ID: 1152252354

View in Genome Browser
Species Human (GRCh38)
Location 17:79218656-79218678
Sequence CCTCCCTGCATCTCGGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152252354_1152252368 28 Left 1152252354 17:79218656-79218678 CCGGGAGCCGAGATGCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1152252368 17:79218707-79218729 AGGCTCAGGGAATGTCTTTGGGG 0: 1
1: 0
2: 1
3: 24
4: 238
1152252354_1152252360 -10 Left 1152252354 17:79218656-79218678 CCGGGAGCCGAGATGCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1152252360 17:79218669-79218691 TGCAGGGAGGTCAGGGAACAGGG 0: 1
1: 0
2: 4
3: 47
4: 585
1152252354_1152252366 26 Left 1152252354 17:79218656-79218678 CCGGGAGCCGAGATGCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1152252366 17:79218705-79218727 GCAGGCTCAGGGAATGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 187
1152252354_1152252362 14 Left 1152252354 17:79218656-79218678 CCGGGAGCCGAGATGCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1152252362 17:79218693-79218715 TCCATTCTGCCTGCAGGCTCAGG 0: 1
1: 0
2: 1
3: 35
4: 310
1152252354_1152252367 27 Left 1152252354 17:79218656-79218678 CCGGGAGCCGAGATGCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1152252367 17:79218706-79218728 CAGGCTCAGGGAATGTCTTTGGG 0: 1
1: 0
2: 0
3: 15
4: 181
1152252354_1152252361 8 Left 1152252354 17:79218656-79218678 CCGGGAGCCGAGATGCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1152252361 17:79218687-79218709 CAGGGTTCCATTCTGCCTGCAGG 0: 1
1: 0
2: 1
3: 22
4: 238
1152252354_1152252364 15 Left 1152252354 17:79218656-79218678 CCGGGAGCCGAGATGCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 254
Right 1152252364 17:79218694-79218716 CCATTCTGCCTGCAGGCTCAGGG 0: 1
1: 0
2: 2
3: 18
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152252354 Original CRISPR CCTCCCTGCATCTCGGCTCC CGG (reversed) Intronic
900165753 1:1243726-1243748 TCTCCCTGCCTCCCGGCTACCGG + Intronic
900323503 1:2096166-2096188 CCTCCCTGCGTCTGGCCTCTGGG + Intronic
900354137 1:2251872-2251894 CCTCCCCGCCCCTTGGCTCCGGG + Intronic
900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG + Intergenic
900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG + Intergenic
900703995 1:4067658-4067680 CCTCCATGCCCCTCTGCTCCTGG - Intergenic
900819850 1:4878287-4878309 GCTGCCTTCATCTCAGCTCCTGG - Intergenic
901230933 1:7641406-7641428 CCTCCCTCCAGCCCAGCTCCAGG - Intronic
904888218 1:33757945-33757967 CCATCCTCCATATCGGCTCCAGG + Intronic
905959888 1:42035280-42035302 CCTGCCGGCATCCCGGCTCTGGG - Intronic
906536836 1:46555408-46555430 CCTCCCTGGTCCTTGGCTCCGGG - Intergenic
910257338 1:85260742-85260764 CCTCCCTGGAAGTAGGCTCCAGG + Intergenic
913599581 1:120410362-120410384 CCTTCCTGTATCTCACCTCCAGG + Intergenic
914087800 1:144469253-144469275 CCTTCCTGTATCTCACCTCCAGG - Intergenic
914314362 1:146495771-146495793 CCTTCCTGTATCTCACCTCCAGG - Intergenic
914499987 1:148237610-148237632 CCTTCCTGTATCTCACCTCCAGG + Intergenic
914591292 1:149108195-149108217 CCTTCCTGTATCTCACCTCCAGG - Intergenic
915475057 1:156148343-156148365 CCTCTCTGCATCTCGGCTGTGGG - Intronic
916130182 1:161605975-161605997 CCGCCCAGCCTCTCGGCTCACGG + Intronic
916652148 1:166842552-166842574 CATCCCCTCATCTTGGCTCCTGG - Intronic
919661114 1:200248716-200248738 CCTCCCTGCTTCACAGCTCCTGG + Intergenic
924229561 1:241952140-241952162 CCTCCCTTCATGCCAGCTCCTGG + Intergenic
1063147120 10:3305686-3305708 CCTTCTTGCATCTGGGCTTCTGG + Intergenic
1063205436 10:3826533-3826555 CCATCCTGCAGATCGGCTCCAGG + Intergenic
1063302112 10:4859366-4859388 CCTCCCTGCCTCTTGGCCTCTGG - Intergenic
1063664856 10:8055116-8055138 CGTCCCTGCAGCCCGGCTCGCGG - Intronic
1064248199 10:13686232-13686254 CCTCCCTGTATCTCTGTTCCTGG - Intronic
1070349307 10:75576396-75576418 CCTCCCTGCAACAGGGCACCTGG + Intronic
1070527956 10:77311395-77311417 CCTCCCTGCTTCTCGGCACCAGG + Intronic
1070770618 10:79080251-79080273 CCTCCCTGCGCCTCAGATCCTGG + Intronic
1071504171 10:86222789-86222811 CCCCCCTTCAGCTGGGCTCCAGG - Intronic
1072759341 10:98042909-98042931 CCTCCCTTCACCTCTGGTCCTGG - Intergenic
1073033742 10:100548603-100548625 CCCCACTGCATCTGGGCTGCAGG + Exonic
1074182553 10:111077200-111077222 CCTGCCTCCGTCGCGGCTCCTGG + Exonic
1076565455 10:131395544-131395566 CCTCCCTGGACCTCAGCTGCAGG - Intergenic
1076596383 10:131625210-131625232 GGTCCCTGCATCCGGGCTCCAGG - Intergenic
1076616771 10:131760120-131760142 CCTGCCTGCATGTCGGAGCCTGG + Intergenic
1076902780 10:133347976-133347998 CCTCCCTGCCCCTCCTCTCCTGG + Intronic
1077709287 11:4519809-4519831 CCTCCCCGCTTCTGGGCTCTTGG + Intergenic
1078415663 11:11162687-11162709 TCTCCCTGCAGCTGGGCCCCAGG + Intergenic
1078616438 11:12870392-12870414 TCTCCCAGCTTCTCTGCTCCTGG - Intronic
1079125785 11:17718043-17718065 CCTGCCTGGATCTCCCCTCCTGG - Intergenic
1080248673 11:30208617-30208639 TCTCCCTCCATCTTGGCTACAGG + Intergenic
1083613562 11:64015643-64015665 CCTCCCCACATCTCTGCACCAGG - Intronic
1083901758 11:65646745-65646767 GCTGCCTGCAGCTCGGCGCCTGG - Exonic
1084214915 11:67641938-67641960 CCTCCCTGCATCTCTGCAGTTGG + Intergenic
1084438555 11:69157786-69157808 CCCCACTGCATCTCGGTTCCAGG + Intergenic
1084609433 11:70192893-70192915 CCTCCCTGCCCCTCTGCTCCTGG - Intergenic
1085276334 11:75302527-75302549 TCTTCCTGCATCTCAGCCCCAGG - Intronic
1088876593 11:113941581-113941603 ACCCCCTGCATCTGTGCTCCTGG + Intronic
1089701592 11:120247794-120247816 CCTCTCTGGATCATGGCTCCTGG - Intronic
1089731889 11:120524526-120524548 CCTACCTGGACCTTGGCTCCAGG + Intronic
1089978247 11:122751345-122751367 CCTCACTGCTTCTTAGCTCCTGG - Intronic
1090611459 11:128474713-128474735 CCTGCCAGCATCTCAGCTGCTGG + Intronic
1090667782 11:128926188-128926210 CCTCCTTCCAGCTCGGCTGCAGG - Intergenic
1091057251 11:132430514-132430536 CCAGCCTGCCTCGCGGCTCCTGG - Intronic
1091628529 12:2140971-2140993 CCTCCCTGCCTACCCGCTCCAGG - Intronic
1091691261 12:2599002-2599024 CCTCCCTGCATCTGAAGTCCGGG - Intronic
1091903491 12:4164641-4164663 TCTTCCTGCCTCTCGGCTCCGGG + Intergenic
1094476647 12:30845665-30845687 CCTCCCTGCTTCCCGGGTCCTGG - Intergenic
1095838852 12:46669815-46669837 CCTCTCTGCGTCCCAGCTCCTGG - Intergenic
1095976559 12:47944067-47944089 GCTCCCTGCTTCCCAGCTCCTGG - Intergenic
1096775178 12:53959388-53959410 CCCCCCTCCATCTCAGCCCCGGG - Intergenic
1097076232 12:56397003-56397025 CCTCTCTGCATCTCTGCAGCTGG + Intergenic
1097712816 12:62934398-62934420 TCTCCCTGCTTCTCGGCCTCAGG - Intronic
1101197681 12:102402140-102402162 CCTCTCTGAATCTTGGCTGCTGG - Intronic
1102027608 12:109722528-109722550 CCTCCTTGCAGCTGGGCCCCTGG - Intronic
1102647658 12:114414295-114414317 CCGCCCGGCCTCTCGGTTCCGGG + Intergenic
1103953744 12:124565847-124565869 CCACTCTGCACCTCAGCTCCTGG - Intronic
1103994861 12:124822496-124822518 CCTCCCTCCATCCCGGTCCCCGG - Intronic
1104072971 12:125362616-125362638 TCTCCCTGCCCCTTGGCTCCTGG + Intronic
1104682533 12:130761496-130761518 CCTTCCTGCAGCTCCGTTCCAGG - Intergenic
1108510962 13:51155584-51155606 CCTCTCTCAATCTCTGCTCCTGG + Intergenic
1118776865 14:68978866-68978888 CCTGCCGGGCTCTCGGCTCCGGG - Intronic
1118783382 14:69025370-69025392 CCTCCCTCCATCTTGACTCAAGG + Intergenic
1119310907 14:73645399-73645421 CCTCCCTGCATCTCGACGGGGGG - Intronic
1121240890 14:92429201-92429223 CCTCCCTGCACCCCTACTCCTGG - Intronic
1122523552 14:102363422-102363444 CCACCCTGCATCCCGGCTGCCGG + Intronic
1122879437 14:104683444-104683466 CCTCCCTGCCCCACGGCTCCAGG - Intergenic
1122909403 14:104819727-104819749 CCTCCGGGCACCTCGGCCCCTGG - Intergenic
1126794103 15:52245727-52245749 CATCACTGCATCTCGGCTGCTGG - Intronic
1128514829 15:68335659-68335681 CTTCCCTCCATCCCGGCCCCAGG + Intronic
1129697447 15:77748622-77748644 CCTCCCCACAACTCTGCTCCAGG + Intronic
1129817119 15:78565257-78565279 CCTTCCTGGAACTCTGCTCCAGG + Intergenic
1131176220 15:90211341-90211363 CCTCACAGCATCTGTGCTCCTGG - Intronic
1131826022 15:96322958-96322980 CCTCCCCGCGTCGCGGCTCAGGG - Intergenic
1131966577 15:97850471-97850493 CCTCCCCGCATCCCCGCTACAGG + Intergenic
1132684167 16:1155341-1155363 CGGGCCTGCACCTCGGCTCCCGG - Intronic
1133223349 16:4328526-4328548 CCTCCCAGCATCCCTGTTCCAGG - Intronic
1133224586 16:4334850-4334872 TCTTCCTGCCCCTCGGCTCCGGG + Exonic
1134246722 16:12545657-12545679 CTTCCCAGCTTCTAGGCTCCAGG + Intronic
1136933485 16:34437786-34437808 CCTCCCGGCGTCCTGGCTCCGGG + Intergenic
1136971087 16:34974028-34974050 CCTCCCGGCGTCCTGGCTCCGGG - Intergenic
1139432428 16:66918269-66918291 CCACCCTGCTTCTAGGCTCTTGG + Intronic
1140482859 16:75271839-75271861 CCTCCCCCCATGTCAGCTCCTGG - Intergenic
1141308382 16:82888547-82888569 CCTCCATGCAGCACTGCTCCAGG + Intronic
1141461269 16:84179997-84180019 CCTCCCTGCATTTCCTCTGCTGG - Exonic
1142668056 17:1473659-1473681 CCTCCCTGCATCTGGCACCCTGG + Intronic
1142689004 17:1593530-1593552 CCTCCCTATCTCTCTGCTCCTGG + Intronic
1143323061 17:6080550-6080572 CATCCTTGCATCCTGGCTCCTGG - Exonic
1143735605 17:8910116-8910138 CCTCCCTGCTCCTCTGCCCCAGG - Intronic
1145239416 17:21231445-21231467 CCTCCCTACATCTCGGTGCCTGG + Intergenic
1146275516 17:31513427-31513449 CCTTCCAGCATCTCCCCTCCAGG + Intronic
1146886384 17:36473745-36473767 CCTCCCTGCTTCACGGGTACAGG - Intergenic
1146989798 17:37259359-37259381 TCTCCCTGCAGCACAGCTCCAGG - Exonic
1147548567 17:41422107-41422129 TCACCGTGCATCTCAGCTCCAGG + Exonic
1147550509 17:41438529-41438551 TCACCGTGCATCTCAGCTCCAGG + Exonic
1147882065 17:43660548-43660570 CTTCTCTGCCTCTAGGCTCCTGG + Intronic
1147910862 17:43855185-43855207 GCTCCTTGCGTCTCGTCTCCAGG + Exonic
1147978424 17:44260752-44260774 CCTCCATCCATCTCAGCTCCTGG + Exonic
1148397799 17:47324039-47324061 CCTCCCTTCCTCTCGGCTGGAGG - Exonic
1148541366 17:48483189-48483211 ACTCCCAGCATCCCAGCTCCTGG - Intergenic
1148913127 17:50953982-50954004 CCTCCCTGCCACTCAGCTCAGGG + Intergenic
1150764366 17:67992035-67992057 GCTCCCTACAGCTCTGCTCCAGG - Exonic
1150952669 17:69821196-69821218 CCTGCCTGCTTCTGGGCCCCAGG - Intergenic
1151310547 17:73290079-73290101 CCTGCCTGCACCCCGACTCCTGG + Intronic
1151684954 17:75640849-75640871 CCTTCCTGCCTCTCCGCTCAGGG - Exonic
1151820680 17:76495128-76495150 CCTCTCTGCATCCCGGCAGCCGG + Intronic
1151924638 17:77186141-77186163 GCTCCCTCCATCCCAGCTCCTGG + Intronic
1151974981 17:77479676-77479698 CCTCCCTCGCTCTGGGCTCCAGG + Intronic
1152252354 17:79218656-79218678 CCTCCCTGCATCTCGGCTCCCGG - Intronic
1152421081 17:80193570-80193592 CCTCCCTCCCTCCCGGCTCCCGG - Intronic
1152438184 17:80288764-80288786 CCTTCCTGCCTGCCGGCTCCAGG + Intronic
1152738587 17:82009210-82009232 CCTCCCGGCATCTTCGCGCCAGG + Intronic
1153244608 18:3061515-3061537 CCTCCTTGCAATTCAGCTCCTGG + Intergenic
1155474777 18:26226874-26226896 CCTCCCCTCACCTCTGCTCCCGG + Exonic
1157610643 18:48952759-48952781 CCTCCCGCCCTCTCAGCTCCGGG + Intergenic
1157935138 18:51864396-51864418 GCTCCCTGCTTCACGGCGCCTGG - Intergenic
1159947899 18:74457401-74457423 CCTCCCCGCACCTCCGCCCCAGG - Intronic
1160011903 18:75112517-75112539 CCGGCCTGCAGCTCTGCTCCTGG + Intergenic
1160874449 19:1290652-1290674 CCTGGCTGCATCCCGGTTCCTGG - Intronic
1162569858 19:11465617-11465639 CCGCCCTGCAAATCTGCTCCCGG - Intronic
1163148896 19:15399732-15399754 CCTCCCTGCATCCCACCACCTGG - Intronic
1163437873 19:17306081-17306103 CCTCTCTGAGCCTCGGCTCCCGG - Intronic
1163632931 19:18426310-18426332 CCTGCCTGCTTCTCGCCTCTAGG + Intronic
1164471723 19:28541783-28541805 CCTCCCTGGATCTCAGCTAGGGG + Intergenic
1165783319 19:38446397-38446419 CCTGACTTCATCTTGGCTCCTGG + Intronic
1166231652 19:41428292-41428314 CCTCCATCCCTCTCGGCACCCGG + Intronic
1166884605 19:45952795-45952817 CCACCCTGCAGCTCTCCTCCAGG + Intronic
1167363264 19:49041646-49041668 GCTCACTGCATCTCTGCTTCCGG + Intergenic
1167597741 19:50436257-50436279 CCACTCTCCATCCCGGCTCCAGG - Intronic
1168406587 19:56113675-56113697 CCTCCCTGCGTCCCGGTTCCTGG - Intronic
1168723742 19:58569655-58569677 CCTCTCTGCATCCCAGCACCTGG - Intronic
925140039 2:1543947-1543969 CCCCTCTGCCTCCCGGCTCCTGG - Intergenic
925164156 2:1705337-1705359 GCACCCTGCATCTGGGCTCATGG - Intronic
925189113 2:1868699-1868721 CCCCCCTGCCTCTCAGCCCCAGG - Intronic
926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG + Intergenic
926364468 2:12120563-12120585 CCTCCCTGCATGTATTCTCCAGG + Intergenic
927708317 2:25310578-25310600 CCTCCCTGATCCTGGGCTCCGGG + Intronic
927861135 2:26560975-26560997 CATCCCTGAATCTCAGCACCTGG - Intergenic
927996336 2:27489441-27489463 TAGCCCTGCATCTCGCCTCCTGG + Intronic
934670397 2:96208735-96208757 GCGCCCTGCATCCCGGCCCCGGG - Exonic
935396001 2:102609801-102609823 CCTGCCTGCATCTATGCTACAGG + Intergenic
935987627 2:108689798-108689820 CCCTCCTACATCTTGGCTCCTGG - Intergenic
936075384 2:109398369-109398391 CCTCTCTCCATCATGGCTCCTGG + Intronic
936126455 2:109792499-109792521 CCCTCCTGCGTCTTGGCTCCTGG - Intergenic
936218238 2:110578969-110578991 CCCTCCTGCGTCTTGGCTCCTGG + Intergenic
937424059 2:121782826-121782848 CCTCCCTGAATCCAGGCTCCTGG + Intergenic
937428296 2:121817730-121817752 CCTCCCTGGAACTCTTCTCCAGG - Intergenic
938903379 2:135817357-135817379 CCTCCCGGCATCTCTGACCCAGG - Exonic
946310806 2:218881446-218881468 CCTTCCTGCAGCTCAGCCCCAGG + Intronic
947749143 2:232523782-232523804 GCTCCCTGCAGCTGGGCTCGCGG - Exonic
947941362 2:234058886-234058908 CCTTCCTGCATGTAGTCTCCCGG - Exonic
949046920 2:241876631-241876653 CGTCCCTGCATTTCGGCCCCTGG - Intergenic
949063238 2:241973782-241973804 CCTCGCTGCTTCTCGGAGCCTGG + Intergenic
1168835606 20:875346-875368 CCCCCATGGATCTGGGCTCCAGG + Intronic
1170460292 20:16571434-16571456 CCTCCATGTACCTGGGCTCCAGG + Intronic
1171389818 20:24794310-24794332 CCTCCCTGCCCCTTGCCTCCTGG + Intergenic
1171437567 20:25135097-25135119 CCTGCCTGCATCACCCCTCCTGG + Intergenic
1171442884 20:25179837-25179859 CCTCTGAGCATCTCTGCTCCAGG - Intergenic
1173069002 20:39743405-39743427 CCCCCCTGCATTCTGGCTCCTGG + Intergenic
1175317873 20:58064370-58064392 CCTCCTTACATCTAAGCTCCTGG + Intergenic
1176031725 20:63016088-63016110 CACCCCTGCATCTGGGCTGCTGG + Intergenic
1176310481 21:5146432-5146454 CCTCCCTCCAGCTCAGATCCAGG + Intronic
1178704084 21:34858575-34858597 CCTCCCTGCATCTTGGCTTTTGG + Intronic
1179846574 21:44115603-44115625 CCTCCCTCCAGCTCAGATCCAGG - Intronic
1179926738 21:44539051-44539073 CCTCCCAGCTTCTCTGCTCTGGG - Exonic
1179937169 21:44613111-44613133 CCTCCCAGCTTCTCTGCTCTGGG + Intronic
1181270260 22:21654411-21654433 CCTCCCTTCCTCTAGGCACCAGG + Intronic
1181585255 22:23849534-23849556 CCTCCCTGCCCCTCAGCTCTTGG - Intergenic
1182350291 22:29695547-29695569 CCTGCCTGCCTCTCGGACCCTGG - Exonic
1182414870 22:30214944-30214966 CCTCCCTGCCTCCTAGCTCCTGG - Intergenic
1182558110 22:31140035-31140057 GCTCTCTGCAGCTCGGGTCCGGG + Exonic
1183383150 22:37500508-37500530 CCTCCCGGCACCCAGGCTCCAGG + Intronic
1183742036 22:39674173-39674195 CCTTCCTGCCTCTCAGCCCCTGG - Intronic
1184106030 22:42368107-42368129 CTTCCCTGCATCCCAGCCCCAGG + Intergenic
1184276446 22:43411863-43411885 CCTCCCCGCCTCTCCGCGCCCGG - Intronic
1184500794 22:44870400-44870422 CCTCACTGCTTCAGGGCTCCAGG + Intergenic
1184849576 22:47112570-47112592 CCCCGCTTCATCTCGGCCCCAGG + Intronic
950141893 3:10621292-10621314 GTTCCCTGCAACTCTGCTCCTGG - Intronic
950642642 3:14358497-14358519 CCTCCCTGCCTCCTGGCTCCAGG + Intergenic
950655272 3:14432574-14432596 ACTGCCTGCAGCTCTGCTCCAGG - Intronic
951481751 3:23168907-23168929 CCTCCCTCCATCTTGGCCCTGGG + Intergenic
953757227 3:45657131-45657153 CCTCCCTGCTTCTCAGCACCAGG + Intronic
953916135 3:46922312-46922334 TCTCCCTGCCTCCCTGCTCCAGG - Exonic
954877246 3:53810156-53810178 CGTCCCTGCACCGCAGCTCCTGG + Exonic
960465977 3:117997124-117997146 CCTCCCTGCCGCCGGGCTCCGGG - Intergenic
960522529 3:118671782-118671804 CCTCCGTGCATCTCAGCCCTTGG + Intergenic
962164903 3:133038542-133038564 CCTCCCTGAAGCTGGGCTCCCGG - Intronic
962982283 3:140501392-140501414 CCTTCCTGCATCTAGCCTTCAGG - Intronic
966184317 3:177214468-177214490 CCTCCCTTCCTCTCACCTCCTGG - Intergenic
967846540 3:194047536-194047558 CCTCCCTTTTTCTCAGCTCCAGG - Intergenic
967879167 3:194287030-194287052 CCTCCCTGCAGCTTGGTTCTGGG + Intergenic
968441948 4:628709-628731 CCTCCCTCCATGGTGGCTCCTGG - Intronic
968727121 4:2252836-2252858 CCTCCCTGCATGTGGACTCCAGG - Intronic
968931608 4:3582304-3582326 CCTCCGTGCTTCTGGTCTCCTGG + Intronic
969274863 4:6128270-6128292 TCTCACTGCATCCAGGCTCCTGG + Intronic
971373291 4:26035320-26035342 CCTCCCTGCAAATCCACTCCTGG + Intergenic
974886234 4:67821053-67821075 ACTCCCTGCATCTGGGCATCAGG - Exonic
977731593 4:100359942-100359964 ACTCCTTGCATTTCAGCTCCTGG - Intergenic
979609066 4:122670542-122670564 CCCCCCTGCTCCACGGCTCCTGG + Intergenic
980063927 4:128161375-128161397 CCTCCCTGCCTCTGGGGTTCTGG - Intronic
981052051 4:140318924-140318946 CCTCCCTTCATCTCCACTTCTGG + Intronic
985131242 4:186740659-186740681 CCTCCCTGCATCTCCCATCTGGG + Intergenic
987199691 5:15563597-15563619 CCTCCTTCCTTCTCTGCTCCTGG + Intronic
988177072 5:27742555-27742577 CCTCTCTCCATGTCGGCTCCAGG - Intergenic
992826135 5:80552090-80552112 CATCCCTGCATGTGGGCTCCAGG - Intergenic
993595328 5:89847749-89847771 TCTCCCTGCATCTGGACTTCCGG + Intergenic
998230862 5:140360740-140360762 CTCCTCTGCATCTCTGCTCCTGG + Exonic
1000849225 5:166319510-166319532 CCTCCCTGCAATCTGGCTCCTGG - Intergenic
1002621991 5:180494522-180494544 CCTCCCGCCCTCTCGGCCCCCGG - Intronic
1002806748 6:583858-583880 CCTCCCTGCAGCTCAGCACTGGG - Intronic
1003399969 6:5783064-5783086 CCTCCCTGCCTCACGCCTCGGGG + Intergenic
1003522185 6:6867703-6867725 CCTCACTGCATCTCAGGCCCTGG - Intergenic
1004601388 6:17153773-17153795 GCTCCCTGAAACTCGTCTCCAGG + Intergenic
1004671320 6:17800324-17800346 CCTCCCTGCAACTTGCCTTCTGG + Intronic
1005443610 6:25897974-25897996 GCTCACTGCAGCTCCGCTCCCGG - Intergenic
1006582589 6:35085547-35085569 CCTCCCCGCAGCCCAGCTCCCGG + Intronic
1006920910 6:37626441-37626463 CCTCCCTGCATCTGTGTTCCTGG + Intergenic
1007422759 6:41729316-41729338 CCTCCCTACATCTCTGGTCTGGG + Intronic
1007557997 6:42782748-42782770 GCTCCCTCCTTCCCGGCTCCCGG - Intronic
1007871817 6:45048871-45048893 CCTCCCTCCCCCTCAGCTCCTGG - Intronic
1008622888 6:53288988-53289010 GCTCACTGCTTCTCGCCTCCTGG - Intronic
1008677910 6:53841070-53841092 TCTCCCTGCATCCCGGCTCCTGG - Intronic
1008706353 6:54165284-54165306 CCTCCCTGCACCTCTGCTTATGG + Intronic
1013011723 6:106126476-106126498 TCTCCCTGCAGCTCAGCTTCTGG - Intergenic
1013452267 6:110295452-110295474 CCTCCCTGCCTGTCAGCTCAGGG - Intronic
1015150739 6:130034053-130034075 CTTCCCTTCATCTCAGCCCCAGG + Intronic
1017520042 6:155194170-155194192 CCTCCCGGCTTCTCTGCGCCTGG - Intronic
1018442120 6:163822939-163822961 CCTCCCTGCCACTCTTCTCCAGG - Intergenic
1019404925 7:877956-877978 CCTCCCTGCCTCCCTCCTCCTGG + Intronic
1019416228 7:927787-927809 CCTCCCTGTGTCTCGGGTCGAGG - Intronic
1019625342 7:2013080-2013102 CTACCCAGCAGCTCGGCTCCAGG + Intronic
1021838197 7:24701415-24701437 CCTCCCTGCAGATCAGCTCTAGG - Intronic
1022173203 7:27849172-27849194 TCTCCCTGCAGCCCGTCTCCAGG - Intronic
1024556340 7:50606104-50606126 CGTCCCTGCATCTCCCCTCAGGG - Intronic
1025958252 7:66199128-66199150 TCTCCCTGGGTCCCGGCTCCTGG + Intergenic
1032507407 7:132446030-132446052 CCTTCCTCCATCGGGGCTCCTGG - Intronic
1034451768 7:151141017-151141039 CCTCACTGCATCTTGGCCCCAGG - Intronic
1034474696 7:151275645-151275667 CCTCCATGCCCCTGGGCTCCAGG - Intronic
1035236108 7:157498502-157498524 TCTCCCTGCCTCCCGCCTCCTGG - Intergenic
1035290459 7:157834729-157834751 CCTCCCTGCAGGCCGGCTCCAGG - Intronic
1035352686 7:158257680-158257702 CAACCCTGCAGCTCCGCTCCTGG + Intronic
1036221755 8:6926863-6926885 CAGCCCTGCAGCTCTGCTCCAGG + Intergenic
1036678846 8:10855770-10855792 CCAGCCTGCATTTAGGCTCCGGG + Intergenic
1038013546 8:23494106-23494128 CCTCCCTGCTGCTGGTCTCCTGG + Intergenic
1038697375 8:29818458-29818480 CCTCCCTGCATCTCACCACAGGG - Intergenic
1038785627 8:30612659-30612681 CCTCCCTCCCTCTCAGCACCTGG + Intronic
1041463767 8:58138915-58138937 CTTCCCTGCATCTCTACACCTGG + Intronic
1042219578 8:66460326-66460348 CAGCCCTGCATCTTGGATCCTGG - Exonic
1042855426 8:73261872-73261894 CTTCCCTGCAGCAAGGCTCCAGG + Intergenic
1042879581 8:73472041-73472063 CCTTCCTGCACCTCCACTCCTGG - Intronic
1045342409 8:101266577-101266599 CCTCCCTGAGCCTCTGCTCCAGG + Intergenic
1046883972 8:119342149-119342171 CCTCCCTACTTTCCGGCTCCTGG - Intergenic
1048990949 8:139759823-139759845 CCTCCCCACATCTGGCCTCCAGG - Intronic
1049426811 8:142541421-142541443 CCTTCCTGCATCGCTGCCCCTGG - Intronic
1049469344 8:142768530-142768552 CTTCCCTGCACCAGGGCTCCTGG - Intronic
1049479691 8:142815983-142816005 CATCCTTGCATCCTGGCTCCTGG - Intergenic
1049873399 8:144999572-144999594 CCTCCCTGGGGCTCAGCTCCTGG - Intergenic
1051330726 9:16022544-16022566 GCTGCCTGCATCTGGGTTCCTGG + Intronic
1052016647 9:23476079-23476101 CCTTCCTGCCTCTGGGTTCCTGG + Intergenic
1054458519 9:65449623-65449645 CCTCCGTGCTTCTGGTCTCCTGG - Intergenic
1056732333 9:89177579-89177601 ACTCCGTGCATCTCTCCTCCCGG + Intronic
1056817474 9:89812059-89812081 CCCCCCTACAGCTGGGCTCCTGG - Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1061169445 9:128943784-128943806 GCTCCCTGGAGCTCTGCTCCCGG + Intronic
1061219633 9:129242732-129242754 CCTCCCTGCCTCTCAGCCCCTGG - Intergenic
1061306142 9:129734454-129734476 CCTCCCTGAATCGAGGCTCTGGG + Intergenic
1061688559 9:132304920-132304942 GCTCACTGCATCCCGCCTCCTGG - Intronic
1062213936 9:135378921-135378943 CTTCACTGCTGCTCGGCTCCTGG - Intergenic
1062301888 9:135878208-135878230 CCTCCCTTCACCTCTGCTCCAGG - Intronic
1186878464 X:13840389-13840411 CCTCCCTGCCTGCGGGCTCCGGG + Intronic
1191204648 X:57821241-57821263 CCTCCCTGGATCTTGGGTCCAGG + Intergenic
1192198889 X:69050991-69051013 CCGCCCTGCATCTCAGTGCCTGG + Intergenic
1195668150 X:107449126-107449148 CCTCCCTGCAGCTCCCCTCCTGG - Intergenic
1197753205 X:129979770-129979792 CCGCCTTGCCTCTCGTCTCCAGG - Intergenic
1198402514 X:136281466-136281488 CTTCCCATCATTTCGGCTCCAGG + Intergenic
1199872218 X:151909686-151909708 CCTACCTGCATCTCAGCTGCTGG - Intergenic