ID: 1152244139

View in Genome Browser
Species Human (GRCh38)
Location 17:79176462-79176484
Sequence AAGGAGACCCAGTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152244139_1152244146 1 Left 1152244139 17:79176462-79176484 CCCAGCCCCAACTGGGTCTCCTT 0: 1
1: 0
2: 0
3: 17
4: 239
Right 1152244146 17:79176486-79176508 CAGAGCCGAACTCGCTGCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1152244139_1152244147 4 Left 1152244139 17:79176462-79176484 CCCAGCCCCAACTGGGTCTCCTT 0: 1
1: 0
2: 0
3: 17
4: 239
Right 1152244147 17:79176489-79176511 AGCCGAACTCGCTGCCCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 51
1152244139_1152244153 21 Left 1152244139 17:79176462-79176484 CCCAGCCCCAACTGGGTCTCCTT 0: 1
1: 0
2: 0
3: 17
4: 239
Right 1152244153 17:79176506-79176528 CGGAGGGACTGTGAAACCAATGG 0: 1
1: 0
2: 0
3: 8
4: 147
1152244139_1152244148 5 Left 1152244139 17:79176462-79176484 CCCAGCCCCAACTGGGTCTCCTT 0: 1
1: 0
2: 0
3: 17
4: 239
Right 1152244148 17:79176490-79176512 GCCGAACTCGCTGCCCCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152244139 Original CRISPR AAGGAGACCCAGTTGGGGCT GGG (reversed) Intronic
901038872 1:6352283-6352305 AAGGAATCCCAGCTGAGGCTGGG - Intronic
903173123 1:21565719-21565741 ACGGAGAGGCAGGTGGGGCTGGG - Intronic
903236938 1:21956433-21956455 GAGGAGAGCCGGTTGGGGGTGGG - Intergenic
903411880 1:23151337-23151359 TAGAAGACCCAGTTATGGCTGGG - Intronic
903996468 1:27307999-27308021 AAGGGGACCCAGCTGGTCCTTGG - Exonic
904009355 1:27381045-27381067 AGGGAGACCCAGTTCAGGCTGGG - Intronic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
905226574 1:36482825-36482847 AAGGAGGCCAAGCAGGGGCTGGG - Exonic
906524769 1:46487707-46487729 GGGGAGCCCCAGTTGGGGATGGG + Intergenic
906803040 1:48754252-48754274 ATAGAGACCCAGTTGGGGGAGGG - Intronic
909500337 1:76328046-76328068 AAGAAGAGGCAGTTGAGGCTAGG + Intronic
910476732 1:87615548-87615570 CAGGAGAACCACTTGAGGCTAGG - Intergenic
911295280 1:96107314-96107336 AAGAAGAGCCAGGTAGGGCTGGG - Intergenic
911660822 1:100499450-100499472 AAGAAAACCCAGTTGTGACTTGG - Exonic
912420437 1:109539098-109539120 AAGGAGACAGAGTGGGGGCCAGG - Intergenic
912713037 1:111963087-111963109 TTGGAGACCCAGCTGGGGATGGG - Intronic
912738976 1:112175773-112175795 AAGGAGTCACAGTAGGGGCTGGG - Intergenic
913322498 1:117598861-117598883 GAGGAGAGCTAGTTGGGGCAAGG - Intergenic
913366534 1:118045821-118045843 TAGGACACCCAGTTGGTGTTCGG + Intronic
916319953 1:163492598-163492620 AAGGAGACCAACCTGGTGCTTGG - Intergenic
919075365 1:192807290-192807312 CAGGAGACCCAGTTAGAGCCTGG - Intergenic
919220680 1:194624916-194624938 ATGGAGCCCCAGTGGGGGCGGGG + Intergenic
920366217 1:205449712-205449734 AAGGAGAACCAGAGGGGGTTGGG - Intronic
922535607 1:226378550-226378572 AAGAAAAGCCAGCTGGGGCTGGG + Intronic
923002969 1:230022852-230022874 AAGGAGACCAAGTGGGGGGCTGG + Intergenic
923820727 1:237437345-237437367 AAATAGACCCAGATGTGGCTGGG - Intronic
924805645 1:247359383-247359405 TAGGAGACCCTGGTGGGGGTAGG + Intergenic
1063107764 10:3008416-3008438 AAGGCGACCCAGCTGGTCCTTGG - Intergenic
1064891073 10:20174519-20174541 AAGCAAACCCTTTTGGGGCTAGG - Intronic
1066352224 10:34646756-34646778 AAGGAGAATCACTTGGGGCAGGG - Intronic
1067221157 10:44345371-44345393 AAGGAGACACAGGAGAGGCTTGG + Intergenic
1071366303 10:84903908-84903930 CAGGTGACCCACCTGGGGCTGGG + Intergenic
1073036362 10:100566747-100566769 AAGGGGGCCCATTTGGGGATTGG + Intergenic
1073272615 10:102278370-102278392 CAGGAGGACCAGTTGAGGCTGGG - Intronic
1073382154 10:103086921-103086943 AAGGAAACCCAGCAGGGCCTGGG + Exonic
1073796911 10:106998430-106998452 AAGGAGACCTAGGTAGGGGTGGG + Intronic
1074491414 10:113942536-113942558 AGGGAGACCTAGTTGAGACTGGG - Intergenic
1074538773 10:114347566-114347588 AAGGAGACTCACTTGAGTCTGGG - Intronic
1074887852 10:117708589-117708611 CATGAGCCCCAGTGGGGGCTGGG - Intergenic
1076193482 10:128499032-128499054 AAGGAGTCCCAGGGGAGGCTGGG + Intergenic
1076453589 10:130574117-130574139 AAGGGAACCCACGTGGGGCTTGG - Intergenic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1077253521 11:1571115-1571137 GGGGTGACCCTGTTGGGGCTGGG + Intronic
1077641342 11:3884521-3884543 ATGGAGAACCACTTGGGGCATGG - Intronic
1079100623 11:17539355-17539377 GAGCAGACCCAGTTGGGGAAGGG - Intronic
1080795840 11:35562431-35562453 ATGGAGACTGAGTAGGGGCTGGG + Intergenic
1081759770 11:45569017-45569039 AAGGACACAAGGTTGGGGCTGGG + Intergenic
1082120084 11:48370689-48370711 AAGAAGAATCAGTAGGGGCTGGG - Intergenic
1082760448 11:57122005-57122027 TAGGACACCCAGTTGGTGTTGGG + Intergenic
1083605451 11:63975962-63975984 AAGGAGAGACAGCTGGGGTTAGG - Intronic
1083803504 11:65059964-65059986 ACGGAGAGCCAGGAGGGGCTGGG + Intergenic
1083995882 11:66272061-66272083 TCGGAGACCCAGCTGGGGCAGGG + Intronic
1084438239 11:69156383-69156405 AAGGGGCCCCAGTTGGAGCTAGG - Intergenic
1084675506 11:70631594-70631616 AAGGTGACCCAGAGGGCGCTGGG + Intronic
1085909632 11:80806646-80806668 GAGGAGACTCACTTGAGGCTAGG + Intergenic
1086038108 11:82441507-82441529 AAAGAGAGCCACTGGGGGCTTGG + Intergenic
1086960551 11:92975916-92975938 AAGGTTACCCAGTTTGGTCTTGG - Intronic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1092151338 12:6251023-6251045 AAGGAGATCCAGTTGGGGTAGGG - Intergenic
1097166233 12:57087942-57087964 AATGCGAACCAGATGGGGCTAGG + Intronic
1097778448 12:63675211-63675233 GGGGAGACCAGGTTGGGGCTGGG - Intergenic
1101463853 12:104926786-104926808 AAGAAGACCCAGTGTTGGCTGGG + Intronic
1101614863 12:106326326-106326348 AAGGAGACTCAGGTGGGCCATGG + Intronic
1103925818 12:124422932-124422954 AAGCAGACCCTGTGTGGGCTGGG - Intronic
1105309689 13:19195444-19195466 AAGAATACCCATTTGTGGCTGGG + Intergenic
1105527815 13:21192175-21192197 AAGAATACCCATTTGTGGCTGGG - Intergenic
1105901039 13:24753435-24753457 CAGGAGAGCCAGTTAGTGCTTGG + Intergenic
1110667862 13:78138845-78138867 AAGGAGTCCCAGATGTGCCTGGG - Intergenic
1111490038 13:88960424-88960446 AAAGAGAGACATTTGGGGCTGGG + Intergenic
1111934891 13:94548629-94548651 TAGGACACCCAGTTTGGCCTTGG + Intergenic
1113711344 13:112467290-112467312 CAGGAGCCCCAGGTGGGGATTGG + Intergenic
1114719052 14:24860553-24860575 AAGGAAAACCAGTTTGGCCTAGG + Intronic
1117653793 14:57933453-57933475 AAGGAGACCAAGTAGTGACTTGG - Intronic
1117666560 14:58062109-58062131 AAGGAGGACCACTTGAGGCTAGG + Intronic
1119320635 14:73728199-73728221 AAGAAGACCAACTTGGGCCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119705366 14:76779726-76779748 AAGTAGACGCAGTTAGGGCCTGG - Exonic
1121325573 14:93017738-93017760 AGGGAAACCCACTTGGGGGTGGG - Intronic
1121538971 14:94711067-94711089 GAGAAAACCCAGTTGGGGCGGGG - Intergenic
1122440806 14:101730692-101730714 AAGGGTACCCAGGTGGGGCCTGG + Intronic
1122773460 14:104107129-104107151 AGGGAGACCCAGGCGGGGCCAGG - Intronic
1122793798 14:104195604-104195626 CAGGAGACGCAGGTGAGGCTGGG + Intergenic
1202890065 14_KI270722v1_random:148408-148430 AAGAAAACACAGTTGGGCCTGGG + Intergenic
1125552172 15:40553450-40553472 GAGAAGCCCCAGATGGGGCTTGG + Intronic
1128081178 15:64857790-64857812 AAGGAGCTGCAGTTTGGGCTGGG + Intronic
1128118750 15:65130450-65130472 AAGGAGACAGGGTTGGGGCTGGG - Intronic
1128203137 15:65827342-65827364 AAGGAGACTAGGTTGGGGGTGGG - Intronic
1128804357 15:70519622-70519644 AAGGAGAACCAGGTGGGCCAAGG + Intergenic
1129189862 15:73930937-73930959 CAGGAGACCCAGCTGGGCCTGGG - Intronic
1132281263 15:100617966-100617988 AGGGAGACCCCGTGGGGGGTGGG - Intronic
1132348566 15:101123026-101123048 AAGGCCACCAAGCTGGGGCTGGG + Intergenic
1132575117 16:660581-660603 AAGGAGACCCGGATGCTGCTGGG - Intronic
1132760319 16:1505784-1505806 TAGGAGACCCAGACTGGGCTTGG + Intronic
1135539530 16:23319339-23319361 AAGGAAGCCCAGATTGGGCTGGG - Intronic
1136625130 16:31457751-31457773 AAGGAACCCCAGTCTGGGCTGGG - Intergenic
1139428053 16:66895449-66895471 CAGGAGACCCAGCTTGGGCTGGG - Intronic
1139699700 16:68700506-68700528 AAGGAAATGAAGTTGGGGCTGGG + Intronic
1140735929 16:77897768-77897790 TAAGAAACCCAGTTTGGGCTGGG - Intronic
1141049666 16:80748842-80748864 AAAGGGACCCAGTTTGGGCATGG + Intronic
1141637126 16:85320110-85320132 AAGGAGAAGCAGTCGGGGCCGGG + Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1143621943 17:8085892-8085914 CAGGAGTCCCTGGTGGGGCTGGG + Intronic
1144342146 17:14318719-14318741 AAGGAGACACAGTCAGGGCAGGG - Intronic
1144628234 17:16856450-16856472 GAGGAGAGCAAGGTGGGGCTGGG + Intergenic
1144658403 17:17052615-17052637 AAGGAGTCCAAGTTGGGGCAAGG - Intronic
1145159826 17:20567017-20567039 GAGGAGAGCAAGGTGGGGCTGGG + Intergenic
1145398214 17:22512327-22512349 AAGGAAACCCAGATGGCTCTTGG - Intergenic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1149429621 17:56587276-56587298 GAGGAGACGGAGTAGGGGCTAGG + Intergenic
1150131319 17:62670729-62670751 AAGGAGTCCCAGCTGGGGGATGG + Intronic
1152244139 17:79176462-79176484 AAGGAGACCCAGTTGGGGCTGGG - Intronic
1152342021 17:79730723-79730745 CAGGGGACCCAGGTGAGGCTGGG - Intergenic
1152598767 17:81251042-81251064 AAGGGGACCCAGTTTGGGGGTGG - Intronic
1156515999 18:37681008-37681030 AAGTAGACCCTGATGTGGCTTGG - Intergenic
1157619553 18:49008484-49008506 CAGGGGACCCAGGTGGGGCAGGG - Intergenic
1159050725 18:63419007-63419029 AAGGAGAGCTATTTGGGGCCAGG - Intronic
1160953196 19:1677349-1677371 AAAAAGACACAGTTGGGTCTGGG - Intergenic
1161378815 19:3953762-3953784 AGGGAGAGCCAGTGAGGGCTTGG - Intergenic
1161483826 19:4524231-4524253 AAGGAGACTGAGTCAGGGCTGGG - Intronic
1161981837 19:7633977-7633999 AAGGAGACAGAGCTGGAGCTAGG - Intronic
1162079726 19:8210678-8210700 AGGCAGACCCATTTGAGGCTGGG - Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1163624683 19:18382401-18382423 AAGGAGAGCCAGGAGGAGCTGGG + Intronic
1165404669 19:35622346-35622368 AAGGAGGCCTGGATGGGGCTGGG + Intronic
1165943750 19:39428884-39428906 AAGGCGACAGAGCTGGGGCTGGG - Intergenic
1166051304 19:40262177-40262199 CAGGAGACTCACTTGAGGCTAGG + Intronic
1166197863 19:41218847-41218869 AAGGAGGCCTGGCTGGGGCTGGG + Intergenic
1166202417 19:41246780-41246802 AAGGAGGACCAGTTGAGGCCTGG - Intronic
1166215593 19:41332387-41332409 AGGGAGACCCAGATGGAGATAGG - Intronic
1166369330 19:42292521-42292543 CAGGAGACCAAGTTAGGGCCCGG - Intronic
1167081381 19:47278386-47278408 AAAGAGAATCAGCTGGGGCTGGG - Intergenic
1167705740 19:51079886-51079908 AAGGAGAGGCAGCTGGGGCTGGG - Intronic
1168592203 19:57646701-57646723 AAAGAGACCCAATAGGTGCTTGG - Intergenic
927489166 2:23509276-23509298 AATGACACCCAGCTGAGGCTGGG + Intronic
928483760 2:31708851-31708873 AAGGAAACACAGTGGAGGCTGGG + Intergenic
931017152 2:57996182-57996204 AAGGAGACAGAGTTGAGGATGGG + Intronic
932177669 2:69617554-69617576 AAGGAGTCCAAGTTGGGTCAGGG + Intronic
933610940 2:84434462-84434484 GAGGAGAGCCAGTGGGGGCCAGG + Intronic
933902343 2:86859109-86859131 AAGGAGACCCAGGACAGGCTGGG + Intronic
935370014 2:102335431-102335453 AAGTTCACCCAGTTGTGGCTGGG - Intronic
935667230 2:105523253-105523275 CAGGAGACTCAGTTGAGCCTGGG + Intergenic
935778202 2:106490159-106490181 AAGGAGACCCAGGACAGGCTGGG - Intergenic
936665877 2:114594941-114594963 AGGAAGATCCAGTGGGGGCTGGG - Intronic
936790563 2:116146032-116146054 AAGGAGACAGAATTGGAGCTAGG - Intergenic
937677643 2:124609359-124609381 CAGGAGAATCAGTTGAGGCTAGG + Intronic
937734295 2:125271069-125271091 AAGTAGAGCCATTTGGTGCTGGG + Intergenic
938143250 2:128813135-128813157 AAGGACACCCAGGTGTGGGTTGG + Intergenic
938260582 2:129892567-129892589 AAGGAGACCCAGGTCGGGGCAGG - Intergenic
938775616 2:134538829-134538851 AAGGAGACCTGGGAGGGGCTGGG + Intronic
942456896 2:176144248-176144270 ATGGGTACCCAGTTAGGGCTAGG - Intergenic
943015050 2:182499947-182499969 AGCGAGTCCCAGTTGGAGCTGGG + Intronic
946773074 2:223109346-223109368 AAGGAGACCCATAGAGGGCTGGG - Intronic
947551668 2:231050911-231050933 CAGGAGCCCCAGCTGGGGCTGGG - Intergenic
948252678 2:236543208-236543230 AAGGAGACCCACTTGCCTCTGGG + Intergenic
948799314 2:240424312-240424334 AGGGAGACTGAGGTGGGGCTAGG + Intergenic
1172439948 20:34958279-34958301 AAGGTGACCCAGTTTGTGGTAGG + Intergenic
1173808710 20:45943035-45943057 AAGCAGTCCCACTTGGAGCTTGG - Intronic
1174140366 20:48408822-48408844 AAGGAGACACATTTGGGAGTGGG - Intergenic
1174423370 20:50415430-50415452 AAGGAGACTCAGAGAGGGCTGGG + Intergenic
1174635177 20:51993330-51993352 CAGGAGAATCAGTTGAGGCTAGG + Intergenic
1178351107 21:31873549-31873571 GCGGAGACCCAGGCGGGGCTGGG + Exonic
1178696452 21:34796918-34796940 AAGGAAGCCCAGGTGGGGCTGGG + Intronic
1181093162 22:20488038-20488060 AATGTGACCCAGTGGTGGCTTGG - Intronic
1182424370 22:30264370-30264392 GAGGAGACCCTGAGGGGGCTGGG - Exonic
1182796887 22:32997487-32997509 AAGGAGACAGAAGTGGGGCTGGG - Intronic
1184173191 22:42771542-42771564 AAGGAGTCCCAGTGAGGCCTGGG + Intergenic
1184915406 22:47565526-47565548 AAGGAGGGCCACTTGGGGCCAGG - Intergenic
1184988984 22:48154757-48154779 AAGGGAAGCAAGTTGGGGCTGGG + Intergenic
1185001751 22:48250537-48250559 AAAGGGACCCAGTGGGCGCTGGG - Intergenic
949249815 3:1970368-1970390 CAGGAGACTGAGTTGGGGGTTGG - Intergenic
949319745 3:2795813-2795835 AAAGATACCCATTTGTGGCTGGG - Intronic
953168684 3:40488046-40488068 AGGGAGGCCCTGGTGGGGCTAGG - Exonic
953239745 3:41138126-41138148 AAGGACACACAGTTGGGGAATGG + Intergenic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
955720419 3:61874596-61874618 AAGGAGACCCATTCCTGGCTGGG - Intronic
956495538 3:69822036-69822058 AAGAAAATCCAGTTTGGGCTGGG - Intronic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
960043908 3:113178124-113178146 AAAGAGACTGAGTTGGGGCTGGG + Intergenic
961038439 3:123660029-123660051 AGGGACATCCAGGTGGGGCTAGG - Intronic
961235853 3:125366388-125366410 TAGGAGAGTCAGTTGGGGTTGGG - Intronic
961785416 3:129344199-129344221 AAAGAGACCCAGCCTGGGCTGGG - Intergenic
962160175 3:132990614-132990636 AAGGAGAAGCTGATGGGGCTTGG - Intergenic
964253647 3:154749824-154749846 AAGGAGTCCCTTTTGGAGCTGGG - Intergenic
967557236 3:190874838-190874860 CAGGAGAACCACTTGGGCCTGGG - Intronic
967739659 3:192991048-192991070 AAGATGAGCTAGTTGGGGCTGGG + Intergenic
971300278 4:25436214-25436236 AAGAAGACCCAGTTCTAGCTTGG - Intergenic
971468217 4:26988429-26988451 AAGGAGAGACAGTGGGGCCTGGG + Intronic
972745546 4:41928854-41928876 AAAGAAACACAGTAGGGGCTAGG + Intergenic
973712636 4:53644704-53644726 AAGGAGGCCCTGCTGGTGCTGGG - Intronic
976015812 4:80552913-80552935 TAGGAGAACCACTTGGGGCCAGG - Intronic
977559274 4:98516158-98516180 CAGGAGCCCCTGTTGGGGCAGGG - Intronic
981258883 4:142696002-142696024 AAGGAGAGCCAGCTGGGACTAGG + Intronic
981307468 4:143262220-143262242 AAGGAGACACTGGTGGGGGTGGG - Intergenic
987083248 5:14445232-14445254 AAGGAGTGGCAGTGGGGGCTGGG + Intronic
992995474 5:82328475-82328497 AAGAAGACCTAGCTGGGTCTTGG - Intronic
994891261 5:105639586-105639608 AAGGAGGCCGAGTGGGGTCTAGG + Intergenic
995774394 5:115710245-115710267 AATGAGACCCAGTTGGACTTTGG - Intergenic
999090932 5:148935337-148935359 AAGCAGACACAGTCAGGGCTGGG + Intronic
1000092339 5:157940672-157940694 AAAGAAACCCACTTGGGGCCAGG + Intergenic
1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG + Intronic
1000910925 5:167020851-167020873 AAGGAGACCTAGGTCGGGCATGG + Intergenic
1002299482 5:178249168-178249190 AAGGAGACCCAGGAGAGCCTGGG - Exonic
1003085187 6:3054769-3054791 AAACAGAGCCAGTTGGGGGTTGG + Intergenic
1003085291 6:3055596-3055618 AAACAGAGCCAGTTGGGGGTTGG + Intergenic
1005371385 6:25137245-25137267 AAGGAGACCCATAGGAGGCTTGG + Intergenic
1006106757 6:31721502-31721524 GAGCTGAGCCAGTTGGGGCTGGG + Intronic
1006446622 6:34083446-34083468 AAGGAGACCCAGCTGGCGCGTGG + Intronic
1006707483 6:36033608-36033630 AAGAAGAACCAGTGGAGGCTGGG - Intronic
1007102801 6:39261645-39261667 AAGGTCAGCCAGTTGGGACTGGG - Intergenic
1007850886 6:44801740-44801762 AAGGAGACCGAGATGGGGTCAGG + Intergenic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1011362906 6:86547696-86547718 GAGGAGGACCAGTTGAGGCTTGG + Intergenic
1011634571 6:89359311-89359333 AAGAAGACCGGGATGGGGCTGGG + Intergenic
1013216814 6:108034911-108034933 AAATAAACCCAGCTGGGGCTGGG - Intergenic
1013432121 6:110064593-110064615 GAGGAGCCCCTGCTGGGGCTGGG - Intergenic
1015966106 6:138696583-138696605 TAGGAGACCCTGTTGGGGAAGGG - Intergenic
1017097095 6:150813868-150813890 AAACAGTCCAAGTTGGGGCTGGG + Intronic
1018658300 6:166061695-166061717 AAGCAGGCCCAGATGTGGCTTGG - Intergenic
1020097825 7:5378197-5378219 GAGGAACCCCAGTTGGGGTTTGG - Intronic
1029419157 7:100463469-100463491 GAGGAGACCGAGGTGGAGCTGGG - Exonic
1029658760 7:101945061-101945083 AAGGAGTCCCAGAGTGGGCTTGG - Intronic
1030589855 7:111467167-111467189 AAGGTCACCCAGTAGGTGCTGGG - Intronic
1031997424 7:128241666-128241688 AAGGAGATAAAGTTGGGGGTAGG + Intronic
1032128093 7:129209178-129209200 AAGTTCACCCAGCTGGGGCTGGG - Intronic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1033314662 7:140287578-140287600 AAGGTCACACAGTTGGGGGTGGG - Intergenic
1035795455 8:2352401-2352423 AAGGAGGCCCGGATGGTGCTTGG - Intergenic
1036649767 8:10634842-10634864 AGGGAGTCCCAGTTGGGGTTGGG - Intronic
1038082524 8:24155180-24155202 GAGGAGAACAAGTTGGAGCTAGG + Intergenic
1040924500 8:52664161-52664183 AGGGATACCCAGTTGAAGCTAGG - Intronic
1041364182 8:57083661-57083683 AAGGACCATCAGTTGGGGCTGGG - Intergenic
1042379310 8:68094755-68094777 TAGGACACCCAGTTGGTGTTAGG - Intronic
1045504786 8:102770707-102770729 AAGGAGATGCAGGTGGGTCTTGG + Intergenic
1046817139 8:118597185-118597207 AAGGAGCCCCCGTTGGCCCTAGG - Intronic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1049540709 8:143207603-143207625 AGGGAGACACAGTTGGTCCTGGG - Intergenic
1049684971 8:143935676-143935698 AAGGACACCAGGGTGGGGCTGGG + Intronic
1049762842 8:144338690-144338712 AAGGGGACAGAGTTGGGGGTCGG - Intergenic
1052185366 9:25587487-25587509 CAGGAGGCCTAGTTGGGGATTGG + Intergenic
1052980356 9:34443964-34443986 AGGGAGACCAAGTTGAGGGTTGG - Intronic
1053369843 9:37551536-37551558 AAGCAGGCCCAGGTGTGGCTGGG - Intronic
1056339628 9:85612765-85612787 AAGGACACCCAGTTGGTGTCTGG + Intronic
1057015118 9:91644580-91644602 AAGTTGACCCAGTGGAGGCTGGG + Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060827876 9:126696717-126696739 ATGGAGGCCGAGGTGGGGCTGGG - Exonic
1060885689 9:127150446-127150468 AAGAAGGCCCATTTGGAGCTTGG - Intronic
1060996718 9:127878163-127878185 GAGGAGTCCCAGGTGGGTCTCGG - Intergenic
1187430650 X:19221356-19221378 AAGGACACCCTTTTGGTGCTGGG - Intergenic
1188934236 X:36153769-36153791 CAGCAGACCCAGGTGTGGCTTGG - Intergenic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1195246666 X:103001456-103001478 AAGAAGACCATGGTGGGGCTTGG - Intergenic
1197796036 X:130299557-130299579 AGGGAGGCCAAGATGGGGCTGGG - Intergenic
1197871185 X:131064154-131064176 TAGGAGACTGGGTTGGGGCTGGG + Intronic
1197944877 X:131827950-131827972 AAGGGGACCTACTTAGGGCTAGG + Intergenic
1199819186 X:151427651-151427673 AATGAGAAGCAGTGGGGGCTGGG + Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1201683135 Y:16670944-16670966 AGGGAGACCCATGTGGGACTTGG + Intergenic