ID: 1152241080

View in Genome Browser
Species Human (GRCh38)
Location 17:79161495-79161517
Sequence GGGCCTCCACACACCCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152241080_1152241086 7 Left 1152241080 17:79161495-79161517 CCCTCGGGGGTGTGTGGAGGCCC 0: 1
1: 0
2: 1
3: 18
4: 193
Right 1152241086 17:79161525-79161547 GGCCTGCCTGCTCTTGCAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 303
1152241080_1152241088 10 Left 1152241080 17:79161495-79161517 CCCTCGGGGGTGTGTGGAGGCCC 0: 1
1: 0
2: 1
3: 18
4: 193
Right 1152241088 17:79161528-79161550 CTGCCTGCTCTTGCAGCTGGTGG 0: 1
1: 0
2: 2
3: 35
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152241080 Original CRISPR GGGCCTCCACACACCCCCGA GGG (reversed) Intronic
900585670 1:3431239-3431261 GGGCCTCCACACACAGGCCAGGG + Intronic
901405140 1:9040219-9040241 CGGCCTCCCCACCACCCCGAAGG + Intronic
902721998 1:18309945-18309967 GGGCCTCCATGCACCCCCCAGGG - Intronic
905119227 1:35668964-35668986 GGGCCTCCACATTCCACGGATGG + Intergenic
907240971 1:53080893-53080915 GGCCCTGTACACACCCCCGTGGG + Intronic
915225159 1:154406176-154406198 GGTCCTCCCCCCACCCCCGCGGG + Intronic
915844802 1:159252249-159252271 GGGCCTCCAGCCACCCCCACTGG + Intergenic
918042753 1:180923158-180923180 AGGCCTCCACAAACACCCAAAGG - Intronic
918701854 1:187616592-187616614 GGTGCTCCACACATCCCAGACGG - Intergenic
919769404 1:201147693-201147715 GTGCCTCCACAGAGCCCCTAGGG + Intronic
920143939 1:203841980-203842002 GGGGCTCCTCACATCCCAGACGG + Intronic
922172193 1:223165271-223165293 GGGTGTCCACACACCCCTGATGG - Intergenic
922751933 1:228074078-228074100 GGGCGACCACACACCTCCAATGG + Exonic
1063217528 10:3938025-3938047 GGGTCGCCACAAACCCCCCAGGG + Intergenic
1065047057 10:21754217-21754239 TGGCCTCCAGAGCCCCCCGAGGG + Intergenic
1067325105 10:45259736-45259758 GGGGCTCCTCACATCCCAGACGG - Intergenic
1075500152 10:122965568-122965590 GGGCCTCCAGCCACCCCTGCTGG + Intronic
1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG + Intronic
1076731528 10:132441359-132441381 GGGCATCCCGACACCCCCAAAGG - Intergenic
1076914358 10:133414504-133414526 GGGGCTCCTCACATCCCAGACGG + Intronic
1077076230 11:703452-703474 AGGCCTCCACAGACCCCCATGGG + Intronic
1077292255 11:1803294-1803316 GGGTCTCCACTCACCCCGGAAGG + Intergenic
1078301945 11:10140410-10140432 AGGCCTCCACAAAACCCCAAAGG + Intronic
1078390399 11:10931488-10931510 CGGCCTCCGCACACTCCCCAGGG - Intergenic
1079603691 11:22341425-22341447 GGCCCTCCTCCCAACCCCGACGG + Intronic
1080983140 11:37431442-37431464 GGTGCTCCTCACATCCCCGATGG + Intergenic
1081627292 11:44663586-44663608 GGGGCTCCTCACATCCCAGATGG - Intergenic
1082258995 11:50063253-50063275 GGGGCTCCTCACATCCCAGACGG + Intergenic
1082870946 11:57943739-57943761 GGGGCTCCTCACATCCCAGACGG + Intergenic
1083773059 11:64878945-64878967 TGGCCCCCCCACACCCCCGCGGG + Intronic
1084972857 11:72781178-72781200 GGGCCTCCCCACACTCCCCATGG - Exonic
1085303687 11:75473351-75473373 GGGCCTCCATCCACCCACGCTGG + Intronic
1085593703 11:77789652-77789674 GGGCCCCAACACATCCCTGATGG + Intronic
1090737084 11:129619346-129619368 GGGCCTCCACTCACTCCGGAGGG + Intergenic
1090780285 11:130001932-130001954 GGGCCACCCCACACCCCTGCGGG + Intronic
1091291971 11:134445664-134445686 GGGACCCCACAACCCCCCGATGG - Intergenic
1091308683 11:134557779-134557801 TGGGCTCCACACACCCCTGCTGG - Intergenic
1091550025 12:1530215-1530237 GGGCCGCGACACCCTCCCGAGGG - Intronic
1095097502 12:38156256-38156278 GGGCCTCCACAAACCCCCCCGGG - Intergenic
1096492132 12:52018746-52018768 GGGCCGCCACCCAGCCCCAAAGG - Intergenic
1099667858 12:85654152-85654174 GGGTCTCCAGCCACCCCCAATGG - Intergenic
1101873887 12:108586353-108586375 GGGCCACCTCACAACCCAGAGGG + Intergenic
1103045478 12:117731482-117731504 GGGCCTCCTCACTTCCCAGATGG - Intronic
1104182208 12:126393185-126393207 GGGCCTTCACCCACCTCTGATGG + Intergenic
1106114552 13:26806218-26806240 GGGGCTCCACACTTCCCAGAAGG + Intergenic
1108330144 13:49377815-49377837 GGGGCTCCTCACATCCCAGACGG - Intronic
1111843037 13:93473501-93473523 GGGCCTTCCCAGACCCCTGAGGG + Intronic
1112369433 13:98782025-98782047 GGGCCACCACACACCTCCTTGGG - Intergenic
1113568899 13:111339417-111339439 TATCCTCCACACACTCCCGAGGG + Intronic
1118423463 14:65633442-65633464 GGGGCTCCTCACATCCCAGACGG - Intronic
1119051769 14:71377119-71377141 GGGCCCCCCCACCCCCCAGATGG + Intronic
1122212253 14:100180865-100180887 GGGTCTCCTCACATCCCAGACGG - Intergenic
1122672895 14:103385631-103385653 GGGCCTCCACACAGCGCCGCCGG - Exonic
1122770403 14:104095236-104095258 GGGCCTCTGCACACTCCCCAAGG - Intronic
1122824312 14:104362246-104362268 GGGCCACCACACGCCCTGGATGG - Intergenic
1202917573 14_GL000194v1_random:190635-190657 GGGGCTCCTCACATCCCAGACGG - Intergenic
1128379124 15:67098747-67098769 AGGCCTCCACAGCCCCCGGAAGG + Intronic
1130088391 15:80797743-80797765 GGTCCTCCACACACCCACGGTGG + Intronic
1132556997 16:576927-576949 AGGCCTCCACAGAGGCCCGAGGG - Intronic
1132601088 16:773315-773337 TGGACCCCACACACCCCCCAGGG - Intronic
1133787103 16:8982091-8982113 GGGGCTCCTCACATCCCAGACGG - Intergenic
1138307295 16:55989291-55989313 GGCGCTCCTCACACCCCAGACGG - Intergenic
1138389046 16:56657309-56657331 GGGTCTCCCCACAGCCTCGACGG - Intronic
1141130300 16:81431949-81431971 GGGCCTCCATTCAGCCCCCAGGG - Intergenic
1141598150 16:85109953-85109975 GGGGCTCCATGAACCCCCGAAGG - Intronic
1142069384 16:88082663-88082685 GGGCCTCCCCACACCCTGGTGGG + Intronic
1142234980 16:88917912-88917934 GTCCCTCCACGCACCCCGGAGGG - Intronic
1142256749 16:89017556-89017578 AGGCCTTCACCCTCCCCCGAAGG - Intergenic
1142256773 16:89017626-89017648 GGGCATTCACCCTCCCCCGAAGG - Intergenic
1142549846 17:732147-732169 GGGCCTCGCCCCACCCCGGAGGG + Intergenic
1144536296 17:16095027-16095049 GGGGCTCCTCACATCCCAGACGG - Intronic
1145418088 17:22741165-22741187 GGGGCTCCTCACATCCCAGAAGG - Intergenic
1151723177 17:75869825-75869847 TGGCCTCCCCACACCCCAGGAGG - Intergenic
1151729826 17:75904690-75904712 GGGCCGCCGGACACCCCCGCTGG - Exonic
1152241080 17:79161495-79161517 GGGCCTCCACACACCCCCGAGGG - Intronic
1155091377 18:22514921-22514943 GGGCCTCCAGCCACCCCTGCTGG - Intergenic
1157778971 18:50420672-50420694 GGGTCTCCACCCACCCCTGCCGG - Intergenic
1160778977 19:869406-869428 GGTCCCCCACCCACCACCGAGGG - Intronic
1160823133 19:1067487-1067509 CGGGCTCCACTCACCCCCGAGGG - Intronic
1160966852 19:1750472-1750494 GGGCCTCCACCCATGCCCCAGGG - Intergenic
1161237327 19:3204475-3204497 GGGCCTCCCAGAACCCCCGAGGG - Intronic
1161342849 19:3752465-3752487 GGGCCCCCACACTCCCAGGAAGG - Intronic
1164231188 19:23290072-23290094 GGGGCTCCTCACTTCCCCGACGG + Intergenic
1164679469 19:30124088-30124110 GCGCCTCCCCACACCCCCGCTGG - Intergenic
1164880425 19:31728132-31728154 GGGCCTCCAAACACCCCACCTGG - Intergenic
1167409557 19:49336982-49337004 GGGCCCCCACACAACCCAGGAGG - Exonic
926252815 2:11165436-11165458 GGGGCTCCTCACATCCCAGACGG + Intronic
929083016 2:38139568-38139590 TGGCCTCCACCCAGCCCTGATGG - Intergenic
930011446 2:46941140-46941162 AGGCCTCCCCACGCCCCCGCGGG + Intronic
930208854 2:48614813-48614835 GGCCCTCCTCACATCCCAGACGG + Intronic
930585993 2:53267790-53267812 GGGCCTCCAGCCACCCCTGCCGG + Intergenic
930744756 2:54870797-54870819 GGGCCTCCACAGACCTCTGTAGG + Intronic
932570073 2:72933958-72933980 GGGCAACCACAAACCCACGAGGG + Exonic
932903451 2:75725234-75725256 GGCGCTCCTCACACCCCAGACGG - Intergenic
933022215 2:77208161-77208183 GAGCCACCACGCACCCCCCAAGG + Intronic
934623320 2:95829662-95829684 GGGCCTCCAGCCACCCCCACTGG - Intergenic
934623954 2:95833150-95833172 GGGCCTCCAGCCACCCCCACCGG - Intergenic
934624356 2:95834815-95834837 TGGCCTCCAGCCACCCCCGCTGG - Intergenic
934624480 2:95835330-95835352 GGGCCTCCAGCCACCCCCGCTGG + Intergenic
934750276 2:96789427-96789449 AGGCCTCCAGAAACCCCGGAGGG - Intronic
934809151 2:97266295-97266317 GGGCCTCCAGCCACCCCCGCTGG - Intergenic
934809303 2:97266901-97266923 GGGCCTCCAGCCACCCCCTCCGG + Intergenic
934809382 2:97267209-97267231 GGGCCTCCAGCCACCCCCGCCGG + Intergenic
934810439 2:97272429-97272451 GGGCCTCCAACCACCCCCACTGG + Intergenic
934827253 2:97435510-97435532 GGGCCTCCAACCACCCCCACTGG - Intergenic
934828068 2:97489743-97489765 GGGCCTCCAGCCACCCCCGCCGG - Intergenic
934828198 2:97490257-97490279 TGGCCTCCAGCCACCCCCGCTGG - Intergenic
934828354 2:97490874-97490896 GGGCCTCCAGCCACCCCCGCTGG + Intergenic
934946668 2:98547415-98547437 GGGCATCCACCCAGCCCCCAGGG + Intronic
938253356 2:129833443-129833465 GGGGCTCCTCACATCCCAGACGG - Intergenic
938573679 2:132584993-132585015 GGCCCACCACACAGCCCTGATGG - Intronic
939318655 2:140586481-140586503 GGGCTTCCACACACCCCTGATGG + Intronic
942355616 2:175108185-175108207 GGGGCTCCTCACATCCCAGACGG - Intronic
942630101 2:177945475-177945497 AGGCCTCCTCACATCCCAGATGG - Intronic
943578037 2:189653629-189653651 GGGGCTCCTCACATCCCAGATGG - Intergenic
947667936 2:231918828-231918850 GGGCCCCCACACACGCCTGGAGG - Intergenic
947800765 2:232927706-232927728 GGGGCTCAACACCCACCCGATGG + Intronic
948636123 2:239338859-239338881 GGGCCTCCAGGCTCCCCCCAAGG + Intronic
1169354929 20:4898162-4898184 GGGTCTCCTCAAACCCCCCAGGG - Intronic
1170202486 20:13760410-13760432 GGCGCTCCTCACACCCCAGACGG - Intronic
1171404044 20:24897849-24897871 AAGCCTCCACAAACCCCAGAAGG - Intergenic
1174179534 20:48666157-48666179 GAGCCTCCCCAAACCCCCGGGGG + Intronic
1174336832 20:49868408-49868430 GGGCGTCCACACACCACACAGGG - Intronic
1175166656 20:57048873-57048895 GGGCTCCCACACACCCCCTCTGG + Intergenic
1175482677 20:59322474-59322496 CACCCTCCACCCACCCCCGAAGG - Intronic
1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG + Intergenic
1175681588 20:60993008-60993030 GGGCCTCCTCACCTCCCAGAGGG + Intergenic
1175704089 20:61162963-61162985 GGGTCTCCTCCCACCCACGATGG - Intergenic
1175756896 20:61535792-61535814 GGGCCCCCACACTCTCCCCATGG - Intronic
1175915225 20:62422927-62422949 GGGCCTCCAGCCACCCTCGGAGG + Intronic
1175966787 20:62663980-62664002 GAGCCTCCATTCACCCCCCAGGG + Intronic
1176117565 20:63439739-63439761 GGGCCTGCTCACACCCCTGAGGG + Intronic
1178303383 21:31470918-31470940 CAGCCGCCACCCACCCCCGAGGG + Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180739361 22:18041959-18041981 GGGGCTCCTCACATCCCAGACGG + Intergenic
1181744821 22:24948689-24948711 GTGCCTCCAGACAGCCCCAAGGG - Intergenic
1183776774 22:39971307-39971329 TGCCTTCCACACACCCCTGAGGG - Exonic
1184225686 22:43127837-43127859 GGGCCTCCACCCACCGCCCAGGG - Intronic
1184482097 22:44753681-44753703 GGGCCTTCACACTCCTCCCAAGG - Intronic
951264247 3:20548150-20548172 GGTGCTCCACACATCCCAGATGG + Intergenic
953800411 3:46018537-46018559 GGGCCACTACTCACCACCGATGG - Exonic
958606484 3:96364620-96364642 GAGCCTGCACACACCTCCAAAGG + Intergenic
958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG + Intronic
966617285 3:181926242-181926264 GGGGCTCCTCACATCCCAGACGG + Intergenic
968624132 4:1618871-1618893 AGGCCTCCACGGCCCCCCGAGGG + Intronic
972552719 4:40148022-40148044 GGGGCTCCTCACATCCCAGACGG + Intronic
972939715 4:44181865-44181887 GGGGCTCCTCACATCCCAGACGG - Intronic
974597938 4:64037526-64037548 GGGCCCCCCCACCCCCCAGACGG - Intergenic
975865821 4:78722672-78722694 GGGCCTCCAGTCACTCCAGAAGG - Intergenic
982289477 4:153765414-153765436 GGGCCTCCCCACACAACCTAGGG - Intergenic
982723571 4:158882444-158882466 GGGGCTCCTCACTCCCCAGAAGG - Intronic
993934797 5:93986428-93986450 GGGCCCCCCCACCCCCCAGATGG - Intronic
994277379 5:97855250-97855272 TGGCCTCCAGACACCCCCACTGG + Intergenic
995988028 5:118203614-118203636 GGGCTTCCACTCACCCCTGCTGG - Intergenic
996425884 5:123313166-123313188 GGGCCTCCACGCACCCCTACTGG - Intergenic
996425978 5:123313674-123313696 GGACCTCCATACACGCCCCAAGG - Intergenic
999050988 5:148523748-148523770 GGAGCTCCACACACACCAGAAGG + Intronic
999455682 5:151714226-151714248 GGTGCTCCTCACACCCCAGACGG + Intergenic
1001597058 5:172905149-172905171 GGGCCTCCGCACAGCACTGAGGG - Intronic
1006225349 6:32532238-32532260 GGGGCTCCTCACATCCCAGACGG - Intergenic
1006373450 6:33659153-33659175 GGACGTCCACACACCCCTGGTGG + Intronic
1006403907 6:33833081-33833103 GGGGCTCCTCACATCCCAGATGG + Intergenic
1007368246 6:41409333-41409355 GGCCCGCCACTCGCCCCCGAGGG + Intergenic
1011297157 6:85838372-85838394 GGGGCTCCTCACATCCCAGACGG - Intergenic
1014463704 6:121729899-121729921 GGGTCTCCTCACATCCCAGATGG + Intergenic
1017618893 6:156274490-156274512 GGGCCTCAGCACCCCCACGATGG - Intergenic
1019610804 7:1935824-1935846 GAGCCTGCAGACACCCCCAAGGG + Intronic
1023867456 7:44244977-44244999 GGGCCTCCACCCACTCACGTTGG - Intronic
1025852748 7:65257816-65257838 GGGGCTCCTCACATCCCAGACGG - Intergenic
1025966732 7:66280047-66280069 GGGCCACCACACCCCCAGGAGGG - Intronic
1026007999 7:66614687-66614709 GGGGCTCCTCACATCCCAGACGG - Intergenic
1026360764 7:69599383-69599405 GGGGCTCCCCACAGCACCGAGGG - Exonic
1029121352 7:98270434-98270456 GGGCCTCCCAACGCCCCCGATGG + Intronic
1029813137 7:103069120-103069142 GGGCCTCCTCACTTCCCAGAGGG - Intronic
1033339122 7:140478707-140478729 GGGCCTAGACACCCCGCCGAGGG - Intronic
1034922678 7:155096893-155096915 GGGGCTCCTCACATCCCAGACGG + Intergenic
1034967281 7:155399125-155399147 AGGCCTCCACTCACCACCCAGGG + Intergenic
1034984012 7:155496453-155496475 GGACTTCCCCACACCCTCGATGG - Intronic
1039804966 8:40989891-40989913 GGACCTACCCACACCCCCGGAGG + Intergenic
1040043586 8:42940016-42940038 GGGGCTCCTCACATCCCAGACGG + Intronic
1040052907 8:43033430-43033452 GGGGCTCCTCACATCCCAGACGG + Intronic
1040121406 8:43688173-43688195 GGGGCTCCTCACATCCCAGATGG + Intergenic
1041287041 8:56272399-56272421 GGGGCTCCTCACATCCCAGATGG + Intergenic
1043301878 8:78744275-78744297 GGGCCTCCAGCCATCCCCGCTGG - Intronic
1049202768 8:141349992-141350014 GGTCCTCCACTCACCCCCACGGG - Intergenic
1052626364 9:30981550-30981572 GGGCCTCCAGTCACCCCTGTTGG + Intergenic
1055298001 9:74853223-74853245 GGGGCTCCTCACTTCCCCGATGG - Intronic
1057040337 9:91843325-91843347 GGCCCTCCACGCTCCCCCGTGGG + Intronic
1057155182 9:92831992-92832014 GGGGCTCCTCACATCCCAGACGG + Intergenic
1057553222 9:96067255-96067277 CGGCCTCCACACAGCCTCCAAGG + Intergenic
1057852656 9:98577251-98577273 GGGCCACCACTCACCCCTGGTGG + Intronic
1059234781 9:112751739-112751761 GGGGCTCCATTCACCTCCGACGG + Intronic
1060080193 9:120636843-120636865 GGGCCCCCCCACCCCCCAGACGG - Intronic
1061479057 9:130887534-130887556 GAGCCACCACAGGCCCCCGAGGG - Intronic
1062165637 9:135105976-135105998 GGAGCCCCCCACACCCCCGAGGG - Intronic
1189301400 X:39955088-39955110 GGGCCTTGTCACACCCCCCAAGG + Intergenic
1189882180 X:45504301-45504323 GGGGCTCCTCACATCCCAGATGG + Intergenic
1190171481 X:48115297-48115319 GGTGCTCCACACATCCCAGACGG - Intergenic
1190184504 X:48222404-48222426 GGGTCTCCTCACATCCCAGACGG - Intronic
1192213348 X:69141566-69141588 TGGATTCCATACACCCCCGATGG + Intergenic
1192500224 X:71645441-71645463 GGGGCTCCTCACATCCCAGACGG + Intergenic
1193052005 X:77111625-77111647 GGGCCTCCAGCCACCCCTGCCGG + Intergenic
1193301307 X:79891970-79891992 GGGCCTCCAGCCACCCCTGCTGG + Intergenic
1195346271 X:103953741-103953763 GGGCCTCCAGCCACCCCTGTTGG + Intronic
1195473605 X:105260336-105260358 GGGCCTCCAGCCACCCCTGTTGG - Intronic
1198398898 X:136251136-136251158 GGTCCTCCCCTCACCCCCGCCGG - Intronic
1199307119 X:146279683-146279705 GGGCCTCCACCTACCCCCACTGG - Intergenic
1199478729 X:148274212-148274234 GGGCCTCCAGCCACCCCCACTGG + Intergenic
1199782335 X:151073943-151073965 GGGGCTCCTCACATCCCAGATGG + Intergenic
1200002220 X:153067918-153067940 GGGACTCCTCTCATCCCCGAGGG - Intergenic
1200005513 X:153082107-153082129 GGGACTCCTCTCATCCCCGAGGG + Intergenic
1200208822 X:154336468-154336490 GGGCCCCCACCCACCCCTGCAGG - Intergenic
1200222056 X:154395666-154395688 GGGCCCCCACCCACCCCTGCAGG + Intronic