ID: 1152239720

View in Genome Browser
Species Human (GRCh38)
Location 17:79155012-79155034
Sequence CCAGGCATCCAAAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152239711_1152239720 9 Left 1152239711 17:79154980-79155002 CCTCGGCGTCTGAGGAAGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1152239720 17:79155012-79155034 CCAGGCATCCAAAGGGTGGGTGG 0: 1
1: 0
2: 4
3: 19
4: 167
1152239707_1152239720 13 Left 1152239707 17:79154976-79154998 CCAGCCTCGGCGTCTGAGGAAGG 0: 1
1: 0
2: 2
3: 38
4: 1696
Right 1152239720 17:79155012-79155034 CCAGGCATCCAAAGGGTGGGTGG 0: 1
1: 0
2: 4
3: 19
4: 167
1152239706_1152239720 14 Left 1152239706 17:79154975-79154997 CCCAGCCTCGGCGTCTGAGGAAG 0: 1
1: 0
2: 2
3: 27
4: 587
Right 1152239720 17:79155012-79155034 CCAGGCATCCAAAGGGTGGGTGG 0: 1
1: 0
2: 4
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152239720 Original CRISPR CCAGGCATCCAAAGGGTGGG TGG Intronic
902251463 1:15156342-15156364 CCAGGCCTGCAGAGGGAGGGAGG - Intronic
902362218 1:15948113-15948135 ACAGGCCCCCAAAAGGTGGGAGG + Intronic
902481389 1:16713844-16713866 CCAGGCAACCATAGGGCGGCTGG + Intergenic
903522950 1:23967611-23967633 TCAAGCGACCAAAGGGTGGGTGG - Intronic
904120720 1:28196042-28196064 CCAGTCCTCCAAGAGGTGGGGGG - Intergenic
904606849 1:31702719-31702741 CCAGGCACCCACAGGGTCAGGGG + Intronic
906291568 1:44622773-44622795 CCAGGCACCCCAAAGGTAGGTGG + Exonic
908113535 1:60919918-60919940 CCATGAATGCAATGGGTGGGAGG + Intronic
908152003 1:61311880-61311902 TCAAGCCTCCAAAGGGTGGGTGG - Intronic
910553606 1:88504760-88504782 CCAGTTATGCAAAGGCTGGGAGG + Intergenic
912809510 1:112783234-112783256 CAAGGCTTCCACAGGGTGTGGGG + Intergenic
915979452 1:160410889-160410911 CCCAGCATCCAAAGGGAGGGAGG - Intronic
917739853 1:177951862-177951884 CCAGGCATCCCAAGGGCTTGAGG - Intronic
919055234 1:192562406-192562428 CCAGGCCTCCAGAGAGTTGGGGG + Intergenic
919557723 1:199081090-199081112 CAAGGCATCCAAAGTATTGGTGG + Intergenic
919751720 1:201041867-201041889 GCAGGGTTCCAAAGGCTGGGAGG - Intronic
919805877 1:201380741-201380763 CCAGGCATGCAAAGGGGGAATGG + Intronic
920174006 1:204088947-204088969 CCAGTGGTCCAGAGGGTGGGAGG + Intronic
923676977 1:236088628-236088650 CCTGGCATCCAGAGCCTGGGTGG + Intergenic
1065053632 10:21820674-21820696 CCAGGCTTCCATCGGGTTGGAGG - Intronic
1065841990 10:29709820-29709842 GCAGGCACCCAGTGGGTGGGTGG + Intronic
1067850221 10:49749872-49749894 CCAGGCCTCCACAGTGGGGGAGG - Intronic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1073217391 10:101843908-101843930 CCCGGGCTGCAAAGGGTGGGGGG - Intronic
1075948082 10:126454973-126454995 CCAGGCATGCCAAGGGAAGGTGG - Intronic
1076830471 10:132991961-132991983 CCCAGCAGCCACAGGGTGGGAGG - Intergenic
1077191274 11:1256815-1256837 CCAAGCACACACAGGGTGGGAGG + Intronic
1077296133 11:1827058-1827080 CCGGGCAGCCAGTGGGTGGGTGG + Intergenic
1077465741 11:2732916-2732938 CTGGGCCTCCAGAGGGTGGGTGG - Intronic
1078795859 11:14591343-14591365 CCAGGAACCCACAGAGTGGGTGG - Intronic
1079163046 11:18012546-18012568 CCAGGCATCAGGAGTGTGGGGGG + Intronic
1082833799 11:57638271-57638293 CCTGGCAGCCAATGGGAGGGAGG + Intergenic
1083628957 11:64086050-64086072 CCAGGGCTCCATAGGGAGGGAGG - Intronic
1083770618 11:64864885-64864907 CCAGCCATCCAGGGGGAGGGGGG - Intronic
1086110298 11:83192060-83192082 CCAGGCCTCCGGAGGGTGGGGGG - Intergenic
1087115555 11:94520757-94520779 CCAGGCCTGCAAAAGGTGGCAGG - Intergenic
1089681173 11:120119796-120119818 CCAGCCATGCACAGGGAGGGAGG - Intronic
1089941710 11:122424921-122424943 CCAGTCATTTAAATGGTGGGTGG - Intergenic
1090657233 11:128855441-128855463 CCTGGCACCCAGAGGGTGTGAGG + Intronic
1092744503 12:11660861-11660883 CCAGGCACCCAAAGGGACAGAGG + Intronic
1092902681 12:13074738-13074760 CCTGGGATCCTAAGGGTGTGTGG + Intronic
1094142745 12:27198037-27198059 CCAGGATTGCAGAGGGTGGGAGG - Intergenic
1094422248 12:30282993-30283015 CCAGGCTTCCAGTGGGTGGGTGG + Intergenic
1097765310 12:63519770-63519792 ACAGGCATCCACAGGGTGCCAGG + Intergenic
1098112846 12:67141801-67141823 CCAGTCATCCAAAGACTTGGTGG - Intergenic
1098742616 12:74193209-74193231 CCATGCATCCAAAGGCTGCTGGG + Intergenic
1099584985 12:84504492-84504514 CCAGGGATACAAAGTGTTGGAGG - Intergenic
1100606425 12:96155510-96155532 CCAGTCATCCAAAGGGCTGCAGG - Intergenic
1102201557 12:111061007-111061029 CCTGGCATCCCAAGGCTGGGAGG - Intronic
1103379279 12:120481364-120481386 GCAGGCATCTAAAGTGGGGGCGG - Intronic
1105249435 13:18684668-18684690 GCGGGCATCCAAAGGGTGGGAGG + Intergenic
1109881798 13:68487720-68487742 CCTGGCAACCAAAGTGTGTGTGG + Intergenic
1111607951 13:90564457-90564479 TCAGACATGCAATGGGTGGGGGG - Intergenic
1112738007 13:102443036-102443058 ACAGGGATCCATAGGGAGGGTGG + Intergenic
1112943770 13:104898733-104898755 CCAGGCTTCCTGTGGGTGGGAGG + Intergenic
1113716697 13:112514277-112514299 TCAGGCATCCATGGGGTGGGGGG + Intronic
1114440950 14:22747303-22747325 CCTGAGATTCAAAGGGTGGGTGG - Intergenic
1115203179 14:30874827-30874849 CCGGGGATCCGAAGGGTGCGGGG + Intronic
1117333337 14:54735809-54735831 CCAGGCATCTCAATGGTGAGAGG - Intronic
1119153116 14:72383786-72383808 GCAGGCTTTCAAAGGGTGGGGGG + Intronic
1120432444 14:84436248-84436270 ACAGGCCTCCAAAAGGTGGGAGG + Intergenic
1120787202 14:88548741-88548763 CCAGGTAGCCAAAGGTAGGGAGG + Intronic
1123634126 15:22286181-22286203 CCATGCTTCCACAGGGTAGGTGG + Intergenic
1127313288 15:57771036-57771058 CCTGGCCTCCAAAGTGTGAGGGG + Intronic
1127647346 15:60971880-60971902 CCAGACAGCCCAATGGTGGGAGG - Intronic
1129410722 15:75348891-75348913 TCAGGCATCCTGAGGGAGGGTGG - Exonic
1129762302 15:78136941-78136963 AAAGGCATCCAAGAGGTGGGTGG - Intronic
1131848007 15:96508778-96508800 ACAGGGATAGAAAGGGTGGGAGG - Intergenic
1132121722 15:99181720-99181742 CCAGGCCTCCAAGGGGTGTGTGG - Intronic
1134601367 16:15536304-15536326 CCAAGCATCCAGAGGCGGGGGGG - Intronic
1139491921 16:67290834-67290856 TGAGGCATCCACAGGGTCGGTGG + Intronic
1139601496 16:67990189-67990211 CCAGGGATCCAGAGGGTGGCAGG - Intronic
1141660326 16:85437842-85437864 CCACACAGCGAAAGGGTGGGAGG - Intergenic
1143272882 17:5688868-5688890 CCAGGGATGCAAAGGATGTGTGG + Intergenic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1144036476 17:11370558-11370580 ATAGCCATCCAAAGAGTGGGTGG - Intronic
1144282466 17:13740104-13740126 GAAGGCATACAAAGAGTGGGAGG - Intergenic
1146693499 17:34892576-34892598 CCAGACATCCTTTGGGTGGGTGG + Intergenic
1149393296 17:56213878-56213900 CCAGGGAGGCAAAGGATGGGAGG + Intronic
1151775552 17:76198862-76198884 TGTGGCATCCAGAGGGTGGGAGG - Intronic
1152070796 17:78132690-78132712 CCAGGCCTCCCCAGGGTTGGGGG + Intronic
1152228232 17:79102471-79102493 CAGGGCAGCCAAAGGGTGGCTGG - Intronic
1152239720 17:79155012-79155034 CCAGGCATCCAAAGGGTGGGTGG + Intronic
1153650632 18:7236935-7236957 CCGGGCATACATAGGGTGGTGGG - Intergenic
1153756253 18:8286357-8286379 CCAGGATTCCCAAGGGTGGCTGG + Intronic
1154439394 18:14374234-14374256 GCAGGCATCCAAAGGGTGGAAGG - Intergenic
1160145093 18:76357182-76357204 CCAGCCATCCAAGAGGAGGGAGG + Intergenic
1160976156 19:1793613-1793635 GCAGGCACCCCAAGGGTGGTCGG + Intronic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161718270 19:5889663-5889685 CCAGGTCTGCAAAGGGTAGGAGG - Intronic
1162989629 19:14293782-14293804 CCAGCCATCCTAAGGGAGAGAGG - Intergenic
1163392610 19:17039500-17039522 CCAGGCAGCCCAGGAGTGGGAGG + Intergenic
1163612392 19:18308259-18308281 CCAGGCACACAGAGGGTGTGGGG - Intronic
1164886564 19:31783508-31783530 ACAGGAATCCAAAGAGAGGGTGG - Intergenic
1165286327 19:34845553-34845575 CCAGGTATCCAAATGTTGGCAGG - Intergenic
1165319709 19:35077615-35077637 TCAGGAAACCAGAGGGTGGGCGG - Intergenic
1167490871 19:49792189-49792211 CCGGGCATCCAGGGGGTGCGTGG - Intronic
1167490942 19:49792376-49792398 CCAGGCATCCAGGGGGCGTGAGG - Intronic
1167671576 19:50856559-50856581 CCAGGCAGCCATGGGGAGGGTGG - Intronic
1167822742 19:51943711-51943733 TCAGGCATCCATGGTGTGGGGGG + Intronic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
1202715428 1_KI270714v1_random:39755-39777 CCAGGCAACCATAGGGCGGCTGG + Intergenic
925089514 2:1142373-1142395 CCTGGAATCCAAAGGGATGGTGG - Intronic
929940374 2:46329252-46329274 CGAGGCAACCACAGGGTAGGAGG + Intronic
931944173 2:67286760-67286782 CCAGCATTCCACAGGGTGGGTGG + Intergenic
932100794 2:68897379-68897401 ACAGGGATCCAATGGGAGGGAGG - Intergenic
932494615 2:72140226-72140248 CCAGGCAGCGGGAGGGTGGGCGG - Intronic
932605531 2:73163142-73163164 CCTGGCTCCCAAGGGGTGGGAGG + Intergenic
938912279 2:135897171-135897193 TCAGGCAGCTAAAGGGAGGGGGG + Intergenic
939103560 2:137924136-137924158 GAGGGCATCCAAAGGGTGGAAGG + Intergenic
939961684 2:148570984-148571006 CCACACATGCAAGGGGTGGGGGG + Intergenic
942498721 2:176565863-176565885 CCAGGCAGCCAAAAGGAGGGCGG - Intergenic
946072436 2:217046060-217046082 GCAGTCATCCAAAATGTGGGTGG + Intergenic
946247361 2:218395352-218395374 CCTGACAGCCCAAGGGTGGGTGG + Exonic
947240995 2:227994474-227994496 CAAGTCTTCCAAAGGGTGAGTGG + Intronic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1169016682 20:2298306-2298328 CCTGGCATCCCCAGAGTGGGTGG + Intronic
1170931053 20:20769625-20769647 CAAGGCTTCCAAAAGGTGGAAGG - Intergenic
1172753805 20:37269604-37269626 CCAGGCATCCCAAGGGTCTCAGG - Intergenic
1175330273 20:58158790-58158812 CCAGGGGTCCAGAGGGAGGGAGG - Intronic
1176456288 21:6915174-6915196 GCAGGCATCCAAAGGGTGGAAGG + Intergenic
1176834462 21:13780234-13780256 GCAGGCATCCAAAGGGTGGAAGG + Intergenic
1180099364 21:45577253-45577275 CCAGGCACTCCCAGGGTGGGGGG + Intergenic
1183401793 22:37609110-37609132 CCAGGGATCCGACAGGTGGGCGG - Intronic
1184350419 22:43939873-43939895 CCTGGCAGCCAAAGGGTCAGAGG - Intronic
1185060808 22:48605829-48605851 CCAGGCATCCCAACTGTGGGTGG - Intronic
953125613 3:40088980-40089002 CTAGGCATGCAGAGGGTGTGGGG + Intronic
953170932 3:40506399-40506421 CTTGACATCTAAAGGGTGGGAGG - Intronic
953720330 3:45349523-45349545 GCAGGCATCGAAAGGGTTTGGGG + Intergenic
953926470 3:46985179-46985201 CCAGGCATCCAGCGGGTTTGGGG + Intronic
954267700 3:49482861-49482883 CCAGGCATCCTAGGGGTTGATGG + Intronic
956024903 3:64972792-64972814 CCAAGTATGCAAATGGTGGGAGG - Intergenic
956206500 3:66760364-66760386 ACTGGCATCCAATGGGTGGAGGG + Intergenic
957921962 3:86758449-86758471 CAAAGCCTCCAAAGTGTGGGAGG - Intergenic
959109470 3:102104822-102104844 CAAAGCATCCCAAGGCTGGGAGG + Intronic
960570182 3:119178070-119178092 CCAGGACACCAAAGGGTTGGGGG + Intronic
961266093 3:125644111-125644133 CCAGGAAGCAAGAGGGTGGGTGG + Intergenic
961626125 3:128264910-128264932 CCAGGCAGCCAGAGGGGAGGTGG - Intronic
962383630 3:134915881-134915903 CAAAGCTTCCACAGGGTGGGAGG + Intronic
963761965 3:149293624-149293646 CCAGGAACCCAAAGGATAGGAGG + Intergenic
968631875 4:1656074-1656096 CCAGGCATCTCAAGGATGTGCGG + Intronic
973782321 4:54300323-54300345 ACAGGGATCCATAGGGAGGGTGG + Intergenic
974026732 4:56739352-56739374 ACAGGCATGCAACGGGTGGATGG + Intergenic
974066828 4:57086399-57086421 CAAGGGACCCAAAGGGTGGAAGG - Intronic
975484690 4:74922546-74922568 CCAGTCACCCATAGGGTAGGAGG + Intergenic
980496347 4:133590695-133590717 CCAGGAACCCAAAGGATAGGAGG + Intergenic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
991069525 5:62461209-62461231 GCAGGGATGGAAAGGGTGGGAGG + Intronic
993187346 5:84636440-84636462 CCTAACATCCATAGGGTGGGTGG - Intergenic
996168598 5:120259917-120259939 CAAGGTTACCAAAGGGTGGGAGG - Intergenic
997517672 5:134502474-134502496 AGAGGCATGCAAAGGGTGGGTGG - Intergenic
998402035 5:141853179-141853201 CCAGGGAAACAACGGGTGGGTGG - Exonic
1001295534 5:170496192-170496214 CCAGGCACTAAAAGGATGGGTGG + Intronic
1002930377 6:1630387-1630409 CCAGGCAGCCAATGGGCAGGCGG - Intronic
1003298638 6:4856514-4856536 CCAGGCAGCCTGAGGGTGGCAGG + Intronic
1003581857 6:7347483-7347505 ACAGGGATCCAAAGCGAGGGTGG + Intronic
1004168811 6:13279768-13279790 CCCTGCATCCAAAGAGTGGGTGG - Intronic
1005994547 6:30923360-30923382 CCAGGCATCCATCGGGGAGGAGG - Exonic
1010942411 6:81934246-81934268 CCAGACACCCAAGGGGAGGGTGG - Intergenic
1016391617 6:143580726-143580748 CCTGGCCTCCATAGTGTGGGTGG + Intronic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1021470912 7:21001697-21001719 CCAGGCATCCCAAGTGTGCTAGG + Intergenic
1022099017 7:27158126-27158148 CCAGGAATACAAAAGGTGGAGGG + Intergenic
1023159056 7:37279723-37279745 ACAGGGATCCAACGGGAGGGTGG + Intronic
1025939091 7:66060786-66060808 CCAGACATACAAAGGCTGAGAGG + Intergenic
1026593004 7:71712537-71712559 CCAGCCATCAACACGGTGGGAGG + Exonic
1032586099 7:133148066-133148088 CCAGGTATCCAAAGGGATGAGGG - Intergenic
1032878165 7:136059976-136059998 CCAGGCATGCAAAGAGCTGGGGG + Intergenic
1033313960 7:140282629-140282651 CCAGGCTGACAAAGGGTGGGAGG + Intergenic
1034029070 7:147740070-147740092 CCAGGCATCCACAGAGGGGCTGG + Intronic
1037313219 8:17577479-17577501 CCGGGCAGGCAAAGAGTGGGAGG - Intronic
1037745642 8:21642057-21642079 CCTGACATCCAAAGGATGGAGGG - Intergenic
1047718161 8:127614834-127614856 CCAGGCATGGGAAGGGTGGGAGG + Intergenic
1048979311 8:139694631-139694653 CCAGGCATCTGGAGAGTGGGGGG - Intronic
1049780988 8:144428750-144428772 CCAGGCAGCCACGGGGAGGGAGG + Intergenic
1052863435 9:33450850-33450872 CCAGGCCTCTATAGGCTGGGAGG + Intergenic
1057210404 9:93198218-93198240 TCAGGCACCCAAAGGGAGGAGGG - Intronic
1061078987 9:128358844-128358866 CTAGCCTTCCAAAGGGTGAGAGG - Intronic
1061749079 9:132763012-132763034 GCAGGTGTCCAAAGGGTGGTGGG - Intronic
1061813066 9:133174571-133174593 GCAGGCATCCTAAGGGTGGATGG - Intergenic
1062288295 9:135783393-135783415 CCAGGCCTCCAGAGGGAGCGGGG + Intronic
1187237677 X:17483751-17483773 CAAGGCATGCAAGGTGTGGGAGG - Intronic
1189246858 X:39569994-39570016 CCAGGCACCCAAAGGCTCAGAGG - Intergenic
1193343798 X:80382929-80382951 CCAGGAAGCCAAGGGGTCGGGGG - Intronic
1193758064 X:85432961-85432983 TAAGGCATCCACAGGGTGGAAGG - Intergenic
1195721528 X:107873315-107873337 CCAGGAATCCAAAGGACAGGAGG - Intronic
1197953623 X:131923455-131923477 ACAGGCATCCATTGGGAGGGTGG + Intergenic
1198375971 X:136040604-136040626 CCAAACATCCAAAGGTTGGGAGG - Intronic
1200097832 X:153672462-153672484 CCAGGCCTCCCAAAGGTTGGTGG + Intronic
1200115457 X:153767935-153767957 CCAGCCATCCACAGAGAGGGGGG - Intronic