ID: 1152248834

View in Genome Browser
Species Human (GRCh38)
Location 17:79200906-79200928
Sequence CTCTGTGTGCGGCGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 226}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152248820_1152248834 27 Left 1152248820 17:79200856-79200878 CCAAGACAGAAGAAATCCACCCA 0: 1
1: 0
2: 3
3: 84
4: 1294
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248825_1152248834 -4 Left 1152248825 17:79200887-79200909 CCCCCTCCTGCGTCCTCGTCTCT 0: 1
1: 0
2: 4
3: 44
4: 535
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248826_1152248834 -5 Left 1152248826 17:79200888-79200910 CCCCTCCTGCGTCCTCGTCTCTG 0: 1
1: 0
2: 1
3: 23
4: 360
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248823_1152248834 7 Left 1152248823 17:79200876-79200898 CCAGCCTTTCACCCCCTCCTGCG 0: 1
1: 0
2: 1
3: 28
4: 370
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248827_1152248834 -6 Left 1152248827 17:79200889-79200911 CCCTCCTGCGTCCTCGTCTCTGT 0: 1
1: 0
2: 0
3: 15
4: 265
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248828_1152248834 -7 Left 1152248828 17:79200890-79200912 CCTCCTGCGTCCTCGTCTCTGTG 0: 1
1: 0
2: 1
3: 13
4: 224
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248821_1152248834 11 Left 1152248821 17:79200872-79200894 CCACCCAGCCTTTCACCCCCTCC 0: 1
1: 1
2: 4
3: 90
4: 856
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248822_1152248834 8 Left 1152248822 17:79200875-79200897 CCCAGCCTTTCACCCCCTCCTGC 0: 1
1: 0
2: 5
3: 43
4: 497
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248824_1152248834 3 Left 1152248824 17:79200880-79200902 CCTTTCACCCCCTCCTGCGTCCT 0: 1
1: 0
2: 0
3: 40
4: 453
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226
1152248829_1152248834 -10 Left 1152248829 17:79200893-79200915 CCTGCGTCCTCGTCTCTGTGTGC 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152248834 Original CRISPR CTCTGTGTGCGGCGGGCAGC TGG Intronic
900206979 1:1435820-1435842 CGGTGAGTGCGGCGGGCGGCCGG + Exonic
901814732 1:11787693-11787715 CTCTTTGGGCGGCAGGCAGCCGG + Exonic
902718819 1:18290846-18290868 CTCTGTGTGGTGGAGGCAGCGGG - Intronic
904237654 1:29124859-29124881 CCCTGTCCGCGGCGCGCAGCCGG - Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
905216830 1:36414612-36414634 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
905670703 1:39788584-39788606 CTCGGCGGGCGGCGGGCGGCGGG + Exonic
906152696 1:43596757-43596779 CTGTGTGTGCGGGTGGCAGTGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907830482 1:58060110-58060132 TTCTGTGTGGGGAGAGCAGCAGG + Intronic
910000013 1:82330631-82330653 CTCTGTGTGTGGCTTGCAGATGG + Intergenic
910374501 1:86553532-86553554 CTCCCTGAGCGGCGGGAAGCAGG - Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
917046045 1:170861377-170861399 CTCTGTGGGCTGCGGCCAGGTGG - Intergenic
917721760 1:177792530-177792552 CTCTGTGTGGAGCTTGCAGCTGG + Intergenic
919178201 1:194047108-194047130 CTTTCTGTGCGGTGAGCAGCAGG - Intergenic
919282770 1:195512368-195512390 CTTTCAGTGCGGCGAGCAGCAGG + Intergenic
920764009 1:208813585-208813607 CTCTCTGTGCAGTGGGCAGCAGG - Intergenic
921291755 1:213664096-213664118 CCCTGTGTGCTGCAGGGAGCTGG - Intergenic
921581904 1:216905166-216905188 TTCTGTGTGTGATGGGCAGCCGG - Intronic
1063362045 10:5467022-5467044 CTCTCTGTGCACCGGGCAGGAGG + Intergenic
1067060889 10:43077416-43077438 TTCTGTTTGCCGTGGGCAGCGGG + Intronic
1067256652 10:44648442-44648464 TTCTGTTTGAGGCTGGCAGCAGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068044695 10:51871455-51871477 TGCTGTGTGCAGTGGGCAGCAGG - Intronic
1068700641 10:60016003-60016025 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071572113 10:86703035-86703057 CTCTGGCTGCGGAGAGCAGCAGG + Intronic
1072591834 10:96833415-96833437 CCCTCTGTGCGGCGGCCGGCGGG + Exonic
1072719393 10:97771414-97771436 CTCCATGAGCGGCGCGCAGCCGG + Exonic
1073252955 10:102133200-102133222 CGCTGTGAGCGGCGGCGAGCAGG + Exonic
1074563777 10:114558106-114558128 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1076922202 10:133459883-133459905 CTCAGGGTGCGGCTGGCCGCGGG + Intergenic
1076997303 11:304333-304355 CTCCGCGTGCGGCGGGTGGCGGG - Intergenic
1077333326 11:1992921-1992943 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1077340896 11:2025879-2025901 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1077340949 11:2026062-2026084 CCCTGAGTGCGGCTGGCAGGTGG + Intergenic
1078542756 11:12224703-12224725 CTCTGTCTGCTGCTGGCACCAGG - Exonic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1083271629 11:61575828-61575850 GTGTGTGTGCGGGTGGCAGCTGG - Intronic
1083860115 11:65415862-65415884 CCCTGTGTGCGGGGAGCAGTTGG - Intergenic
1084594405 11:70108471-70108493 CTCTGTGGGAGGCAGGCAGCCGG + Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1090327775 11:125904178-125904200 CTGTGTGAGCGGCGGGCCGCGGG + Intronic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091265513 11:134268201-134268223 CTTTCTGTGCGGTGAGCAGCAGG - Intergenic
1202816306 11_KI270721v1_random:48102-48124 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1202823881 11_KI270721v1_random:81068-81090 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1202823934 11_KI270721v1_random:81251-81273 CCCTGAGTGCGGCTGGCAGGTGG + Intergenic
1097345445 12:58486935-58486957 CTCTGTGAGCTGCAAGCAGCTGG - Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1102679884 12:114684203-114684225 CGCTGTGGGCTGCGGGGAGCCGG + Intergenic
1104211287 12:126691234-126691256 CTCTGGCTGCCACGGGCAGCAGG + Intergenic
1104686320 12:130787401-130787423 CCCTGTGTGGCGTGGGCAGCTGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1106559017 13:30833011-30833033 CTCTGTGTGCTGCGGGGACAGGG - Intergenic
1108192565 13:47957316-47957338 CTTTCTGTGTGGCGAGCAGCAGG + Intronic
1108459486 13:50650959-50650981 CTCCCTGTGAGGAGGGCAGCAGG + Intronic
1110537376 13:76667145-76667167 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
1111203547 13:84972863-84972885 CTCTCTGTGCAGCAAGCAGCAGG - Intergenic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1113882678 13:113636431-113636453 AGCTGTGTGTGGCGGTCAGCGGG + Intronic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1122459518 14:101883716-101883738 CACTGTGTGCAGGGGGCTGCTGG + Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1124115282 15:26836762-26836784 CTTTCTGTGCGGTGGGCAGCAGG - Intronic
1124220752 15:27847953-27847975 CTCTGTGTGTTGCTGGCAGGTGG - Intronic
1124693480 15:31844988-31845010 CTCTGTTTGCTGGGGGTAGCAGG - Intronic
1125477592 15:40057838-40057860 CTCTGTGTGCTCCAGGCATCTGG - Intergenic
1125740029 15:41956044-41956066 CTGTGTGTGCTGCGGGGAGCTGG - Intronic
1127082589 15:55395098-55395120 CTTTCTGTGCGGCAAGCAGCAGG + Intronic
1129373164 15:75110451-75110473 CTCTGTGTCAGGTGGGAAGCCGG - Intronic
1132679737 16:1134818-1134840 CTCTGTGTGCAGGTGGCAGCGGG - Intergenic
1132728433 16:1348803-1348825 CTGGGTGGGCGGTGGGCAGCTGG + Exonic
1132839529 16:1972313-1972335 CTGTGTGTGCGCCGGCCCGCGGG + Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1134078922 16:11311536-11311558 CTTTCTGTGTGGCGAGCAGCAGG + Intronic
1134520779 16:14918372-14918394 CTGTGAGTGCGGCGGGCGGATGG + Intronic
1134550796 16:15137601-15137623 CTGTGAGTGCGGCGGGCGGATGG - Intronic
1134599346 16:15521194-15521216 CTTTCTATGCGGCGAGCAGCAGG + Intronic
1134708451 16:16317023-16317045 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134715666 16:16357056-16357078 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134951151 16:18351622-18351644 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1134959091 16:18395103-18395125 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1136297790 16:29313502-29313524 CTCAGCGTGCGGGGGGCATCCGG + Intergenic
1136656669 16:31713368-31713390 CTCTGTGACCGGCAGGCACCGGG + Exonic
1136988587 16:35137791-35137813 CTCTGTCTGGGGCTGTCAGCAGG - Intergenic
1137617998 16:49858202-49858224 CGCTGTTCTCGGCGGGCAGCGGG - Intergenic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1139525851 16:67515931-67515953 CTTTCTGTGTGGCGAGCAGCAGG + Intergenic
1140825567 16:78702800-78702822 CTCTGTGTGCTGCGGGTCGAGGG + Intronic
1140866404 16:79066280-79066302 CTCAGTGTGCGGGAGGAAGCAGG - Intronic
1141744302 16:85915298-85915320 TTCTGTGGGAGGCGAGCAGCTGG + Intronic
1142139917 16:88468266-88468288 CTCTGTGCGCCGCAGGCAGTGGG - Intronic
1145057906 17:19715154-19715176 CACTGTGTTCTGCGGGCACCTGG - Exonic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1146057563 17:29589052-29589074 GTCTGAGGGAGGCGGGCAGCTGG - Intronic
1147256418 17:39184859-39184881 CTCTGTCTGGGGGGGGAAGCAGG + Exonic
1148869605 17:50648747-50648769 CTCTGTGTGTTGGGGGCAGGTGG - Intronic
1151470734 17:74316162-74316184 CTTTGAGTACGGGGGGCAGCTGG - Intergenic
1151631771 17:75315857-75315879 CCCTGTGGCCGGCGTGCAGCCGG - Intergenic
1151950592 17:77351561-77351583 CTGTGTGAGCTGCGGTCAGCAGG + Intronic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152258889 17:79255919-79255941 CTCTGTGCTCGGCAGGCAGCGGG - Intronic
1152386469 17:79977778-79977800 CTCTGTGGTCAGCGGGAAGCTGG - Intronic
1152464277 17:80457023-80457045 CTCGGGGTGGGGCGGGCAGGAGG - Intergenic
1152503140 17:80726357-80726379 ATCTGTGGGCGGCGAGCACCAGG - Intronic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1153952513 18:10069181-10069203 CGCTGTGAGAGGCGGGGAGCTGG - Intergenic
1155157956 18:23173270-23173292 GTCTGTGCGCAGCAGGCAGCAGG - Intronic
1156772169 18:40741820-40741842 CTCTGAGTGGAGTGGGCAGCTGG + Intergenic
1157762655 18:50275727-50275749 CTCTGTTGGCGGGGGGCAGGTGG + Exonic
1158959471 18:62577034-62577056 CTCTGTCTCCGGCCCGCAGCAGG + Exonic
1159327295 18:66938641-66938663 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1159904510 18:74077729-74077751 CTCTGTCTTTGGCAGGCAGCCGG + Intronic
1160100513 18:75916283-75916305 CTCTGTGCGCCGCGGGCTCCCGG - Intergenic
1160226031 18:77011585-77011607 CTCTGGGAGTGGCAGGCAGCCGG - Intronic
1160416909 18:78717963-78717985 CTCTGTGTGCTGCCAGCACCTGG - Intergenic
1160532598 18:79574257-79574279 CTGTGTGTGCCGCCGGCACCTGG + Intergenic
1160584298 18:79904080-79904102 CTCCGTGTGCGGCCTGCTGCAGG - Exonic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234493 19:3191094-3191116 CGCGGTGCGTGGCGGGCAGCAGG + Intronic
1162100470 19:8335630-8335652 CCCGGGGCGCGGCGGGCAGCGGG + Exonic
1163291847 19:16384162-16384184 CTCTGTCTTCGGGGGGCTGCAGG - Intronic
1164881007 19:31732849-31732871 CTCTGTGAGCATGGGGCAGCTGG + Intergenic
1164976936 19:32580765-32580787 CTCTGTGTGCACCGAGGAGCCGG + Intergenic
1165704469 19:37965931-37965953 CTTTGTGTGCGGTGGGCACTTGG + Intronic
1165808505 19:38596483-38596505 CTCCCTGTGCGGCCCGCAGCAGG - Exonic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
925147158 2:1588919-1588941 CTCTGTGGGCTGTGGGCTGCGGG - Intergenic
926634404 2:15164831-15164853 TTCTGTGGGCGGCGGGGAGGGGG - Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
927970988 2:27306379-27306401 CTCTGTGTGGGGGGTGCGGCGGG + Intronic
929394827 2:41510691-41510713 CTTTCTGTGCGGTGAGCAGCAGG - Intergenic
929446327 2:42004115-42004137 CTTTGTGTGTGGTGAGCAGCAGG - Intergenic
929767500 2:44859328-44859350 CTCTTTGTGCTTCTGGCAGCGGG + Intergenic
930086337 2:47500096-47500118 CTTTCTGTGCGGTGAGCAGCAGG + Intronic
933278217 2:80304607-80304629 CTTTGCGGGCGGCGGGCGGCGGG + Exonic
935331312 2:101979754-101979776 CTCTGCCAGCTGCGGGCAGCAGG + Intergenic
936068344 2:109348815-109348837 ATCTGGGGGCGGCGGGGAGCAGG - Intronic
936467693 2:112767807-112767829 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
937390675 2:121483172-121483194 CCCTGTGTGGGGCGGGGAGGGGG - Intronic
937782263 2:125852591-125852613 CTGTGTGTGCAGGTGGCAGCAGG - Intergenic
940639248 2:156330271-156330293 CTCTGACTGCCGCGGGCTGCCGG - Intronic
942111554 2:172687862-172687884 CTTTGTGTTCAGTGGGCAGCAGG - Intergenic
945470720 2:210225182-210225204 CTCACCGCGCGGCGGGCAGCTGG + Exonic
945737809 2:213622551-213622573 CTTTCTGTGCGGTGAGCAGCAGG + Intronic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948479552 2:238241003-238241025 CCCTTTGTCCGGCGGGCAGGCGG + Intergenic
948830948 2:240598027-240598049 CTCTGTGTCCGGCAGGTAGGTGG - Exonic
948936180 2:241166468-241166490 CTGTGTGGGCGGTGGGCACCAGG + Intronic
1171358806 20:24572189-24572211 CTTTCTGTGTGGCGAGCAGCAGG + Intronic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1172205319 20:33159170-33159192 CCCTGTGTGTGGCCAGCAGCGGG - Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1175524241 20:59622634-59622656 CTCTGTGTGCAGCGAGGTGCCGG - Intronic
1175887833 20:62302556-62302578 GGCTGTGGGCGGCGGGCACCAGG - Intronic
1179783810 21:43718818-43718840 CCCTGCGTGCGGCGGGGCGCGGG + Intergenic
1179883351 21:44302600-44302622 CTCTATGTCAGCCGGGCAGCAGG + Intronic
1180138572 21:45876983-45877005 CTGTGAGTGCGGCTGGCAGCAGG - Intronic
1180200747 21:46222685-46222707 CTCTGTATCCGGCTGGCAGAGGG + Exonic
1180962042 22:19766528-19766550 CTCCGGGCGCGCCGGGCAGCGGG - Exonic
1181107227 22:20582530-20582552 CTATGCGTGCGGTGGGCAGGTGG + Intronic
1184572624 22:45335876-45335898 CTGTGTGTGCGCTGGGCACCAGG + Intronic
1184841665 22:47055762-47055784 CTCTGTCTGCTGCTGGGAGCTGG + Intronic
1185192251 22:49446356-49446378 CTCTGCGTCCAGCTGGCAGCTGG + Intronic
949134827 3:551723-551745 CTTTCTGTGCGGAGAGCAGCAGG + Intergenic
950470052 3:13179195-13179217 CTCTCTGTGAGGTGAGCAGCAGG + Intergenic
950772481 3:15323416-15323438 CTCTGTTTGCAGCGCCCAGCGGG + Intronic
954230790 3:49215571-49215593 CTTTCTGTGTGGCGAGCAGCAGG - Intronic
954283624 3:49602247-49602269 CTCTGTGTCCCTGGGGCAGCAGG + Intronic
954661638 3:52229823-52229845 CTCTGGGTGCGAAGGTCAGCAGG - Intronic
954761161 3:52875450-52875472 CACTGTGTGAGGGGGCCAGCAGG - Intronic
955732762 3:62004665-62004687 CTTTCTGTGCAGCGAGCAGCCGG + Intronic
958147718 3:89648281-89648303 TTGTGTGTGCGGGGGGCTGCTGG - Intergenic
960986496 3:123284529-123284551 CTCTGTGTGCCGGGGGTGGCGGG - Exonic
961222573 3:125212327-125212349 CTCTGTGCGGCGCGGGCAGCCGG - Intronic
961991881 3:131200855-131200877 CTTTCTGTGCTGCGAGCAGCAGG + Intronic
962804367 3:138916179-138916201 CTCTGAGGGCTGCGGGCTGCGGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
965799806 3:172479995-172480017 CTTTCTGTGCGGCCAGCAGCAGG + Intergenic
968727998 4:2257089-2257111 CGCTGGCTGGGGCGGGCAGCTGG - Intronic
969300641 4:6294975-6294997 CTCTGTGTGAGGGTGGCAGTGGG + Intronic
976751931 4:88457589-88457611 GGCTGTGAGGGGCGGGCAGCCGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
977883106 4:102228731-102228753 CTCTCTGTGTGGTGAGCAGCAGG - Intergenic
984076943 4:175195071-175195093 CTTTCTGTGCAGCAGGCAGCAGG + Intergenic
984269499 4:177533813-177533835 CTTTCTGTGTGGCGAGCAGCAGG + Intergenic
984805592 4:183748594-183748616 CTTTCTGTGCGGCGAGCAGCAGG - Intergenic
984955162 4:185037726-185037748 CTTTCTGTGCGGCGAGCAGCAGG + Intergenic
985104831 4:186490089-186490111 CTTTCTGTGCGGTGAGCAGCAGG + Intronic
985271920 4:188201675-188201697 CTTTCTGTGTGGCGAGCAGCAGG - Intergenic
985322386 4:188729111-188729133 CTTTCTGTGCGGCGAGCAACAGG - Intergenic
985428621 4:189855999-189856021 TTCTGTGTGTGGCAGGCGGCAGG + Intergenic
985754027 5:1702482-1702504 CTCTGTGTGGGGGTGGGAGCAGG + Intergenic
986136308 5:4982355-4982377 GTCTGTGTGCAGGGGGCAGGCGG + Intergenic
986794005 5:11191612-11191634 CTCTGAGGGCTGCGGGCAGAGGG + Intronic
994072953 5:95621388-95621410 CTCTCTGTGCTGCGCGCCGCAGG + Exonic
997527147 5:134560727-134560749 CTCTCTGTGAGGAGGACAGCAGG - Exonic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
1002616345 5:180458851-180458873 CTCTCTGTGCGGTGAGCAGTGGG + Intergenic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1003532715 6:6951577-6951599 CTTTCTGTGCTGCAGGCAGCAGG + Intergenic
1004341101 6:14808047-14808069 CTTTCTGTGCGGCGAGCAGCAGG - Intergenic
1004942637 6:20576797-20576819 CTCTGTGTGTGGCGTGGAGCAGG + Intronic
1006974410 6:38085050-38085072 CTCTGTGTCCTGCAGTCAGCAGG + Intronic
1007596834 6:43056160-43056182 CTCTGGTTGCTGGGGGCAGCCGG - Exonic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1011625408 6:89279267-89279289 GTCTGTGTGAGGCAGGCAGCGGG + Intronic
1012368804 6:98477623-98477645 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
1013755100 6:113452119-113452141 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
1015497415 6:133895785-133895807 CACTGTGTGCGTCGGGAAGTCGG + Intergenic
1018053584 6:160032652-160032674 TTCTCTGAGCGGCGAGCAGCAGG + Exonic
1019167766 6:170110332-170110354 CCCTGTGTGCCGCGGGGACCAGG - Intergenic
1019425075 7:971109-971131 CACTCTGTGCTGCTGGCAGCGGG + Intronic
1019522571 7:1467415-1467437 CTGTGCCTGCGGCGGGCACCTGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023805415 7:43869465-43869487 CTCCGTGTGCAGCGGGTTGCTGG - Exonic
1024521093 7:50304550-50304572 CGCTGTGCGCGCGGGGCAGCCGG + Intronic
1024794647 7:53007032-53007054 CTTTCTGTACGGCAGGCAGCAGG - Intergenic
1026855449 7:73750803-73750825 CTTTCTGTGCGGCAAGCAGCAGG - Intergenic
1032485750 7:132286234-132286256 CTCTGTGTGGGGCATGCAGTGGG + Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1036450645 8:8864179-8864201 CTTTCTGTGCGGCAAGCAGCAGG + Intronic
1036547358 8:9784790-9784812 CTTTCTGTGCGGCAAGCAGCAGG - Intergenic
1037973668 8:23193155-23193177 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1039967299 8:42292696-42292718 CTCTGTGTGCTGCTGGGAGCTGG - Intronic
1040659435 8:49553007-49553029 CTTTCTGTGCGGAGAGCAGCAGG + Intronic
1040794623 8:51275205-51275227 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
1041816816 8:61982391-61982413 CTTTCTGTGAGGCGAGCAGCTGG + Intergenic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1049338485 8:142099252-142099274 CTCTGTGTGCGGCCTGGAGGCGG - Intergenic
1052033978 9:23659588-23659610 ATCTGTATGCGGTAGGCAGCTGG - Intergenic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1057577421 9:96254660-96254682 CTCTGTGGGCTGGGGGAAGCAGG - Intronic
1057630088 9:96712706-96712728 TTCTGTGTGCAGCAAGCAGCAGG - Intergenic
1058439209 9:104991743-104991765 CGCGGCGGGCGGCGGGCAGCGGG + Intergenic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1061489831 9:130938779-130938801 CGCTGTGTGCGGGCGGGAGCAGG + Exonic
1061505983 9:131032161-131032183 CTCTGTGGGCGGCAGGTAGGAGG + Exonic
1061922669 9:133790803-133790825 CTCTTTGTGCTGCTGGCACCGGG + Intronic
1062539473 9:137035240-137035262 CGCTGTCTGCAGGGGGCAGCTGG - Exonic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1185681737 X:1894070-1894092 TTCTGTGTCCGGCGGGCATGGGG - Intergenic
1186246403 X:7620877-7620899 CTCTGGGGGCTGGGGGCAGCGGG + Intergenic
1196294103 X:113979196-113979218 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1198099634 X:133413543-133413565 CTCCGGGTGGGGCGGGCAGGGGG - Intronic
1198241686 X:134794107-134794129 CTCAGTGGTCGGGGGGCAGCTGG + Intronic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1200267776 X:154655035-154655057 CTTTCTGTGCGGCCAGCAGCAGG + Intergenic
1202113489 Y:21448703-21448725 ATCTGTCTGGGGCTGGCAGCAGG - Intergenic