ID: 1152242534

View in Genome Browser
Species Human (GRCh38)
Location 17:79167927-79167949
Sequence GACAAAGATGGGCCTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152242524_1152242534 11 Left 1152242524 17:79167893-79167915 CCAAAGGCTCTATGGATTTCCGA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1152242534 17:79167927-79167949 GACAAAGATGGGCCTCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
1152242531_1152242534 -8 Left 1152242531 17:79167912-79167934 CCGAGGAGGGGGCAGGACAAAGA 0: 1
1: 0
2: 3
3: 38
4: 378
Right 1152242534 17:79167927-79167949 GACAAAGATGGGCCTCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
1152242523_1152242534 14 Left 1152242523 17:79167890-79167912 CCTCCAAAGGCTCTATGGATTTC 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1152242534 17:79167927-79167949 GACAAAGATGGGCCTCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152242534 Original CRISPR GACAAAGATGGGCCTCCCCC AGG Intronic
900181228 1:1311870-1311892 GCTGAAGAAGGGCCTCCCCCAGG - Exonic
900422262 1:2560724-2560746 CACAGAGCTGGGCCTCCCCCGGG - Intronic
900478987 1:2889296-2889318 GACACAGAAGAGCCACCCCCAGG + Intergenic
900685806 1:3946827-3946849 GACAAAGCTCAGCCTCCCACTGG - Intergenic
902711477 1:18242987-18243009 GAGTCAGATGGGCCACCCCCAGG - Intronic
903044517 1:20554729-20554751 GACCAAGATGGGGCTCCCAAAGG + Exonic
904005469 1:27361030-27361052 GACCAAGATGCCCCTCCCGCGGG - Intronic
904599802 1:31667176-31667198 GACAAAGCTGAGACTCACCCAGG - Intronic
906253904 1:44332768-44332790 CATAAGGATGGGCCTCCGCCTGG - Intronic
906523957 1:46483778-46483800 GACAGAGCTGGGCCTCGCCTCGG + Intergenic
907268706 1:53277859-53277881 GACAAAGGAGGGACACCCCCAGG - Intronic
913172941 1:116248726-116248748 GACAAATATGGGCATCTTCCTGG - Intergenic
915712697 1:157916600-157916622 GAGTAAGCAGGGCCTCCCCCAGG - Intergenic
918186892 1:182135588-182135610 GCTAAAGTTGGGTCTCCCCCTGG - Intergenic
919578070 1:199336893-199336915 GCCAAAGATAGCCATCCCCCTGG + Intergenic
922211276 1:223488661-223488683 AACAAAGATTGACCTCTCCCGGG + Intergenic
1066136254 10:32449553-32449575 GACAAACAGGGGACACCCCCAGG - Intronic
1067787812 10:49263576-49263598 GATAAAAATGGGCCTCAGCCTGG + Intergenic
1071518092 10:86312522-86312544 GTCTAAGATGGGCCTCTCCATGG - Intronic
1073327071 10:102649356-102649378 GGGAAAGATGGGCTTCCCCTTGG + Intronic
1073740359 10:106399409-106399431 GAGAAAGAGGGGGTTCCCCCAGG + Intergenic
1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG + Intergenic
1083274847 11:61591053-61591075 GAGAGGGATGGGCCTTCCCCAGG - Intergenic
1084425698 11:69083579-69083601 GGCAGAGAAGGGCCTCCCACAGG + Intronic
1090659428 11:128871106-128871128 GAGAAACATGTGTCTCCCCCAGG + Intergenic
1092905892 12:13100682-13100704 GACAAAGATGGTCTTCACACGGG + Intronic
1095514275 12:42989082-42989104 GACACATCTGGGCCTCACCCAGG - Intergenic
1101445099 12:104731913-104731935 GAGACAGATGAGCCTGCCCCAGG + Intronic
1103343800 12:120235867-120235889 GTGCAAGATGGGCCTGCCCCGGG + Intronic
1104036065 12:125097763-125097785 TACTGAGATGGGGCTCCCCCTGG - Intronic
1105928393 13:25029549-25029571 GAGAAATATGGGCCTCCCATTGG - Intergenic
1105942502 13:25161536-25161558 GAGAAATATGGGCCTCCCATTGG + Intergenic
1108262987 13:48677016-48677038 GACAAAGATGGGGCTCCAGTGGG + Intronic
1112354507 13:98662551-98662573 TGCAAAGAGGGGGCTCCCCCTGG + Intergenic
1113665078 13:112135881-112135903 CAGGAAGCTGGGCCTCCCCCTGG + Intergenic
1113812537 13:113151285-113151307 AACAGAGCTGGGCCTCCCTCAGG - Intergenic
1115556725 14:34550076-34550098 GACAAAGATGGGCTAACACCTGG - Intergenic
1118163784 14:63316382-63316404 GACTGGGATGGACCTCCCCCTGG - Intronic
1127643392 15:60936190-60936212 TACTAAGAAGGGCTTCCCCCAGG - Intronic
1127811455 15:62568803-62568825 GACACAGCTGGGCATCCTCCAGG - Intronic
1129264484 15:74386572-74386594 GAGAAGGAGGGGCCTCCCCAGGG + Intergenic
1130096432 15:80859593-80859615 GGCAATGATGGGCCTACCCTGGG + Intronic
1130139876 15:81216144-81216166 GCCACAGATGGTCATCCCCCAGG - Intronic
1132094291 15:98970618-98970640 TATGAAGATGGGCCTCCCCTAGG + Intronic
1132270121 15:100516839-100516861 TCCAAAGATGGGCCTCACCTGGG + Intronic
1132901173 16:2255291-2255313 GAAAAAGGTGGGCCTGCACCTGG + Intronic
1133427877 16:5708762-5708784 GAGAAAAATGGCCCTCTCCCAGG - Intergenic
1135823742 16:25707758-25707780 GTCAAACATGGCCCTGCCCCAGG + Intronic
1138060905 16:53889363-53889385 GGAAATGAAGGGCCTCCCCCAGG + Intronic
1139410031 16:66751607-66751629 CACAAAGAGGGCCCTCCCCCGGG + Exonic
1139473800 16:67192428-67192450 GACCCAGCTGGGCCGCCCCCGGG - Intronic
1140284322 16:73587137-73587159 AACAGAGTTGGGCCTCTCCCAGG - Intergenic
1141851080 16:86646493-86646515 GACAAAGCTGTGCCCCTCCCAGG - Intergenic
1143727915 17:8862560-8862582 GAGAAAGATCAGCCACCCCCAGG - Intronic
1143865059 17:9917467-9917489 CCCTCAGATGGGCCTCCCCCTGG - Intronic
1146644498 17:34568134-34568156 GATAAACATGGGGCTCCCCTTGG - Intergenic
1148437633 17:47695515-47695537 GAAAAGGAAGCGCCTCCCCCGGG - Exonic
1151443502 17:74148674-74148696 GTCAAAGATGGGCCACCCACAGG + Intergenic
1151976044 17:77483980-77484002 GACAAAGCTGGGATTCTCCCCGG - Intronic
1152242534 17:79167927-79167949 GACAAAGATGGGCCTCCCCCAGG + Intronic
1155220807 18:23683986-23684008 ACCACAGATGGGCCTCACCCAGG + Intergenic
1156746816 18:40402346-40402368 GAAAAAGAAGTGACTCCCCCAGG - Intergenic
1157210518 18:45738197-45738219 GCCAAAGCTGGGGCTCCCTCTGG + Intronic
1157865246 18:51177387-51177409 AACAAAAATGGGCCTGCCCTGGG - Exonic
1158839020 18:61363873-61363895 GAGATAGATGATCCTCCCCCGGG + Intronic
1161035876 19:2084065-2084087 GACAAAGATAAGCCTCAGCCAGG - Intronic
1166047019 19:40235703-40235725 GTCAAGGATGGGCCTGCCCTGGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
932613200 2:73214603-73214625 GCCACAGAAGGGCCTCCCGCGGG - Intronic
938071876 2:128312663-128312685 TACATAGATGGGCCACCCCAAGG + Intronic
938376203 2:130808329-130808351 GAGGAGGATGGGCCTCCCCAGGG + Intergenic
941759577 2:169226732-169226754 GACAAGCATGGGCCTTTCCCAGG + Intronic
942412421 2:175724794-175724816 GACAAAGTAGGGCTTCTCCCAGG + Intergenic
942789297 2:179740406-179740428 GACAAAAAGATGCCTCCCCCAGG - Intronic
946177224 2:217929189-217929211 CACCCAGATGGGCCTACCCCAGG + Intronic
946178689 2:217937388-217937410 GGCAGAGATGGGCCAGCCCCAGG - Intronic
948988989 2:241542219-241542241 GACAGAGCTGGGCGTCCCCTTGG - Intergenic
1172838234 20:37886639-37886661 GGAAAGGATGGGGCTCCCCCCGG + Intergenic
1175149405 20:56921369-56921391 CTCAAAGATGGGTCTCCCACAGG + Intergenic
1175685453 20:61024817-61024839 GGCAAAGAGGAGCCTCCCCGAGG - Intergenic
1176978934 21:15356643-15356665 GATGAAGATGGGCCTTCCCTTGG + Intergenic
1178334774 21:31732959-31732981 GAGAAAGATGCGCCTCCGACAGG + Intergenic
1179958314 21:44753452-44753474 GACAGAACCGGGCCTCCCCCAGG - Intergenic
1183166061 22:36148308-36148330 GACAAAAAGGGGCTTCCACCTGG + Intronic
949876712 3:8630889-8630911 CGCAAAGAGGCGCCTCCCCCAGG - Exonic
950572731 3:13811940-13811962 GACACACACGGGCCACCCCCAGG - Intergenic
951400850 3:22230094-22230116 GACAACGATGAGCCTCCCAGAGG + Intronic
953743459 3:45555944-45555966 GACAAACAAGGGCCTCCCAGAGG + Intronic
961555024 3:127691489-127691511 GACCAACCTGAGCCTCCCCCTGG + Exonic
966898970 3:184466716-184466738 GACAAAGCTTGGCCGGCCCCAGG - Intronic
968385834 4:136546-136568 GAAAAAGCAGGGCCTCACCCAGG - Intronic
971480320 4:27109035-27109057 GACAAAACTGGGTCTCTCCCTGG + Intergenic
974697717 4:65397228-65397250 GAGAAAGGTGGACCTCCTCCTGG + Intronic
978708115 4:111741636-111741658 GTCTTAGCTGGGCCTCCCCCAGG + Intergenic
979529287 4:121751683-121751705 GTTAAAGATGGGCCTGCACCTGG - Intergenic
997589795 5:135065668-135065690 GCCAAAGATGGGCTTCCCGAAGG + Intronic
1002043782 5:176531149-176531171 GACAGGGATGGGCCTTCCACAGG - Intronic
1002772823 6:304106-304128 CAGAAAGATGGGCCTTCACCTGG + Intronic
1003519703 6:6847839-6847861 GACCAAAGTGGGCCTCCTCCTGG + Intergenic
1011149644 6:84256391-84256413 GATAGAGATGGTCCTTCCCCTGG + Intergenic
1015585261 6:134769843-134769865 AACAAAGATGTGCATCCACCAGG - Intergenic
1016003877 6:139069770-139069792 GAGAAAAATGGACCTCCACCCGG - Intergenic
1016042488 6:139445618-139445640 GACAAAAACTGGCCTCACCCAGG + Intergenic
1017431067 6:154371252-154371274 TGCAAGGATGGGCCTGCCCCTGG - Intronic
1019266232 7:118931-118953 GACAAAGAAGGGCCGACCTCTGG + Intergenic
1019560124 7:1651699-1651721 CCCAAAGCTGGGCCTACCCCAGG - Intergenic
1022408698 7:30118821-30118843 GAGAAAGATGGGCCTCAGACGGG - Intronic
1029172922 7:98643566-98643588 GGCAAGGAAGGGACTCCCCCAGG + Intergenic
1031388750 7:121186973-121186995 GCCAAACCTGGGCCTGCCCCTGG + Intronic
1034400067 7:150856393-150856415 GGCAGAGATGGGCTTCCCTCAGG - Intronic
1036764278 8:11537352-11537374 GGCAAAGCTGGGACTCACCCTGG - Intronic
1039885091 8:41650030-41650052 GACGAGGAGGGGCCTCCTCCCGG - Intronic
1039905680 8:41784906-41784928 CCAAAAGATGGGCCTTCCCCAGG + Intronic
1045239798 8:100389509-100389531 TACAAAGATGTGCCTGGCCCAGG - Intronic
1048283600 8:133123645-133123667 GACACAGATGGGGCTCTTCCTGG - Intronic
1052378363 9:27742381-27742403 AGCAAAGATGTCCCTCCCCCTGG + Intergenic
1053022108 9:34701811-34701833 GACAAACACGGGCCTTCCCCCGG - Intergenic
1055287560 9:74745665-74745687 GACAAGCATGGACCTGCCCCAGG - Intronic
1056831773 9:89923159-89923181 GAAAAAAATGGGCCTCAACCTGG + Intergenic
1060287082 9:122263397-122263419 GACAAAAATGTGTCTCCCCTGGG - Intronic
1060821737 9:126665279-126665301 GCCATTGTTGGGCCTCCCCCTGG + Intronic
1062211357 9:135366014-135366036 CACAAGGATGGCCCTCCTCCAGG + Intergenic