ID: 1152245532

View in Genome Browser
Species Human (GRCh38)
Location 17:79182994-79183016
Sequence ACTTTTCCGAAGGCGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152245532_1152245537 1 Left 1152245532 17:79182994-79183016 CCCTCCCGCGCCTTCGGAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1152245537 17:79183018-79183040 GCGAGCGACGCCCCAAACTCCGG 0: 1
1: 0
2: 0
3: 1
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152245532 Original CRISPR ACTTTTCCGAAGGCGCGGGA GGG (reversed) Intronic
909454795 1:75838165-75838187 ATTTTTCCAAAGGCTCTGGAGGG + Intronic
1075848222 10:125564453-125564475 ACTTTTCCACAGGCTGGGGAGGG + Intergenic
1083736520 11:64684786-64684808 ACCTTTCCCAAGGCCCAGGATGG - Intronic
1090095336 11:123737391-123737413 ACTTTTATGAAGGGGCGGGGGGG - Intronic
1091632286 12:2171144-2171166 TCTTTTCTGAAGGCCAGGGAAGG + Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1103087278 12:118071300-118071322 ACTTTTGAAAAGGTGCGGGATGG - Intronic
1108024454 13:46163073-46163095 ACTTCTCAGAAGGGGCGGCAGGG - Intronic
1122922016 14:104884235-104884257 ACGCTTCCGAAGGGGCGGGCAGG - Exonic
1125674701 15:41495736-41495758 GCTTTTCCGAAGAGGCGGGGCGG - Intronic
1142986030 17:3695831-3695853 ACTTTTGGGAAGGCGGGGGAGGG - Intronic
1152153448 17:78617180-78617202 ACTTCTCCGAAGACACGGGGAGG + Intergenic
1152245532 17:79182994-79183016 ACTTTTCCGAAGGCGCGGGAGGG - Intronic
937119472 2:119431808-119431830 ACTTCTCCGCAGGGGCGGGGCGG - Intronic
941827261 2:169914240-169914262 ACTTTTTCATAGGCGAGGGAAGG + Intronic
942890399 2:180980742-180980764 TTTTTTCCGAAGGCGCTGGGCGG + Exonic
1179230168 21:39495767-39495789 ACTTTTCAGAAGGAGCATGATGG - Intronic
961446317 3:126983303-126983325 ACTTTCCCCGCGGCGCGGGACGG + Intergenic
964647612 3:158974812-158974834 ACTTTTCTGAAGGCTCAGGAAGG - Intronic
966222636 3:177565896-177565918 ACTTTTCCTAAGTCTCTGGAAGG + Intergenic
972670619 4:41211393-41211415 AGTTTTCCGGGGGCGGGGGAGGG - Intronic
986624081 5:9707170-9707192 ATTTTTCTGAAGGCTCGGGAAGG + Intronic
995144141 5:108767383-108767405 ACTTTTTCAAAGGCTGGGGAAGG - Intronic
1001902881 5:175445548-175445570 ACCTTTCGGAAGGCACAGGAAGG - Intergenic
1022460049 7:30595922-30595944 ATTTTCCCGAAGGTGAGGGAAGG + Intronic
1186423173 X:9443057-9443079 ACTTGGACGAAGGGGCGGGAGGG + Intergenic
1186423181 X:9443082-9443104 ACTTGGACGAAGGGGCGGGAGGG + Intergenic
1186423189 X:9443107-9443129 ACTTGGACGAAGGGGCGGGAGGG + Intergenic
1186917923 X:14244001-14244023 TTTTTTCCGAAGGCGCTGGGCGG + Intergenic