ID: 1152251609

View in Genome Browser
Species Human (GRCh38)
Location 17:79215473-79215495
Sequence CTCAAGGAACAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 368}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152251609_1152251615 6 Left 1152251609 17:79215473-79215495 CCTTTCTCCATCTGTTCCTTGAG 0: 1
1: 0
2: 1
3: 41
4: 368
Right 1152251615 17:79215502-79215524 CCAAGCCTCTCCCCTTTCCAGGG 0: 1
1: 0
2: 1
3: 48
4: 338
1152251609_1152251613 5 Left 1152251609 17:79215473-79215495 CCTTTCTCCATCTGTTCCTTGAG 0: 1
1: 0
2: 1
3: 41
4: 368
Right 1152251613 17:79215501-79215523 GCCAAGCCTCTCCCCTTTCCAGG 0: 1
1: 0
2: 2
3: 39
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152251609 Original CRISPR CTCAAGGAACAGATGGAGAA AGG (reversed) Intronic
901014678 1:6221718-6221740 CTCAAGGAGCAGCTCGTGAAGGG + Exonic
903419296 1:23206884-23206906 CTCCAGGAACTGGTGGGGAATGG + Intergenic
904586850 1:31585452-31585474 ATGAAGGAGCTGATGGAGAATGG + Exonic
905678738 1:39850324-39850346 CTCAAGTAAAACAAGGAGAAAGG + Intronic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
909658312 1:78055175-78055197 CTCATGTAACAGAAGGGGAAAGG + Intronic
909845278 1:80386428-80386450 CTCAAGCAAGAGAAGGAAAATGG + Intergenic
910621088 1:89255548-89255570 CATAATGATCAGATGGAGAAGGG - Intergenic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
912482655 1:109995792-109995814 GTAAGAGAACAGATGGAGAATGG + Intronic
912540108 1:110408141-110408163 CTAAAGGACGAGATGGAGCAAGG + Intergenic
912779560 1:112532501-112532523 CTTAGGGGACAGTTGGAGAAGGG - Intronic
912931197 1:113963872-113963894 CTCAAGGATCAGAGGGTAAAAGG - Intronic
913630972 1:120709549-120709571 CAGAAGGAACATAAGGAGAATGG + Intergenic
915832499 1:159144151-159144173 CTCATGGAATAGAGGAAGAAAGG - Intronic
919297478 1:195721172-195721194 GTCAAGGAAAAGAAGAAGAAAGG + Intergenic
920320854 1:205121390-205121412 CTCATTGAACAGATGAATAAAGG - Intronic
920676086 1:208039706-208039728 ATCAAGCAGCAGATGGAGAAGGG - Exonic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
922101658 1:222482159-222482181 CCCAAGGAGCAGATGGAGAGAGG - Intergenic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922262738 1:223957275-223957297 CCCATGGAGCAGATGGAGAGAGG - Intergenic
924743670 1:246813167-246813189 CTGAAAGAACTGATGGAAAAAGG + Intergenic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1064437524 10:15324244-15324266 CTTTAGGAAAAGACGGAGAAAGG - Intronic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1066066573 10:31765376-31765398 CTCCAGGAGCAGATGGGGAGGGG - Intergenic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1066731755 10:38442796-38442818 CCCATGGAGCAGATGGAGAGAGG + Intergenic
1068076257 10:52258918-52258940 TTAAATGAACAGATGGGGAAAGG + Intronic
1068706570 10:60083081-60083103 CTCCAAGAACAGAAGGAGAGAGG - Intronic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1070341920 10:75505746-75505768 CTAAAGGAGCAGCTGGAGTAGGG - Intronic
1070576975 10:77686851-77686873 CTCATGGAACACATGTGGAAAGG - Intergenic
1073092210 10:100951757-100951779 CTAAAGGAACAAAAGGGGAATGG - Intronic
1073910721 10:108340547-108340569 GTCAAGGAAAAGATGAAGAAAGG + Intergenic
1074026740 10:109643679-109643701 CTCAAGGAACTTATGGATAAAGG - Intergenic
1074913713 10:117936105-117936127 CTCAGGGAGCAAATGGAGACTGG + Intergenic
1075303995 10:121351297-121351319 CTCAATGAACATTTGTAGAATGG + Intergenic
1076436596 10:130450260-130450282 CCCAAGGAAAAGAGGCAGAATGG - Intergenic
1077207087 11:1349892-1349914 CTCTGGGAACAGCTGGGGAAAGG - Intergenic
1077234502 11:1473353-1473375 CTCGAGGAGCAGATGCTGAAAGG - Intronic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1077847595 11:6042459-6042481 ATCAAGGAAGAAATGGAGAGGGG - Intergenic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1079721662 11:23822509-23822531 CTGAAGGAACAGAAGGCAAAAGG - Intergenic
1080794992 11:35554850-35554872 CACAAGGAACAGATGTAGTCAGG + Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1082273094 11:50193179-50193201 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1083589235 11:63883180-63883202 GTTAAGGAACTGATGAAGAAGGG + Intronic
1084726371 11:70945107-70945129 CTCAAGTAGAAGATGGAGATGGG - Intronic
1084982648 11:72839396-72839418 CTCAGGTAACAACTGGAGAAAGG + Intronic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1087402243 11:97682914-97682936 CTCAAGGAGAAGACTGAGAAAGG - Intergenic
1088847236 11:113679017-113679039 CTCAAGGATTAGATAGGGAATGG + Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1091344886 11:134845963-134845985 CTCCAGGTACAGATGGGGAGGGG - Intergenic
1091798226 12:3309232-3309254 CTTAAGGAACACAAGGAGAGGGG + Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092883904 12:12909166-12909188 CTCAAGGTACAGATGCAGCCTGG + Exonic
1093585229 12:20827961-20827983 CTCAAGGTACAGAGAGAGAGTGG + Intronic
1094238274 12:28192457-28192479 CACAAGGAACAGGTTGACAAAGG - Intronic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1094526356 12:31233845-31233867 CTCATGAAAAAGAGGGAGAAAGG - Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1095976578 12:47944129-47944151 GTCAAGGGTCAGAGGGAGAAGGG + Intergenic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1098008855 12:66028875-66028897 CACATGGAACAGGTGGTGAAAGG - Intergenic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1098485017 12:71010490-71010512 CCCAGGAACCAGATGGAGAAAGG - Intergenic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099237187 12:80095626-80095648 GACCAGGAACAGATGGGGAAGGG + Intergenic
1099506168 12:83478936-83478958 CTCAAAGCACACATGGAGACAGG - Intergenic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1100276731 12:93078256-93078278 CCCAAGTAACAGAGGGAGAGAGG + Intergenic
1100607279 12:96162111-96162133 CATAAGCACCAGATGGAGAAGGG - Intergenic
1102464287 12:113119442-113119464 CCCTGGGAACAGATGGGGAAAGG + Exonic
1102738432 12:115184063-115184085 ATCAATGAACAAATGGATAAAGG + Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106108715 13:26759010-26759032 ATCAAGGAATAGAGGGTGAAAGG + Exonic
1106576042 13:30976639-30976661 CTCAAGGCCCTGATGGAGTATGG - Intergenic
1106695948 13:32172594-32172616 GGCAATGAGCAGATGGAGAAAGG + Intronic
1106765075 13:32905561-32905583 TTCAAGGAAAAGATTGAGAATGG + Intergenic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1107778859 13:43878004-43878026 CACTAGGACCAGATGGTGAAAGG + Intronic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1108870911 13:54984661-54984683 CTAAAGCATGAGATGGAGAAGGG - Intergenic
1109464218 13:62707397-62707419 CTCAGGGACCTGATGGGGAAAGG + Intergenic
1110529469 13:76579511-76579533 CTCAAGGAACAGGAGCACAAAGG + Intergenic
1110656005 13:78000512-78000534 CTCAATTAAAAGATGCAGAATGG + Intergenic
1111394794 13:87651229-87651251 TTCAAGGAAAAGAGAGAGAAAGG + Intergenic
1111634378 13:90884449-90884471 CTCAAGGGAGAAAGGGAGAAGGG + Intergenic
1111854989 13:93626424-93626446 CTCAAGGAATAGATGGGGTGTGG - Intronic
1112021887 13:95378979-95379001 CTATAGGAACAAATGGGGAAGGG - Intergenic
1112431928 13:99357899-99357921 CTCAAGAAACAGTTGCAAAATGG - Intronic
1114732960 14:25013759-25013781 CACAAGGAAAAGATAGTGAAGGG + Intronic
1115631498 14:35250377-35250399 CTAAAGGACCTGATGTAGAAGGG - Intronic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1117218230 14:53574189-53574211 ACCAAGGAACAGATGGAATAAGG - Intergenic
1118045860 14:61970437-61970459 CTCAAGGAGCAGATGGGAAGAGG + Intergenic
1119499527 14:75112357-75112379 CTAGAGGAACAGAGGGATAAAGG + Intronic
1119948776 14:78722954-78722976 CAGAAGGAACAGATGTATAAAGG + Intronic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1123061893 14:105598229-105598251 CGTAAGGAACAGAGGGAAAATGG - Intergenic
1123086636 14:105719960-105719982 CGTAAGGAACAGAGGGAAAATGG - Intergenic
1124621167 15:31274896-31274918 CTCCCAGAACAGCTGGAGAAGGG + Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125390431 15:39186618-39186640 CTCCAGGAGCAGAGGAAGAACGG - Intergenic
1127252230 15:57251585-57251607 CCCAAAGAACAGATGGCAAAAGG - Intronic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1131601174 15:93850567-93850589 CTCAAAGAAAAGAGGGGGAATGG - Intergenic
1132974464 16:2704567-2704589 CCCAAGGAACAGAGAGAGACAGG + Intronic
1133587536 16:7210360-7210382 CTCAAGGATCACATGGACCACGG + Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134252155 16:12581942-12581964 CTCAAGAACGACATGGAGAATGG + Intergenic
1134782521 16:16911354-16911376 CTCTAGGAATACATGGTGAAGGG + Intergenic
1137523407 16:49212798-49212820 CTCAATGAACTGAAGGACAAAGG - Intergenic
1137529154 16:49266131-49266153 CTCAAGGAGGTGGTGGAGAAAGG + Intergenic
1138213192 16:55180273-55180295 CTTCAGGAACTGATGGGGAAGGG + Intergenic
1140125365 16:72113536-72113558 TCCCAGGAACAGAGGGAGAAAGG - Intronic
1140235082 16:73151745-73151767 CTCAAGGAACCCATGGAGATTGG - Intergenic
1140305919 16:73802550-73802572 CTCAGGGAAAAGAATGAGAAAGG + Intergenic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141154229 16:81585932-81585954 CTCCAGGAGCTCATGGAGAATGG - Intronic
1141551221 16:84807884-84807906 GTCAAGGAAGAGCTGGAGAGTGG + Intergenic
1141678815 16:85531940-85531962 CCCAGGGAGCTGATGGAGAAGGG + Intergenic
1143495545 17:7310320-7310342 CTCAAGGAACCCAAGGAGAGTGG - Intronic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1144577000 17:16435676-16435698 GTCAGGAAAGAGATGGAGAAAGG - Intronic
1144807167 17:17975771-17975793 CGGAAGGCACAGGTGGAGAAGGG + Intronic
1145109361 17:20148617-20148639 CTCAAGGCACTGATTGAGAGTGG - Intronic
1146438615 17:32874513-32874535 CTCAATGAAGACCTGGAGAAAGG - Intronic
1146667837 17:34716587-34716609 CCCAAGTAACAGATGGAAGAAGG - Intergenic
1146973184 17:37089249-37089271 ATAAAGGAAGAGAAGGAGAAGGG - Intronic
1148119117 17:45197445-45197467 CTCAGGGTAGAGCTGGAGAAGGG - Intergenic
1148164863 17:45476376-45476398 CACAAGGGACTGATGGAAAAAGG + Intronic
1150396081 17:64823039-64823061 CACAAGGAACTGATGAAAAAAGG + Intergenic
1150501613 17:65656334-65656356 CTCTAGGTACAGATTGATAAAGG - Intronic
1151140444 17:71986405-71986427 ATCAAAGTACAGATGGAGAGTGG - Intergenic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1151510370 17:74555263-74555285 CTCAGGAAACAGAATGAGAAGGG - Intergenic
1151672989 17:75582568-75582590 CCAAAGGCCCAGATGGAGAATGG - Intergenic
1151996580 17:77613150-77613172 CTCCAGGAGGTGATGGAGAAGGG + Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1153286155 18:3456433-3456455 CTCAGGCAAGAGAAGGAGAAGGG + Exonic
1154097100 18:11428567-11428589 CTAAAGGAAGAAATGGAAAAAGG - Intergenic
1154506914 18:15050118-15050140 CACAAAGTACAGATGGAGCATGG + Intergenic
1155692411 18:28641958-28641980 TTAAAGGAAGAGATGCAGAAGGG + Intergenic
1155698565 18:28714773-28714795 CTCAAAGCACAGTTGGAAAAAGG + Intergenic
1156176072 18:34548065-34548087 CTCAAGAAACAGAAGGTAAAAGG - Intronic
1156421554 18:36959594-36959616 GTCCAGGAACAGGAGGAGAAAGG - Intronic
1156585197 18:38424283-38424305 TTCAAGAAAGAGATGGAGGAGGG - Intergenic
1156834580 18:41537300-41537322 CACAAGGAACAAAAAGAGAAGGG + Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157649221 18:49311176-49311198 CACAAGGCACAGCTGGAGAAGGG + Intronic
1157881941 18:51329022-51329044 CTCAGGAAAGAGATGAAGAAAGG + Intergenic
1159206178 18:65255817-65255839 CTTCAAGAACAGATAGAGAAAGG - Intergenic
1160268765 18:77364738-77364760 CTCAAGGAAAACATGGTGACAGG + Intergenic
1161163175 19:2771889-2771911 CGGAAGGAGCAGGTGGAGAAGGG - Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161677613 19:5661266-5661288 CTCCAGGAAATGTTGGAGAAAGG + Intronic
1162521864 19:11185638-11185660 CTCAGAGAAAAAATGGAGAAAGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166161812 19:40959625-40959647 CACAAAGAAGAGATGGAGACAGG - Intergenic
1166523972 19:43499437-43499459 CTCCTGGGACAGAGGGAGAAGGG + Intronic
1166908969 19:46137490-46137512 CTCAGGCAAGAGAAGGAGAAGGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167267083 19:48488593-48488615 CTCAAGGAACAGAAGGACACTGG - Intronic
1167342239 19:48922711-48922733 CTCTTGGGACAGACGGAGAAGGG - Exonic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168373754 19:55858444-55858466 CTGAAGCAAGAGATGCAGAAAGG + Exonic
1168473212 19:56657873-56657895 CCCAAGTAAAGGATGGAGAATGG + Intergenic
925103850 2:1272556-1272578 CCCAGGGAACAGGTGTAGAAAGG + Intronic
925103863 2:1272610-1272632 CCCAGGGAACAGGTGTAGAAAGG + Intronic
927930376 2:27039950-27039972 CCCAAGAAACAGCTGGGGAAAGG - Intronic
928129924 2:28642013-28642035 CTCCAGGAACAGATGGCAAAAGG - Intronic
928163879 2:28955293-28955315 GGCATGGAGCAGATGGAGAAAGG - Intergenic
930166183 2:48205825-48205847 CGGAAGGAACAGGAGGAGAAGGG + Intergenic
931312759 2:61097978-61098000 CTCTAAGAAGAGATGGAAAATGG - Intronic
932305941 2:70704410-70704432 ATCCAGGAGCAGATGAAGAAGGG - Exonic
932844243 2:75119078-75119100 CTCATGGAACAGATGCAGCAGGG + Intronic
933291056 2:80438735-80438757 CTAAAGGAACAGATGGAATGAGG - Intronic
933743174 2:85550930-85550952 TTAAAGGAAAAGGTGGAGAATGG - Exonic
934945209 2:98536254-98536276 GTCCAGGGACAGATGGGGAAAGG + Intronic
936625519 2:114144175-114144197 CTCAAGGCAGTGTTGGAGAATGG + Intergenic
937076381 2:119110280-119110302 CTCAGGGAACTGATGGTCAATGG - Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
940094418 2:149958138-149958160 CAAAAAGAACACATGGAGAAAGG - Intergenic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
941549590 2:166898262-166898284 ATCAAGGAACATATGTTGAAGGG + Intronic
941872453 2:170400068-170400090 GTCCAGGAAAAGAGGGAGAATGG + Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942053453 2:172162263-172162285 CTCAAGCAGAAGATGGAGACAGG - Intergenic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943808209 2:192150728-192150750 CTCAGGGAACAAATGGAGGATGG + Intronic
946162067 2:217841376-217841398 CACAGGGAACAGATGGACATGGG + Intronic
947064394 2:226205532-226205554 TTCATGGAACAGAGGGAGAAAGG + Intergenic
947324931 2:228963579-228963601 CCCAAGGACCAGATGGAGTATGG - Intronic
947384827 2:229580582-229580604 ATAAAGGAACAAATGGAGAGAGG + Intronic
947982497 2:234422296-234422318 CTCAAGGAACAGAGACAGCATGG - Intergenic
1169740218 20:8885164-8885186 GTCAAGGAAGACAGGGAGAAAGG - Intronic
1170571562 20:17635633-17635655 CTTCAGGAGCAGCTGGAGAATGG - Exonic
1170585946 20:17734123-17734145 CACAAGGACCACATGGAGGAAGG - Intronic
1170781050 20:19425688-19425710 GTCAAGCTACAAATGGAGAATGG - Intronic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1171472111 20:25380536-25380558 CTCAAGGAAGAAGTGGAGAGAGG - Intronic
1172353201 20:34260134-34260156 GACAAGGAACAGAAGGAGATTGG - Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174975932 20:55333916-55333938 TACAAGAAGCAGATGGAGAAAGG - Intergenic
1174993047 20:55534639-55534661 TTCAAGGAACAAAAGAAGAAAGG - Intergenic
1175414249 20:58791230-58791252 CTCGAGGAACAGGGGGAGATGGG - Intergenic
1175750558 20:61494087-61494109 CTCCAGGAGCAGGTGGAGACAGG + Intronic
1176003476 20:62845766-62845788 ACCAAGGAAGAGCTGGAGAATGG + Intronic
1176884398 21:14237040-14237062 CTGAGGGAATAAATGGAGAATGG + Intergenic
1177606534 21:23385941-23385963 CTCAATGATCAGATGGTAAAAGG + Intergenic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
1182266222 22:29117706-29117728 CATGAGGAACAAATGGAGAAAGG + Intronic
1183991057 22:41597271-41597293 TTCAAGGACAAGATTGAGAAGGG + Intergenic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
949327486 3:2882846-2882868 CTTAAGGAAAAAAAGGAGAAGGG - Intronic
949431817 3:3985121-3985143 CCCATGGAACAGATAGGGAAGGG - Intronic
949780505 3:7681588-7681610 CTAAAGGAACATACTGAGAAGGG + Intronic
949940457 3:9150466-9150488 TTCCATGCACAGATGGAGAAAGG + Intronic
950147943 3:10665077-10665099 CTCAAAGATCAGATGGTAAAGGG - Intronic
950311202 3:11959504-11959526 ATTAAGGAAAAGAAGGAGAATGG - Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954102479 3:48386253-48386275 TGCCAGGAACACATGGAGAAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
959014897 3:101122681-101122703 CTCATGGTATAGTTGGAGAAGGG + Intergenic
959313452 3:104771493-104771515 CTCAAGGTTCAGTTGGAGCATGG + Intergenic
959392499 3:105793404-105793426 CATAAGGAACTGATGGAGGAAGG + Intronic
959762573 3:109984721-109984743 CTCAAGGAATAAACAGAGAATGG - Intergenic
960545472 3:118909581-118909603 ATTAAGGCATAGATGGAGAAGGG + Intronic
960574413 3:119215724-119215746 ATCAAGGAACACATAAAGAAAGG + Intronic
961347427 3:126273287-126273309 CTCAAAGAGCAGCTGCAGAAAGG + Intergenic
961456669 3:127027979-127028001 ATCAAGCAGCAGATGGAGAAGGG + Exonic
961457369 3:127030895-127030917 CTCACGGAGCAGCTGGAGTACGG + Intronic
961494028 3:127277634-127277656 CTTAAGGAAGAAGTGGAGAATGG - Intergenic
961957677 3:130821005-130821027 CAAAAGGGGCAGATGGAGAAAGG + Intergenic
962044211 3:131738507-131738529 TTTAAGCAACAGATGGGGAAGGG + Intronic
962057115 3:131884350-131884372 CTCAAGTAGTAGATGGAGAGTGG + Intronic
962449151 3:135497463-135497485 TTCACTGACCAGATGGAGAAAGG + Intergenic
962779938 3:138703753-138703775 CTAAAGGAAGAAGTGGAGAATGG - Intronic
962870973 3:139492540-139492562 CACAAGGTACTGCTGGAGAATGG + Intergenic
964170563 3:153765363-153765385 GTCAAGGAACAGTTCTAGAAAGG + Intergenic
964514531 3:157493518-157493540 CTCATGGAACAGAAGAAGAATGG - Intronic
964890395 3:161527623-161527645 CTTGAGGATAAGATGGAGAAGGG + Intergenic
965634008 3:170762691-170762713 CTTAAGGAAGACATGGAAAAAGG + Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966266222 3:178047709-178047731 CGAAAGGAAAAGAAGGAGAAAGG + Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968190376 3:196662900-196662922 GTCATTGAACAGAGGGAGAAGGG - Intronic
972371332 4:38426315-38426337 CTCAAGAAAGAGATTGAGCATGG - Intergenic
972457173 4:39265891-39265913 CTCTAGCAACAAATGAAGAAAGG + Intronic
975624325 4:76328725-76328747 TTCAAGGAACAGTTTGAGAGTGG + Intronic
976513706 4:85939673-85939695 CCCAAGGAAGCGATGAAGAAAGG - Intronic
976782597 4:88777609-88777631 GGCAAGGGACAGAGGGAGAAAGG + Intronic
977356835 4:95956274-95956296 CTCAAGGAACATTAGGAAAAAGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979258140 4:118625423-118625445 CCCATGGAGCAGATGGAGAGAGG + Intergenic
979330206 4:119415145-119415167 CCCATGGAGCAGATGGAGAGAGG - Intergenic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
984145141 4:176051293-176051315 CTCAAGGAACTGATATAGGAAGG - Intergenic
984550490 4:181153485-181153507 CTCAGGGGAGAGATGAAGAAAGG - Intergenic
985075383 4:186208944-186208966 ATAAAGGAACAGAAGGAAAAAGG - Exonic
985314430 4:188640493-188640515 AGGAAGGGACAGATGGAGAAAGG - Intergenic
986022619 5:3819134-3819156 GTCAAGGAACAGCTGGGGAGAGG - Intergenic
986049858 5:4079442-4079464 ACCAAGGAACAGAGGGAGAAGGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986477506 5:8150680-8150702 CTCAAGGAATAAATGGGTAAAGG + Intergenic
986539002 5:8824637-8824659 CTCAAGGAACTGATGTAAGAAGG + Intergenic
987739485 5:21887631-21887653 TACAAGGAACAGTTGAAGAAGGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988954412 5:36300360-36300382 CTCCAGGAACCGATGCAGAGAGG + Intronic
988983134 5:36591590-36591612 CTCATGGAACAGGGGCAGAATGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
991328980 5:65471020-65471042 CTCAAGGAGAAGACGGAGTATGG - Exonic
992021609 5:72630339-72630361 ATCAAGAAACAGGTGGTGAAGGG - Intergenic
992259744 5:74957771-74957793 TTCAAGGAAAAAATGGAGAAGGG + Intergenic
992508387 5:77409868-77409890 CTCAAGTTCCAGGTGGAGAATGG - Intronic
992762667 5:79964863-79964885 CTCAAGGAAGAGATTGAGGCTGG - Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
992901018 5:81296417-81296439 CTCAAGGAGCAAATGAAGGAAGG - Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
993772289 5:91944482-91944504 GCCAAGGAACATATGAAGAAAGG + Intergenic
994666431 5:102711010-102711032 CTAAGGGAAAAGATGGATAAAGG + Intergenic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997507568 5:134430177-134430199 CCTAAGGGACAGATGGAGAAAGG + Intergenic
997605932 5:135176075-135176097 CCCAGGGAACATATGCAGAAGGG - Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
997729457 5:136156595-136156617 CTGAAGGAACTGATGAAGAAAGG + Intronic
997792607 5:136774512-136774534 ATCAAGGAACTGATTGACAATGG - Intergenic
999641686 5:153679134-153679156 CTCAAAGAACAGCTGATGAAGGG - Intronic
999833613 5:155344598-155344620 CTCAGGGTACAGCTGGAGATGGG + Intergenic
999874740 5:155791255-155791277 CTCATGGAACAGAGTCAGAATGG + Intergenic
999960747 5:156753269-156753291 CTCACTGAAGAGATGCAGAAAGG - Intronic
1001489656 5:172146439-172146461 CTCAAGAAACACAAGGAAAACGG + Intronic
1001720830 5:173855721-173855743 CTCAAGTAAAAGGTGGAAAATGG - Intergenic
1001930361 5:175668620-175668642 CTCCAGGACCTGATGAAGAAAGG - Intronic
1003704122 6:8505438-8505460 TTAAAAGAAGAGATGGAGAATGG + Intergenic
1004504898 6:16239455-16239477 CCTAAGGAACAGGTGGAGACCGG + Intronic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1006285836 6:33093142-33093164 ATGAAGGAGAAGATGGAGAATGG + Intergenic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007389420 6:41541884-41541906 CACAAGGGAAGGATGGAGAATGG + Intergenic
1007926481 6:45653537-45653559 TTCAAGGAATAGTTGGAGTAGGG + Intronic
1009198618 6:60717263-60717285 CTCAAGGCAAGGCTGGAGAATGG + Intergenic
1009306156 6:62091753-62091775 CTCATGGAGCAGATCGAGGATGG - Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1011433471 6:87313212-87313234 ATCAAGGAACAGGAGAAGAAAGG + Intronic
1012999642 6:106009381-106009403 CTGAAGGAAAAAATGTAGAAAGG + Intergenic
1014241172 6:119019153-119019175 GTAAGGGAACAGATGGAGGAGGG + Intronic
1018857276 6:167683720-167683742 CCCAAGGCAGAGATGAAGAATGG - Intergenic
1020158280 7:5746074-5746096 CTCAAGGAACACAGGAAAAACGG + Intronic
1020803182 7:12756954-12756976 CTTCACGAAAAGATGGAGAAAGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022292123 7:29014838-29014860 CTGAAGGAACAGTTCCAGAAGGG - Intronic
1022717239 7:32909720-32909742 CCTAAGGAACAGATGGAGTCTGG - Intergenic
1022959849 7:35416005-35416027 CTCTAGGAAGAGATGGAGGCTGG - Intergenic
1023060808 7:36323998-36324020 CTCATGGGACATATGGAGAAAGG - Intergenic
1023504168 7:40882913-40882935 ACGAAGGAACAGATGGAGATGGG - Intergenic
1025625143 7:63214541-63214563 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1026070502 7:67114886-67114908 GTCAAGGAGCAGAGGAAGAATGG - Intronic
1026110511 7:67455399-67455421 CCAAAGGAAGGGATGGAGAAAGG + Intergenic
1026462142 7:70623902-70623924 TTCAGGGAAGAGCTGGAGAACGG - Intronic
1026706395 7:72697394-72697416 GTCAAGGAGCAGAGGAAGAATGG + Intronic
1027333699 7:77126678-77126700 CACAAGGACCAGCTGCAGAAAGG - Intronic
1029782095 7:102744654-102744676 CACAAGGACCAGCTGCAGAAAGG + Intergenic
1030020043 7:105264691-105264713 CTCAGGGAACAGATACGGAAAGG - Intronic
1030207074 7:106961426-106961448 CTCAATGGACATATGAAGAAGGG + Intergenic
1030217256 7:107057121-107057143 TTCAAGCAACAGAGGGAGGAAGG - Intronic
1032468921 7:132164227-132164249 ATCAAGCAGCAGATGGAGAAGGG - Exonic
1032599818 7:133281657-133281679 ATCAAGGAAAAGATAAAGAAGGG - Intronic
1032625124 7:133583689-133583711 CTGAAGGGAGAGATGGGGAAAGG + Intronic
1033883428 7:145915929-145915951 CTAAAGGAAGAAAGGGAGAATGG + Intergenic
1034234626 7:149557100-149557122 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034239406 7:149598332-149598354 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035395352 7:158531365-158531387 CTCCATGAACTGATGGGGAAGGG + Intronic
1035950792 8:4018474-4018496 CACAAGGAGCAGGTGGAGGAAGG + Intronic
1036076665 8:5509698-5509720 ATCAAGGTAGAGATGGATAATGG + Intergenic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1036801174 8:11793943-11793965 CTCATGGAAGAGGTGGGGAAGGG + Intergenic
1038648456 8:29380824-29380846 CTCAAGGAACAGGTTTAGAGGGG + Intergenic
1038976130 8:32698298-32698320 TTCAAGGAACAGCTGGAAAATGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041205473 8:55494722-55494744 CTCAAAGAGAGGATGGAGAAAGG - Intronic
1042514470 8:69644976-69644998 CTCAAACAAGAGATGGAGCAGGG + Intronic
1042863930 8:73340361-73340383 ATAAAGGAAGAGATGAAGAAAGG + Intergenic
1042863934 8:73340409-73340431 ATAAAGGAAGAGATGAAGAAAGG + Intergenic
1043158330 8:76814878-76814900 CTCAAAGAACAGAAGCACAAAGG - Intronic
1043536518 8:81210734-81210756 CTCCAGGAACTGGAGGAGAAAGG + Intergenic
1044913230 8:97084380-97084402 CTCAAGAAAAAGATGGGGGAGGG - Intronic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047623034 8:126627732-126627754 CCTGAGGAACATATGGAGAAAGG - Intergenic
1047915754 8:129582252-129582274 CTCAAGGTGCAGAGGGAGATTGG + Intergenic
1048443024 8:134473922-134473944 CTCAGGAAAGAGATGCAGAATGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1050752035 9:8950378-8950400 ATTTAGGAACATATGGAGAAGGG + Intronic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1051857175 9:21581856-21581878 CTGAGGGAACAAAAGGAGAAAGG - Intergenic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1052991326 9:34520879-34520901 CTTAAGGAACAGAACAAGAAGGG - Exonic
1053036487 9:34831158-34831180 CACAATGAAGAGATGTAGAAGGG + Intergenic
1053139423 9:35673585-35673607 CTCCAGGCACAGAAGGGGAAAGG - Intronic
1053185815 9:36015406-36015428 CTCAAGGAACAGACTGAGATAGG + Intergenic
1053324013 9:37125632-37125654 ACCAAGGAAAAGATGAAGAATGG + Intronic
1055865000 9:80802413-80802435 CTCACTGAACAGATGGAGGCAGG + Intergenic
1055870696 9:80875896-80875918 CTAAAGCAATAGATGAAGAAAGG + Intergenic
1057350465 9:94292997-94293019 CTCATCGAACAGCTGGAGCAAGG + Exonic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1058794831 9:108488062-108488084 CTCAAGGAAAGGATTGACAAGGG - Intergenic
1059009596 9:110442127-110442149 CCCAAGGAGCTGATGTAGAATGG - Intronic
1059744382 9:117185960-117185982 CTCAAGGAACAGAAAGGTAAAGG + Intronic
1059973334 9:119690127-119690149 CTCAGGGAGGAGAAGGAGAATGG - Intergenic
1060055187 9:120407098-120407120 CTCAAGGAACAGCTGGCAAGGGG - Exonic
1061523665 9:131139035-131139057 CACCAGGAACAGATAGAGAGGGG + Intronic
1062535581 9:137019835-137019857 CTTAAGGGACACATGGAGACAGG - Intronic
1186011184 X:5134923-5134945 GTGAAGGAAAAGAAGGAGAATGG + Intergenic
1187707778 X:22024968-22024990 ATCAAGGAGCAGAAGGAGCAAGG - Intergenic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1189424101 X:40882610-40882632 CTTCAGGTACAGATGGGGAAAGG + Intergenic
1189777183 X:44480940-44480962 AGCAAGAAACAAATGGAGAAAGG + Intergenic
1190526976 X:51338270-51338292 CTTAAAGAACAGAAGTAGAAGGG - Intergenic
1193503197 X:82305977-82305999 CCCTAGGAAAAGATGGAGCAGGG - Intergenic
1193538371 X:82739833-82739855 ATCTAGGAACAGATGTAGACAGG + Intergenic
1194272489 X:91834460-91834482 TTCAAGGAACAGCTTGAGAAGGG - Intronic
1195744848 X:108106555-108106577 CTAAAGGAACGGATGGCTAAAGG - Intronic
1196325790 X:114400734-114400756 CCCAAGGAAGGGAGGGAGAAAGG + Intergenic
1196456769 X:115896399-115896421 CTCAGAGAAGAGATGGAGACTGG + Intergenic
1198136398 X:133755326-133755348 CCCAAGGAACTGTTGGAGTATGG - Intronic
1198184704 X:134242183-134242205 TTCAAAGAACAGAAAGAGAAAGG - Intronic
1200236185 X:154468862-154468884 ATCAAGCAGCAGATGGAGAAGGG + Exonic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200589733 Y:5055888-5055910 TTCAAGGAACAGCTTGAGAAGGG - Intronic
1201620990 Y:15957522-15957544 CTAAAGGAACAGATGGCCAGAGG - Intergenic