854-83291876 GGCCACTGAGTACCTCTGACAGG + Intergenic
935079510 2:99778367-99778389 TGACACAAGGTGCCTCAGACAGG + Intronic
936024156 2:109018496-109018518 GGCAACGGGGAGCCTCTGAAGGG - Intergenic
936049262 2:109210934-109210956 GCCCACTGGGAGGCTCTGACAGG - Intronic
940739035 2:157485825-157485847 GGCCACAGAGGGCCTGTTACTGG + Intronic
940979417 2:159984848-159984870 GGCCACAGGGTGTACCTGTCTGG - Intronic
941432733 2:165431282-165431304 GACCTCATGGTGCCTCTGAAAGG + Intergenic
948298732 2:236885817-236885839 GGCCACGGGTTCCCACTGACAGG + Intergenic
1172773726 20:37395731-37395753 AGCCACAGGGAGCCACTCACAGG + Intronic
1173503499 20:43569857-43569879 GGCCACAGGGTGGGATTGACTGG + Intronic
1174355687 20:49996371-49996393 GACCACACGGTGTTTCTGACAGG - Intergenic
1175731192 20:61354870-61354892 GGGCACAGGGAGCCTCTCTCTGG + Intronic
1176127856 20:63483980-63484002 GCCCAGAGAGTGGCTCTGACTGG - Intergenic
1176195377 20:63834481-63834503 GGCCTCAGGGTCCCTTGGACAGG - Intergenic
1179580765 21:42342682-42342704 GGCCACCGGCGGCCTCTGGCAGG + Intergenic
1180071035 21:45435916-45435938 GACCCCAGGGTGCATCTCACAGG - Intronic
1180996396 22:19967954-19967976 GGACACAGAGTTCCTCTGCCTGG - Intronic
1181141777 22:20810746-20810768 CACCTCAGGGTGCCTCTGACTGG - Intronic
1183279197 22:36923113-36923135 GGCCACCTGGTGCCTCTGCAGGG + Intronic
1184220053 22:43094353-43094375 GGCCTCAGGGAGCATCAGACTGG - Intergenic
1184800849 22:46758276-46758298 GGTCACAGGATGCCTCTGTTGGG - Intergenic
949888654 3:8715472-8715494 GGCCTCAGGGTGGTTCTGAAAGG - Intronic
950018533 3:9770255-9770277 GGCCACAGGGTGAGTTTGGCCGG - Intronic
950304531 3:11907858-11907880 GGCCACAGGGTCACGCTGAAGGG - Intergenic
950459911 3:13115110-13115132 GGCCACAGGGAGCCACAGATGGG + Intergenic
950552857 3:13677162-13677184 GGCCACATGAGGACTCTGACAGG - Intergenic
953870966 3:46627446-46627468 GGGCACAGGGAGCCCCTGAAGGG + Intergenic
954423063 3:50428785-50428807 GGACACTGGTTTCCTCTGACAGG - Intronic
954701179 3:52451647-52451669 GGCCACAGGGTCCCTAGGCCTGG + Intronic
958954695 3:100455022-100455044 GGCCAGAGGGTGCCTTTCAAAGG - Intronic
958998007 3:100927997-100928019 GGCCTCAGGATGGTTCTGACTGG - Intronic
961378914 3:126484617-126484639 GGGCACAGGGCACCTCTCACTGG - Intronic
964806253 3:160612834-160612856 GGCCACATGGTTCTTCTGGCAGG + Intergenic
966819491 3:183913799-183913821 GGCCACACGGTCCCCCTTACAGG + Intergenic
967867558 3:194203072-194203094 GGGCAGAGGATGCCTCTGAGAGG + Intergenic
968597381 4:1492431-1492453 GCTCCCACGGTGCCTCTGACAGG + Intergenic
968905783 4:3449941-3449963 GGCCACAGGCTGCCTCTGTGGGG + Intergenic
968956414 4:3721999-3722021 AGCCACAGGGGCCCTCGGACAGG - Intergenic
969869357 4:10095058-10095080 GGCCACAGGGGGCCTCTGCAGGG + Intronic
972771938 4:42205363-42205385 GGCCATAGGGAGCCACTGAAGGG - Intergenic
972808925 4:42561663-42561685 GGACACAGGGAGCCTCTGTAGGG + Intronic
977687132 4:99859884-99859906 GGGCACAGGGAGCCTCTGTGTGG - Intronic
978853027 4:113360777-113360799 GGCCAAAGGTTGTCTATGACAGG - Intronic
980798078 4:137711312-137711334 GGCCAGAGGGTAGGTCTGACTGG - Intergenic
983317413 4:166149690-166149712 GGCCACAGGGCCCCTCTGTTGGG + Intergenic
992229999 5:74654701-74654723 AGCCACAGGGAACCTCTGAAAGG + Intronic
992810415 5:80382206-80382228 AGACACAGGGTGACTCTGAAAGG - Intergenic
1000129827 5:158285919-158285941 GGGCAGAGTCTGCCTCTGACAGG + Intergenic
1000988392 5:167886075-167886097 GGCCACAGTGTGCTCCTGCCTGG + Intronic
1001475183 5:172045219-172045241 GTCCACAGGGAGCTTCTGAGTGG - Intronic
1002428752 5:179191168-179191190 GGCCACTGCGAGCCACTGACAGG + Intronic
1004235682 6:13872900-13872922 GGCAACAGGGTGACTCTCATGGG + Intergenic
1006725671 6:36197297-36197319 GTCCCCTGGGTCCCTCTGACGGG + Intronic
1007056327 6:38889158-38889180 GGCCACTGTGTGCCTGTGACAGG - Intronic
1011254368 6:85405790-85405812 TGACCCAGGGTGCCTCTGAGAGG + Intergenic
1011435623 6:87333459-87333481 GGCCACCAGGTGCCTATAACAGG - Intronic
1013047684 6:106503577-106503599 GGCCACAGGTTGCCTCTTTAAGG + Intergenic
1015823842 6:137291350-137291372 GGCTACCTGGAGCCTCTGACTGG - Intergenic
1017012013 6:150069342-150069364 GGCCAGAGGGGGCCGCTGTCAGG - Intergenic
1017768681 6:157627883-157627905 GGCCACAAGGGGCCTGGGACAGG - Intronic
1019524718 7:1475809-1475831 GGCCACAGGGCGGCGCGGACTGG + Intronic
1019609346 7:1929111-1929133 GGCCACAGAGTTGCTCTGCCTGG - Intronic
1020224448 7:6269089-6269111 GGCCACTGGGAGCCACTGGCAGG - Intronic
1022529012 7:31055660-31055682 GGCTACAGGCTGGATCTGACTGG + Intronic
1023059755 7:36315972-36315994 GGCCCCAGGGTGCCTAGGACAGG - Intergenic
1024042374 7:45565371-45565393 GCCCTCAGGGGGCCTCTGCCTGG + Intergenic
1026283481 7:68943028-68943050 GGCCTCAGGGTTCCCCAGACTGG + Intergenic
1028455167 7:91030642-91030664 AGCCGCAGGGTGCCTCTACCAGG - Intronic
1029154073 7:98502679-98502701 GTCATCAGGGTGCCTCTGTCGGG - Intergenic
1029733332 7:102451862-102451884 GAGCGCAGGGTGCCTCTGCCTGG + Exonic
1034474071 7:151272821-151272843 GGCCACCGCCTGCCTCTGACGGG - Intronic
1035689435 8:1550098-1550120 GGCCACATGGTCCCTCTCACGGG - Intronic
1038447570 8:27614654-27614676 GGGCACAGGGTGCCGCTGACCGG - Exonic
1040317839 8:46274340-46274362 GGCCACAGGGTGGCATAGACAGG + Intergenic
1041942122 8:63399917-63399939 GGCTACATTGTGCCTCTCACTGG + Intergenic
1047510696 8:125513189-125513211 GCCCACAGGGTGACTCAGAGGGG + Intergenic
1049188080 8:141269888-141269910 GGCCACAGTGTGTCTATGGCTGG + Intronic
1049745607 8:144261970-144261992 GGCCAGAGGGTGCCCTGGACTGG + Intergenic
1049758552 8:144321544-144321566 GGCCACAGTGTGGCTCTGCCTGG - Intronic
1049767068 8:144359779-144359801 GGCCACATGGTGCCACAGAGAGG - Exonic
1050776985 9:9276127-9276149 GGCCAAAATGTGCCACTGACGGG - Intronic
1054957742 9:70932777-70932799 AACCACAGGATGCCTCTGAAGGG + Intronic
1055870908 9:80878703-80878725 GGCCATAGTTTGCCTATGACTGG - Intergenic
1056654483 9:88497825-88497847 TGCCACTGTCTGCCTCTGACAGG + Intergenic
1058767156 9:108192638-108192660 GACCACAGAGTGCCTCTGAAGGG - Intergenic
1060207311 9:121689682-121689704 GGCCACAGGGAGCTTCTGTTGGG - Intronic
1061071610 9:128314255-128314277 GGCCACAGGGTGGCTGTCAGCGG - Intronic
1061287785 9:129634010-129634032 GGTGACAGGGTCCCTCTGATAGG + Intronic
1061926597 9:133808926-133808948 GGCCATAGGGCCTCTCTGACAGG - Intronic
1062113926 9:134797386-134797408 GGCCACTGGGTGCCAAGGACTGG - Intronic
1062214167 9:135380110-135380132 AGCCACAGGGGGCCACTGAACGG - Intergenic
1190076664 X:47322063-47322085 GGCCACACGGAGGCTCAGACAGG - Intergenic
1191786500 X:64922092-64922114 GGCCTCAGGTTGGCTCTGCCTGG - Intronic
1192441686 X:71179258-71179280 GACCCCAGAGTGCCTCTGAATGG - Intergenic
1201252853 Y:12076971-12076993 TTCCACTGGGTGCCTCTGAGGGG + Intergenic