ID: 1152251484

View in Genome Browser
Species Human (GRCh38)
Location 17:79214935-79214957
Sequence GGCACCAGGCGAAGATGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152251484_1152251488 2 Left 1152251484 17:79214935-79214957 CCTTGGCATCTTCGCCTGGTGCC 0: 1
1: 0
2: 0
3: 18
4: 130
Right 1152251488 17:79214960-79214982 TCAATTATGAAGCCACCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152251484 Original CRISPR GGCACCAGGCGAAGATGCCA AGG (reversed) Intronic
900101347 1:963416-963438 GGCACAAGGCGAAGCTGCCTGGG + Exonic
900381175 1:2384871-2384893 GGCACATGGAGAAGCTGCCAGGG + Intronic
902831308 1:19014720-19014742 AGCACCAGGCAAAGATGGCGGGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906725983 1:48044558-48044580 GGCAGGAGGAGAAGAGGCCAAGG - Intergenic
908767803 1:67570016-67570038 GGGAGCAGTCAAAGATGCCATGG + Intergenic
912010350 1:104951905-104951927 GGAACCAGAGGAAGATGCTATGG + Intergenic
912430690 1:109626955-109626977 GGCACCAGGCTGAGAAGCCCAGG - Intronic
912798305 1:112706015-112706037 GGCCCAAGGCCAAGATGGCATGG + Exonic
914783328 1:150805756-150805778 GGCACCAGGAAAAGAGGGCAAGG - Intronic
915548825 1:156619828-156619850 GGGACCAGGGGAAGATGCTGGGG - Intronic
916524091 1:165592827-165592849 GGCACCAGACTACCATGCCAAGG - Intergenic
918187656 1:182142459-182142481 AGCACAAGGCAAGGATGCCAGGG - Intergenic
920691602 1:208151033-208151055 GGAACAAGACGAAGCTGCCAGGG + Intronic
922200242 1:223394614-223394636 GGGAGCAGGAGAAGATGCTACGG + Exonic
1064156466 10:12907053-12907075 GGAACCAGGAAAAGATGACAGGG - Intronic
1069619646 10:69829014-69829036 GGATCCAGGCGGAGATGGCAAGG - Intronic
1073188055 10:101629008-101629030 CTCACCAGAGGAAGATGCCAGGG + Intronic
1074121346 10:110496448-110496470 GGCTCTAGGCGGAGATGCCGGGG + Intergenic
1076096717 10:127738782-127738804 GGCCCCCGGGGAAGGTGCCAAGG - Exonic
1081525700 11:43926020-43926042 GGCACCAGGGGAGCCTGCCAAGG - Intronic
1084218585 11:67664653-67664675 GGCTCCAGGCCAGGATCCCAAGG + Intronic
1084943571 11:72627013-72627035 GGCACCAACCGAAGAAGCCAGGG - Intronic
1086169767 11:83822700-83822722 GGAACCAGGCTCAGAGGCCAAGG - Intronic
1086590334 11:88508479-88508501 GGCCCAGGGGGAAGATGCCAAGG - Exonic
1090914609 11:131152237-131152259 GGCACCAAGCAAAGAGGACAAGG + Intergenic
1092057447 12:5519893-5519915 GCCTCCAGGAGAAGAGGCCATGG - Intronic
1092784712 12:12016764-12016786 GGCTGCTGGAGAAGATGCCAGGG - Intergenic
1098484407 12:71004134-71004156 GGAACCAGTCGAACAGGCCAGGG + Intergenic
1100589462 12:96012312-96012334 GGCAACAAGAGAACATGCCATGG + Intronic
1103922529 12:124406398-124406420 TGCGCCAGGAGAAGCTGCCACGG + Intronic
1104801117 12:131555877-131555899 GGGTCCAGGGGAGGATGCCAGGG - Intergenic
1105071144 12:133235358-133235380 GGCACCGGGCGGACAGGCCAAGG - Exonic
1108576805 13:51797855-51797877 AGCCCCAGCAGAAGATGCCAGGG - Exonic
1109332199 13:60943640-60943662 CTCACCAGGAGCAGATGCCAGGG + Intergenic
1111323384 13:86659886-86659908 GACATCAGGGGAAGAAGCCAAGG - Intergenic
1113792333 13:113035548-113035570 GGCAGCAGGCGAAGGAGCCAGGG - Intronic
1115705465 14:35993813-35993835 GACATGAGGCAAAGATGCCAAGG + Intergenic
1117096406 14:52303143-52303165 GTCACAAGGGCAAGATGCCATGG + Intergenic
1121002758 14:90464082-90464104 GGCATCAGCCTAGGATGCCAAGG - Intergenic
1121802129 14:96783526-96783548 TGCACTAGGCGAAGATTCCTGGG - Intergenic
1121970882 14:98354823-98354845 GGCAGCAGGTGAAGCTGCCGAGG + Intergenic
1122770979 14:104097536-104097558 GGCACCTGGGGGAGAGGCCACGG - Exonic
1123708009 15:22964572-22964594 TGCAGCCGGCGAAGATGCCACGG + Intronic
1124832670 15:33164038-33164060 GGCACCAGAGGAAGAAGACATGG + Intronic
1127220947 15:56880385-56880407 GGAACAAGGCAAAGATACCATGG + Intronic
1129034103 15:72639482-72639504 GGCACCAGGCCGAGGTCCCAGGG - Intergenic
1129215779 15:74097734-74097756 GGCACCAGGCCGAGGTCCCAGGG + Intergenic
1129219086 15:74121078-74121100 GGCACCAGGAGAAGAAGCTTGGG - Intronic
1129409027 15:75338721-75338743 GGCACCAGGCCAAGTTCCCAGGG - Intronic
1129732917 15:77942067-77942089 GGCACCAGGCCGAGGTCCCAGGG + Intergenic
1132504013 16:297810-297832 GGCCCCAGGCGAAGCTGCTCTGG + Exonic
1135163070 16:20114617-20114639 AGCATCAGGCCTAGATGCCAGGG - Intergenic
1136278186 16:29191815-29191837 GGCACCTGGTGAGGATGCCTGGG + Intergenic
1137063492 16:35812931-35812953 GGAACCAGAGGAAGAAGCCAAGG - Intergenic
1138560840 16:57800212-57800234 GGCACCTGGCGAGGAAGCCATGG + Intronic
1138977299 16:62223115-62223137 GGCAACAGGCGCATATGCTATGG - Intergenic
1139545809 16:67649034-67649056 CGCACGAGGCGAAGTTGCAAGGG - Intronic
1140511808 16:75513871-75513893 GGTACCAGGTCAAGATGCCATGG - Intergenic
1141665979 16:85465307-85465329 GGCACCAAGCAGAGATGCGAAGG - Intergenic
1142082564 16:88157855-88157877 GGCACCTGGTGAGGATGCCTGGG + Intergenic
1143318827 17:6054457-6054479 AGGGCCAGGCGAAGATGCAAAGG - Intronic
1144037366 17:11379627-11379649 GTCACCAGGACAAGCTGCCATGG - Intronic
1144682367 17:17204463-17204485 GGCACAAGGCCAGGTTGCCACGG - Intronic
1148891644 17:50811828-50811850 GGCACGAGGCGAAGGGGACAAGG - Intergenic
1150165824 17:62941546-62941568 GACACCAGGAGATGATGCAATGG + Intergenic
1150486959 17:65550599-65550621 GGGACCAGTGGAGGATGCCAGGG - Intronic
1152251484 17:79214935-79214957 GGCACCAGGCGAAGATGCCAAGG - Intronic
1154281244 18:13005131-13005153 CACACCAGGTGATGATGCCACGG + Intronic
1154307247 18:13239705-13239727 GGGACCAGACGCAGATGCCCTGG + Intronic
1156461397 18:37323245-37323267 GGCAGCAGGGGAGGATGCCAGGG + Intronic
1161273811 19:3404567-3404589 GACACCAGGAGAAGGTGACAAGG - Intronic
1162476704 19:10904798-10904820 GGCACCCGGCAATGCTGCCAGGG + Intronic
1163322271 19:16581735-16581757 GACACCAGGCGAAGGTGTGAGGG + Intronic
1166048323 19:40242614-40242636 GGCCCCAGGCGAGGACCCCATGG - Exonic
1168072424 19:53960437-53960459 GGCACTAGGCCCAGTTGCCATGG + Intergenic
925217703 2:2111274-2111296 GACACCAGGCGGGGATGCCAAGG - Intronic
927951250 2:27171080-27171102 GTAACCATGCCAAGATGCCAAGG - Intergenic
928064460 2:28149298-28149320 GACACCAGGTGAAGGTTCCAAGG - Intronic
929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG + Intergenic
936521145 2:113212846-113212868 GCCACCGGGCACAGATGCCAAGG + Intergenic
936795342 2:116196502-116196524 GACACCAGCCGAAGCAGCCAAGG - Intergenic
946307678 2:218865410-218865432 GGAACCAGCCAAAGAGGCCAAGG - Intronic
947292373 2:228590485-228590507 CTCACCAGGAGATGATGCCAAGG - Intergenic
1168809461 20:694759-694781 GGCACAATGCCAAGAAGCCATGG + Intergenic
1169077490 20:2770176-2770198 GGAAGCAGGAGCAGATGCCAAGG - Intergenic
1169280917 20:4266331-4266353 GGAGCCAGGAGAAGAAGCCAAGG + Intergenic
1169814782 20:9645165-9645187 GGTACCAGGGGAAGAAGGCAGGG + Intronic
1178124748 21:29504500-29504522 GCCACCATGTGAAGAAGCCAAGG - Intronic
1180590760 22:16935323-16935345 TGCACCAGGCTGAGATGCCTTGG - Intergenic
1181603256 22:23964857-23964879 GGCACCAGGCGAAGATGAGGAGG - Intergenic
1181605258 22:23976450-23976472 GGCACCAGGCGAAGATGAGGAGG + Intronic
1181801762 22:25352301-25352323 GGCTCCAGGCGCTGATCCCAGGG + Intronic
1183473992 22:38025993-38026015 TGCACGAGGGGAAGATTCCAGGG - Intronic
1183515315 22:38262205-38262227 GGCACCACGCGAAAGTGCCAAGG + Intronic
1183642570 22:39101395-39101417 GGCGGGAGGCGAAGATGCCCAGG - Exonic
1185075041 22:48678449-48678471 GGCACCAGGCGAGAATGCTGAGG + Intronic
949863034 3:8523828-8523850 GTCACCAGAGGAGGATGCCAGGG - Intronic
952025903 3:29082017-29082039 GGCACCACGTGAAGAAGCCCAGG + Intergenic
955080880 3:55656944-55656966 GGCATCAGGCTAAGAGGCCCTGG + Intronic
961367112 3:126406942-126406964 TGCACCAGGCACAGGTGCCAGGG + Intronic
961674567 3:128556594-128556616 GGCCCTGGGCCAAGATGCCAGGG - Intergenic
963614464 3:147518037-147518059 GGCATCGGGGGAAGAGGCCAGGG + Intergenic
968662983 4:1806466-1806488 GGCACCAGGGGAATAGGCCAGGG - Intronic
968832609 4:2940878-2940900 GGCACGAGGCAAGGCTGCCAGGG + Intronic
971373059 4:26033725-26033747 GACACCATGTGAAGAAGCCAAGG - Intergenic
984848804 4:184133574-184133596 GGGAGCAGGGGAAGATGACAGGG - Intronic
985660266 5:1153470-1153492 GGCACCCGGAGGAGAGGCCAAGG + Intergenic
986661553 5:10064634-10064656 GGGACCAGCCACAGATGCCATGG - Intergenic
987236238 5:15944678-15944700 GCCCCCAGGCGAAGGTACCAGGG - Intergenic
997721625 5:136082550-136082572 GGCTCCAGGCAACGAAGCCAGGG - Intergenic
998138468 5:139687003-139687025 GGCAGCAGGCGCAGTTCCCACGG + Intergenic
1001284054 5:170409626-170409648 AGCTCCAGGCCAAGATGACAAGG + Intronic
1001513636 5:172339938-172339960 GGCACTTGGCTACGATGCCAGGG + Intronic
1002318002 5:178356803-178356825 TGCAGCAGGAGGAGATGCCAGGG + Intronic
1003045464 6:2729361-2729383 GGCAGGAGACGAGGATGCCAAGG + Intronic
1003123245 6:3335301-3335323 GGCACCAGAGCAAGATGGCATGG - Intronic
1003325499 6:5087012-5087034 TGCACCAGAGGAAGGTGCCACGG + Exonic
1006965585 6:37981026-37981048 GGCACCAGGAGAACATAGCAAGG + Intronic
1010452944 6:76023214-76023236 GGCAGAAGGGGAAGATGCCAGGG - Intronic
1012908746 6:105096187-105096209 GACATCAGGCCTAGATGCCATGG + Intergenic
1018368489 6:163146310-163146332 GGCACCAGGGTAAGTGGCCAAGG - Intronic
1019023519 6:168939279-168939301 GGCACCAGGCAAGGATCCCTAGG - Intergenic
1019283112 7:210454-210476 AGCACCAGGGGAAGCTGCCCAGG - Intronic
1019727992 7:2613500-2613522 GGCCCCAGGCTCAGAAGCCAGGG + Exonic
1029105090 7:98168258-98168280 GGCACAAGACGAAGAATCCATGG + Intronic
1032478227 7:132226748-132226770 GGCACCAGATGAGGATTCCAGGG - Intronic
1039229905 8:35432843-35432865 GGCACCAGACAAAGCTGCCTTGG - Intronic
1049192366 8:141295356-141295378 GGCACCAGGCGGAACTCCCAGGG + Intronic
1051841693 9:21405063-21405085 GGGACTGGGCCAAGATGCCAGGG + Intergenic
1056210201 9:84358158-84358180 GGCACCAGGTTCAGAGGCCAGGG + Intergenic
1059531458 9:115039224-115039246 GGCACCAGGCAGAGAAGCCATGG - Intronic
1059767722 9:117399751-117399773 AACACCAGGCAGAGATGCCAAGG + Intronic
1060401654 9:123353209-123353231 GGCACAGGCCGGAGATGCCAGGG - Intergenic
1060723814 9:125994777-125994799 GGCACCAGGGAAAGGAGCCATGG - Intergenic
1061452753 9:130677541-130677563 GCCCCCAGGGGAAGGTGCCAAGG + Intronic
1186311118 X:8320216-8320238 GACACCAGCCCAAGATGACATGG + Intergenic
1186356938 X:8799921-8799943 GGCCCCAGGCAACGATGCCAGGG + Intronic
1186357261 X:8801036-8801058 GGCCCCAGGCAACGATGCCAGGG + Intronic
1186795645 X:13044416-13044438 GGCCCCAGGCGACAATGCCTGGG + Intronic
1190075613 X:47314867-47314889 TGTTCCAGGCGAAGATGCCAGGG + Intergenic
1191975438 X:66866037-66866059 GGCACTAGGCAAAGTTACCATGG - Intergenic
1193488385 X:82115872-82115894 GACACCAGCTGAGGATGCCAAGG - Intergenic
1193600681 X:83505829-83505851 GGTACCAGGAGCAGAGGCCATGG + Intergenic
1193957990 X:87886264-87886286 GACACCAGCTGAAGAAGCCAAGG - Intergenic
1194285770 X:92008139-92008161 GGCACCAGCCGGAGAAGTCAAGG - Intronic
1196141173 X:112265139-112265161 GCCACCAGGCCAGGAGGCCAAGG + Intergenic
1196706399 X:118721145-118721167 GGATCCTGGCTAAGATGCCAGGG + Intergenic
1200323761 X:155216593-155216615 GGCCTCAAGCCAAGATGCCAGGG - Intronic