ID: 1152252431

View in Genome Browser
Species Human (GRCh38)
Location 17:79219019-79219041
Sequence TGGACTGTGGGTCCAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 298}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152252431_1152252448 19 Left 1152252431 17:79219019-79219041 CCCCCTGCTGGACCCACAGTCCA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1152252448 17:79219061-79219083 ACAGGCACCTGTGCGGGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 157
1152252431_1152252441 1 Left 1152252431 17:79219019-79219041 CCCCCTGCTGGACCCACAGTCCA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1152252441 17:79219043-79219065 CTGCTTGGTGTGGGCCCCACAGG 0: 1
1: 0
2: 2
3: 15
4: 152
1152252431_1152252438 -9 Left 1152252431 17:79219019-79219041 CCCCCTGCTGGACCCACAGTCCA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1152252438 17:79219033-79219055 CACAGTCCAGCTGCTTGGTGTGG 0: 1
1: 0
2: 2
3: 15
4: 202
1152252431_1152252439 -8 Left 1152252431 17:79219019-79219041 CCCCCTGCTGGACCCACAGTCCA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1152252439 17:79219034-79219056 ACAGTCCAGCTGCTTGGTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 143
1152252431_1152252442 12 Left 1152252431 17:79219019-79219041 CCCCCTGCTGGACCCACAGTCCA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1152252442 17:79219054-79219076 GGGCCCCACAGGCACCTGTGCGG 0: 1
1: 0
2: 2
3: 41
4: 276
1152252431_1152252444 14 Left 1152252431 17:79219019-79219041 CCCCCTGCTGGACCCACAGTCCA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1152252444 17:79219056-79219078 GCCCCACAGGCACCTGTGCGGGG 0: 1
1: 0
2: 1
3: 16
4: 192
1152252431_1152252443 13 Left 1152252431 17:79219019-79219041 CCCCCTGCTGGACCCACAGTCCA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1152252443 17:79219055-79219077 GGCCCCACAGGCACCTGTGCGGG 0: 1
1: 1
2: 1
3: 38
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152252431 Original CRISPR TGGACTGTGGGTCCAGCAGG GGG (reversed) Intronic
900365998 1:2312234-2312256 AGGACTGTGGCTCCAGGAGGAGG - Intergenic
900598593 1:3493560-3493582 TGGCCTAAGGCTCCAGCAGGAGG + Intronic
900934440 1:5756254-5756276 TGTGCTGTGGGTTCTGCAGGCGG - Intergenic
901649813 1:10737107-10737129 TGGTCTGTGGCCCCAGCAGCTGG - Intronic
901764028 1:11488566-11488588 TGGACTGTGGGTCCCACGGAAGG - Intronic
902797147 1:18807288-18807310 GGGGCTCTGTGTCCAGCAGGTGG - Intergenic
903456500 1:23490918-23490940 TGACCTCTGGGTTCAGCAGGTGG - Intergenic
904601258 1:31673798-31673820 TGGACTATGGGTGCAGGTGGTGG + Intronic
904872353 1:33626608-33626630 AGAACAGTGAGTCCAGCAGGTGG + Intronic
908552629 1:65224772-65224794 TGAACCGTTAGTCCAGCAGGAGG + Exonic
908729193 1:67208537-67208559 TGGGCTGTGGCTTCAGAAGGTGG + Intronic
908949281 1:69540087-69540109 TGCCCTGTGGGTTTAGCAGGTGG + Intergenic
909474391 1:76065668-76065690 TGGAATGTGGGACCAGAAAGAGG + Intergenic
912658111 1:111505660-111505682 TGGGCTGTGGGTGCAGCGGTAGG - Intronic
914337385 1:146727580-146727602 TGGACAGTGGGTACCTCAGGAGG + Intergenic
915462398 1:156077813-156077835 TGGACTGTGTGTGCAGCAGTGGG - Intronic
918148794 1:181780848-181780870 TGGTGTGTGTGTGCAGCAGGAGG - Intronic
919378019 1:196817927-196817949 TGGACAGTGGGTACAGCACATGG - Intergenic
919387705 1:196941964-196941986 TGGACAGTGGGTGCAGCACATGG - Intronic
919662117 1:200257431-200257453 AGGAATGTGGGTCCAGAAGCCGG + Intergenic
919855479 1:201703535-201703557 AGGACTGTGGGACCAGGAGAGGG - Intronic
924185226 1:241481762-241481784 TTAAATGTGGGTCCAGCAGAAGG + Intergenic
1063933165 10:11049975-11049997 TGGCATGTGGAACCAGCAGGTGG - Intronic
1067285882 10:44907436-44907458 TGGAGTGTTGGTTCAGTAGGTGG + Intergenic
1068390025 10:56383895-56383917 TCCACTGTGGTTCCAGCAGATGG + Intergenic
1070741629 10:78907307-78907329 TGGACTGGGGGTCAAGATGGGGG - Intergenic
1071395971 10:85224376-85224398 CTCACTGTGGGTCCGGCAGGAGG + Intergenic
1071500136 10:86197516-86197538 GGGAGTGTGGGTCTGGCAGGAGG + Intronic
1071922942 10:90371814-90371836 TGGACAGTGGGTCCAGCCCATGG - Intergenic
1073027446 10:100498262-100498284 TGTGCTGTGGGCCCTGCAGGGGG - Intronic
1073514395 10:104064051-104064073 TGGACAGTGGGTCCAGCCAAAGG + Intronic
1074319079 10:112384216-112384238 AGAACTGGGGGTACAGCAGGGGG - Intronic
1074598785 10:114892248-114892270 TGGACTTTGGGTCAAGTAGTAGG - Intronic
1074873325 10:117594960-117594982 TGTAATGTGGGTTTAGCAGGTGG + Intergenic
1075147972 10:119898903-119898925 TGAACAGGGGGTCCAGAAGGTGG - Exonic
1076323159 10:129598794-129598816 TGGAGTGTGAGCCCAGGAGGGGG - Intronic
1078830281 11:14971704-14971726 GGGACTGAGGTGCCAGCAGGCGG - Intronic
1079122265 11:17694820-17694842 TGGTCAGTGGGTCAAGCAGCCGG + Intergenic
1080489517 11:32747940-32747962 TGGACAGTGGGTGCAGCCCGTGG - Intronic
1080614680 11:33935673-33935695 TGGATTGTGGAGCCAGCAGCTGG + Intergenic
1080830982 11:35893038-35893060 TGGAAGGTGGGTCCAGTGGGAGG + Intergenic
1081376776 11:42368379-42368401 TGGGCTGTGGTTCCAGAGGGTGG + Intergenic
1081391673 11:42536959-42536981 TGGACTGTGGTTTTACCAGGAGG + Intergenic
1081862235 11:46339746-46339768 TGGCCTGTGGGCCAAGCATGGGG + Intronic
1082871368 11:57946047-57946069 GGGACTGTGTGCCCAGCTGGTGG - Intergenic
1083173604 11:60936553-60936575 GGGACTGCCGGTCCAGCTGGCGG - Exonic
1083267879 11:61555313-61555335 GGGACTTTGGGGGCAGCAGGGGG - Intronic
1083688270 11:64390826-64390848 GGGCCTGTGGCTCCAGCAGAGGG + Intergenic
1083883888 11:65561351-65561373 GGGCCTGGGGGTACAGCAGGTGG + Intergenic
1084729416 11:71063988-71064010 GGGTCTGGGGGTCCAGCAGCTGG - Intronic
1084730817 11:71072286-71072308 GGGGCTGTTGGTCCCGCAGGAGG - Intronic
1086965600 11:93024612-93024634 TTGACTCTGGGTCAAGAAGGAGG + Intergenic
1086988447 11:93275883-93275905 TGGACTATGGGTGAAGAAGGAGG + Intergenic
1087887356 11:103496101-103496123 TGGAATGTGGGGCATGCAGGAGG - Intergenic
1090422426 11:126584678-126584700 TGGACTGAAGGTGAAGCAGGTGG + Intronic
1091832060 12:3556972-3556994 GGGAGTGTGGGTCCAGATGGAGG + Intronic
1091899841 12:4135827-4135849 TGGAATGTGGGCCGGGCAGGTGG - Intergenic
1092529767 12:9334795-9334817 TGGACTCTGGGTCCAGAAGAAGG + Intergenic
1096630167 12:52921418-52921440 AGAACTGTGGGTCCAGGAGGAGG - Intronic
1097103384 12:56605174-56605196 TAGCCTGGGGGTCCTGCAGGAGG - Exonic
1098636105 12:72785628-72785650 TGCAGTGTGGCACCAGCAGGTGG + Intergenic
1099117934 12:78650619-78650641 TGGGCTGTGGATCCAGAAGTAGG + Intergenic
1099407888 12:82285300-82285322 TGGACTGTGGCTTCAGAGGGAGG + Intronic
1099507753 12:83500191-83500213 TGGGCTGTGGGTTCAGAGGGTGG + Intergenic
1099554689 12:84097255-84097277 TGGACAGTGGGTGCAGCACACGG + Intergenic
1102032823 12:109752900-109752922 TGAGCTGTGGGTCCAGGAGTTGG + Intronic
1103940863 12:124500514-124500536 GGGGCTCTGGGTCCAGCAGGAGG - Intronic
1106136986 13:26980829-26980851 GGGACTCTGGGGCCGGCAGGTGG + Intergenic
1106397775 13:29397646-29397668 TGCTTTGTGGGTCCAGCAGAAGG - Intronic
1106484026 13:30156969-30156991 TGGACTGGGGGCCCTGCAGTGGG - Intergenic
1110941933 13:81362357-81362379 TGGACAGTGGGTGCAGCCCGCGG + Intergenic
1112208014 13:97344722-97344744 AGCTCCGTGGGTCCAGCAGGTGG - Intronic
1112909189 13:104461005-104461027 CGGACTGTGGACCTAGCAGGTGG + Intergenic
1113608259 13:111625596-111625618 TGGACTTTGGGTAAAGCAGATGG + Intronic
1113783748 13:112991076-112991098 TGCTCTGTGGGGCCTGCAGGAGG + Intronic
1114036537 14:18634989-18635011 TGGGCTGTGCGTTCAGCAGTTGG + Intergenic
1114122096 14:19680048-19680070 TGGGCTGTGCGTTCAGCAGTTGG - Intergenic
1115478759 14:33841322-33841344 TTCACTGTGTGTGCAGCAGGAGG - Intergenic
1117181948 14:53200402-53200424 TGGTCTGTGGGTTCAGAGGGTGG + Intergenic
1118866532 14:69708786-69708808 TGTACTCTGGGGTCAGCAGGTGG - Exonic
1119434143 14:74586932-74586954 TGGGCTGTGGGTCCAGCCGGAGG + Intronic
1121169643 14:91842810-91842832 AGGACTGTGGCTCCAGTAAGTGG - Intronic
1121373169 14:93379687-93379709 TGGACTTTGGGGACTGCAGGGGG + Intronic
1123430505 15:20211639-20211661 TGGGCTGTAGGACCAGCAGTGGG - Intergenic
1124075131 15:26437012-26437034 AGGACTGTGGGTCCAGACGAAGG + Intergenic
1124136689 15:27041845-27041867 AGGACTTCGGGTCCTGCAGGGGG + Intronic
1124358822 15:29019169-29019191 TGGAGTGAGGGCCCAGGAGGGGG + Intronic
1125837320 15:42764255-42764277 TGGACAGTGGGTCCAGCCCATGG + Intronic
1126465334 15:48956477-48956499 TGGACTTGGTGTCCAACAGGAGG - Intronic
1128226331 15:66003874-66003896 AGGACTGTGGGTGCAGGAGCAGG - Intronic
1128385779 15:67147251-67147273 TGGACTGTGGCCCCAACAGCTGG + Intronic
1129425336 15:75458448-75458470 AGGACTATGTGTTCAGCAGGAGG + Intergenic
1129692604 15:77722277-77722299 TGGACTCTGGGTTTATCAGGAGG + Intronic
1131046529 15:89319931-89319953 TGGACTGTGGGTGCAGGTGGTGG - Intronic
1132715057 16:1286025-1286047 TGGACTGTGGGAGCAGCTGGGGG - Intergenic
1132867979 16:2103249-2103271 TGGACGGTGCGTGCAGCGGGTGG - Exonic
1132905212 16:2278965-2278987 TGGCATGTGGCTCCAGCAGCAGG + Exonic
1132926044 16:2429559-2429581 CGGACGGTGGGTCCCGCGGGAGG + Intronic
1133387661 16:5383291-5383313 TGGGCTGTGGGTCTGCCAGGAGG + Intergenic
1134062498 16:11207608-11207630 TGGACTTGGGGTGCAGCAGAGGG + Intergenic
1134109137 16:11503788-11503810 TGGCTTGTGGGTCCTGCCGGAGG - Intronic
1134244062 16:12526783-12526805 TGGGCTGTGGACCCCGCAGGGGG - Intronic
1134719231 16:16371653-16371675 TGGACGGTGTGTGCAGCGGGTGG + Intergenic
1134948195 16:18340232-18340254 TGGACGGTGTGTGCAGCGGGTGG - Intergenic
1136854127 16:33639571-33639593 TGGGCTGTAGGACCAGCAGTGGG + Intergenic
1136871841 16:33814429-33814451 GGCACTGTGGGACCAGTAGGTGG + Intergenic
1138496458 16:57412007-57412029 TGGACTGTGGCTTGAGGAGGGGG + Intronic
1139490378 16:67282744-67282766 TGAAGTGTGGCTGCAGCAGGTGG + Exonic
1139937086 16:70579339-70579361 GGGACTGGGGGTCCATTAGGTGG - Intergenic
1139996894 16:70989746-70989768 TGGACAGTGGGTACCTCAGGAGG - Intronic
1141497193 16:84418386-84418408 TTGTGTGTGGGTTCAGCAGGTGG - Intronic
1141678011 16:85527672-85527694 GGGAATGTGGGGCCAGCAGCGGG + Intergenic
1142171946 16:88627560-88627582 TGGAGGGAGGGGCCAGCAGGGGG - Intronic
1142354771 16:89597187-89597209 TGGCCTGTGGGTTCTGCCGGTGG + Exonic
1203100331 16_KI270728v1_random:1301639-1301661 GGCACTGTGGGACCAGTAGGTGG - Intergenic
1144344955 17:14341053-14341075 TGGGTTGTGGGACCAGCAGGCGG + Intronic
1144415497 17:15042423-15042445 TGGACTGTGGGTGTGGGAGGGGG + Intergenic
1145176749 17:20707349-20707371 TGGGCTGGGGGACCAGCTGGGGG - Intergenic
1146355148 17:32127354-32127376 TGAGCTGGGGGACCAGCAGGGGG + Intergenic
1146725728 17:35154417-35154439 TGGGCTGTGTTTCCAGGAGGAGG + Intronic
1146788001 17:35735019-35735041 TGGACTGTGGGGACAAGAGGTGG - Exonic
1147250239 17:39148949-39148971 TGGCCTGGGAGTCCTGCAGGAGG - Intronic
1147412662 17:40264846-40264868 TTGACTGGGGGTGGAGCAGGAGG - Exonic
1147951978 17:44112508-44112530 TGGAGTGGGGGTCAAGGAGGGGG - Intronic
1148911606 17:50946016-50946038 TAGACTGTGGCTCCATCATGGGG - Intergenic
1150342294 17:64378273-64378295 TGCACAGTGGCTCAAGCAGGAGG + Intronic
1150941464 17:69698428-69698450 TGGACTGTGGTTTCAGAGGGTGG - Intergenic
1151804477 17:76397027-76397049 GGGGCTTTGGGTCCAGCTGGAGG - Intronic
1152252431 17:79219019-79219041 TGGACTGTGGGTCCAGCAGGGGG - Intronic
1152259461 17:79259323-79259345 AGGGCTGCGGGTCCTGCAGGTGG - Intronic
1152745556 17:82037133-82037155 GGGACTGTGGGGCCAGCAGCCGG + Intronic
1152902018 17:82947697-82947719 TGGTCCTTGGGCCCAGCAGGAGG + Intronic
1155357636 18:24968915-24968937 TCTACTGTGTGTCCAGCATGGGG - Intergenic
1155384841 18:25266573-25266595 TGGACAGTGGGTGCAGCCGACGG + Intronic
1155474891 18:26227301-26227323 TTGTCTGTCGGTCCAGCTGGCGG + Intronic
1157721956 18:49932030-49932052 TGGGCTATGGGACCAGCTGGAGG + Intronic
1159426791 18:68299395-68299417 GGCACTGTGGGTCCAGCCTGTGG + Intergenic
1160694112 19:474359-474381 GGGGCTGTGGGTACAGCAGTGGG - Intronic
1160811529 19:1014972-1014994 TAGACAGTGGGTCCAGCTGGTGG - Intronic
1161585564 19:5103662-5103684 TGGAGAGAGGGTCTAGCAGGAGG - Intronic
1161742917 19:6035213-6035235 TGGCCTCTGGGTCTTGCAGGAGG + Intronic
1162289003 19:9764607-9764629 GGCACTGTGGGACCAGAAGGCGG + Intronic
1163123836 19:15233460-15233482 GGGCCTGTTGGGCCAGCAGGAGG - Intergenic
1163359079 19:16834311-16834333 TGAACTGTGCGTCCTGCATGTGG + Intronic
1165003807 19:32787931-32787953 TGGACAGTGGGTGCAGCCCGTGG - Intronic
1165323426 19:35100060-35100082 TGCCATGTGGGCCCAGCAGGTGG + Intergenic
1167042652 19:47031907-47031929 TGGTCTGAGAGCCCAGCAGGAGG + Intronic
1167649953 19:50723706-50723728 TGAACTGTGGGTCTGGGAGGGGG + Intronic
1167715875 19:51142657-51142679 TGGTCTGTGGGTCCCCAAGGAGG - Exonic
1167768564 19:51500043-51500065 TGGTCTGTGGGTCCCCAAGGAGG + Exonic
929332381 2:40698426-40698448 AGGACTGTGGAGGCAGCAGGAGG + Intergenic
930045077 2:47163771-47163793 TGGAGTGTTGCACCAGCAGGAGG - Intronic
932779663 2:74552341-74552363 GGCACTGTGGGTCCAGCCTGTGG + Exonic
933895759 2:86808516-86808538 TGCCCTGTCGGCCCAGCAGGGGG + Intergenic
936049848 2:109214344-109214366 GGGGCTGTGGGGGCAGCAGGAGG + Intronic
937451182 2:122003146-122003168 TGGACTGTGGGGACAGAATGGGG + Intergenic
941156782 2:161988676-161988698 GGCACTGTGTCTCCAGCAGGAGG + Intergenic
942348791 2:175031184-175031206 AGGACTCTGGGTCCACCTGGTGG - Intergenic
943041954 2:182814487-182814509 TGGACTGAAGGACCAGCAGCAGG + Intergenic
943262913 2:185688376-185688398 TGGACAGTGGGTGCAACCGGAGG - Intergenic
943589796 2:189783954-189783976 CGGGCTGTCGGTCTAGCAGGGGG - Intronic
944328298 2:198433287-198433309 GGGACAGTGGGTGCAGGAGGGGG + Intronic
944413707 2:199463995-199464017 GGGACCGTGGGTCCCGCAGCGGG - Intronic
944613056 2:201430815-201430837 TGGACAGTGGGTGCAGCCCGCGG - Intronic
945325929 2:208482341-208482363 GGCACTGTGGGACCAGAAGGCGG - Intronic
948397842 2:237660928-237660950 ATGACAGTGGGTCCTGCAGGTGG - Intronic
948823824 2:240564727-240564749 TGTACTGTGGCTTCAGCAGCTGG - Intronic
1168818906 20:760530-760552 TGGACTGTCAGATCAGCAGGTGG + Exonic
1170976880 20:21173217-21173239 TGGACTGTGGTGGCAGCAGTAGG + Intronic
1173139886 20:40472510-40472532 TGGACTGTTTATCCAGCATGTGG + Intergenic
1173555275 20:43961358-43961380 TGGACTGTTGGGCTGGCAGGCGG + Intronic
1174171608 20:48621164-48621186 TGCCCTGTCTGTCCAGCAGGTGG - Intergenic
1175774146 20:61642303-61642325 TGGAATGGGGAACCAGCAGGTGG + Intronic
1175774157 20:61642340-61642362 TGGAATGGGGAACCAGCAGGTGG + Intronic
1176123642 20:63465435-63465457 TGGAGTGTGGGCCCTGCAGGAGG - Intronic
1176366342 21:6035166-6035188 AGGGCTGTGTGACCAGCAGGTGG + Intergenic
1176654319 21:9576305-9576327 TGGACTCTGATTGCAGCAGGTGG - Intergenic
1176948352 21:15012167-15012189 TGGACTGTGTCTCCAAAAGGAGG - Intronic
1178588928 21:33893023-33893045 TGACCTGTGGGTCCCCCAGGAGG - Exonic
1178605816 21:34035773-34035795 TGGAATGTGGGCACAGCATGTGG + Intergenic
1179757175 21:43503379-43503401 AGGGCTGTGTGACCAGCAGGTGG - Intergenic
1179818958 21:43925399-43925421 TGGAGTGTGTGAGCAGCAGGAGG - Exonic
1180228975 21:46414861-46414883 GTGGCTGTGTGTCCAGCAGGAGG - Intronic
1180259034 21:46654094-46654116 TGGTCTCTGGGTCCAGCTGCTGG - Intronic
1180460662 22:15562046-15562068 TGGGCTGTGCGTTCAGCAGTTGG + Intergenic
1180975409 22:19845306-19845328 TGCCCTGTGGGTGCTGCAGGTGG + Intronic
1181087712 22:20449994-20450016 TGGGGTGCGGGTCCAGCAGGTGG - Intronic
1181489832 22:23254653-23254675 TGAGCTGTGGGACCAGCAAGAGG - Intronic
1182050915 22:27311893-27311915 GGGGCTGTGGGGCCTGCAGGAGG - Intergenic
1182663667 22:31942795-31942817 TTGAATGTGGGTCTAGGAGGAGG - Intronic
1183658649 22:39205740-39205762 TGGAACCTGGGTCCAGCAGGCGG - Intergenic
1184149189 22:42628655-42628677 GGGACTGAGTGTCCACCAGGAGG - Intronic
1184179130 22:42807565-42807587 TGGACTGTGGGAACAGCAAGGGG + Intronic
1184296072 22:43526376-43526398 TGGAGTCTGGGCCCAGCAGTGGG + Intergenic
1184800279 22:46754768-46754790 TGGGCTGTGGGGTCAGCAGCTGG + Intergenic
1185045247 22:48525407-48525429 TGGAATCGGAGTCCAGCAGGCGG - Intronic
950045142 3:9944639-9944661 TGTCCTGAGTGTCCAGCAGGAGG - Exonic
950203456 3:11060893-11060915 TGGATCGTGTGTCCAGCAGGTGG + Intergenic
950505390 3:13391386-13391408 TGGAGTGTGGTTCCTGCATGGGG - Intronic
951065144 3:18255437-18255459 TGTAGTGTGGGTCTAGCAAGGGG + Intronic
951653759 3:24981779-24981801 TGGACAGTGGGTACAGCACATGG - Intergenic
954177593 3:48856800-48856822 TAGGCTGGGGATCCAGCAGGAGG - Intergenic
954263303 3:49455405-49455427 TGGAGTATGGGTCAAGCAGGGGG - Intergenic
954405059 3:50340962-50340984 GGGACTGTGGGGCCCGAAGGCGG + Intronic
954692022 3:52400718-52400740 GGGACTGTGGGTCAAAGAGGCGG - Intergenic
954950440 3:54468255-54468277 TGGACAGTGGGTGCAGCCCGTGG + Intronic
955970624 3:64435327-64435349 TGGACTGTGGCTTCAGAGGGTGG + Intronic
956067456 3:65412153-65412175 TGGAGTGTGTGTCCAGGAGGAGG - Intronic
957145061 3:76413074-76413096 TGGGCTGTGGCTCCAGAGGGTGG - Intronic
958931720 3:100214659-100214681 TGGACTTCGGGTACAGCAGATGG - Intergenic
959059821 3:101605802-101605824 TGGACTGTGGGTGCAGCCCACGG - Intergenic
960065354 3:113366710-113366732 TGGACAGTGGGTGCAGCCGATGG + Intronic
960493001 3:118340061-118340083 TGGGCTTTTGGTCAAGCAGGTGG - Intergenic
960593003 3:119383132-119383154 TGCAGTCCGGGTCCAGCAGGTGG + Exonic
962340362 3:134577084-134577106 GGGAGTGGGGGCCCAGCAGGAGG + Intergenic
963645020 3:147903266-147903288 TGGGCTCAGGGTCCAGCAGGAGG - Intergenic
964404728 3:156337476-156337498 TGAACTCTGGCTCCAGGAGGAGG - Intronic
964592202 3:158377356-158377378 TGGAGTTTGGGCCTAGCAGGAGG + Intronic
965465952 3:169030858-169030880 TGGACTGCCAGACCAGCAGGTGG + Intergenic
965720005 3:171651051-171651073 GGGACTGTGGGTGAAGGAGGAGG - Intronic
966889317 3:184395247-184395269 TGGGCAGTGGGACAAGCAGGGGG + Intronic
966926199 3:184646139-184646161 TGGGCTTGGGGTGCAGCAGGCGG + Intronic
968126471 3:196163960-196163982 AGGGCTGTGGGTCCCGCAGGAGG - Intergenic
968609082 4:1549024-1549046 TGCACCGTGTGTCCAGCAGGGGG - Intergenic
969073231 4:4556760-4556782 AGGCCTGTGGGTCCAACAGGAGG - Intergenic
974061319 4:57038518-57038540 AGGACTGTGGCTCCCGCAGTCGG - Intronic
976580560 4:86730798-86730820 TGGACAGTGGGTGCAGCAATCGG - Intronic
981304050 4:143226892-143226914 TGCACAGTGGATGCAGCAGGAGG - Intergenic
982075996 4:151737779-151737801 TGGACTGTTGCTTCAGAAGGTGG + Intronic
983879024 4:172912370-172912392 TGGACAGTGGGTGCAGCCCGTGG + Intronic
984415978 4:179459062-179459084 TGGACTGTGGCTTCAGAGGGTGG + Intergenic
985421927 4:189793201-189793223 TCGCCTGTGTGTCCAGCAGAGGG - Intergenic
986417860 5:7546526-7546548 TTGGCTGTGGGTGCAGGAGGTGG - Intronic
987894353 5:23925681-23925703 TGGACTGTGGCTTCAGAGGGTGG - Intergenic
988546066 5:32158593-32158615 GGGATTGTGGAGCCAGCAGGAGG - Intronic
989175016 5:38515836-38515858 TGGTCTCTGTGTCCAGCAGTGGG - Intronic
990003805 5:50922821-50922843 TGCACCGTGTGTCCAGCAGGGGG + Intergenic
991047746 5:62240608-62240630 TGGGCTGTAGGACCAGCAGTGGG - Intergenic
991425043 5:66482176-66482198 TGGACAGTGGGTGCAGCCTGTGG + Intergenic
992112933 5:73513185-73513207 TGCACTGTGTGTCCAGGAGCTGG + Intergenic
993556324 5:89343980-89344002 CGGGCTGTGGGCCCAGCTGGGGG - Intergenic
997187731 5:131898920-131898942 TGGACAGTGGGTACAGCCCGTGG - Intronic
997842951 5:137258636-137258658 GGGACTGTTGTTCTAGCAGGTGG + Intronic
998934102 5:147216130-147216152 TGGACTGTGGGTACAGCCCACGG + Intergenic
1001148273 5:169203853-169203875 AAGACTGTGGGTAGAGCAGGGGG + Intronic
1002900109 6:1404186-1404208 TGTGCTGTGGTTCCAGCTGGGGG - Intergenic
1003316866 6:5020666-5020688 TGGACAGTGGGTGCAGCCCGTGG - Intergenic
1004256279 6:14067808-14067830 AGGACTGTGGGTGGAGCAGTTGG - Intergenic
1004380732 6:15130063-15130085 TGGACCGTGGGCCCAACAGGGGG - Intergenic
1005805289 6:29468558-29468580 GGGTCTGTGGGCCCAGGAGGGGG + Intergenic
1006577698 6:35058207-35058229 AGGACTGTGGAGCCAGCAGCAGG + Intronic
1007118635 6:39362323-39362345 AGGGATGTGGGTCCAGCAGCTGG - Intronic
1007633989 6:43287228-43287250 TGCCCTCTGGGTCCAGCAGAGGG + Exonic
1007702325 6:43772290-43772312 TGGACTCTGGGGCCAGAAAGGGG - Intronic
1007796051 6:44348583-44348605 AGGTCTGTGGGCCCAGCAGCAGG + Intronic
1010037231 6:71340374-71340396 TGGACCCTGGTTCCAGGAGGTGG - Intergenic
1012815517 6:104018137-104018159 TGGCCTGGGGGTCCAGCACAGGG - Intergenic
1015158948 6:130129832-130129854 TAGACTCTGGCTCCAGTAGGTGG - Intronic
1016683650 6:146857610-146857632 TTCTCTGTGTGTCCAGCAGGGGG + Intergenic
1016975350 6:149802236-149802258 TTGCCTGTTGGTCCTGCAGGCGG + Exonic
1018858117 6:167689858-167689880 TGGCCTGTGGGGTCAGGAGGTGG - Intergenic
1018901427 6:168053739-168053761 TGGACTCTGGGTTCCCCAGGCGG - Intergenic
1022487478 7:30790940-30790962 TGCTCTGAGGTTCCAGCAGGCGG + Intronic
1022992986 7:35726615-35726637 TGGACAGTGGGTCCGGCACTGGG + Intergenic
1024059825 7:45689590-45689612 AGGTGTGTGGGTCAAGCAGGTGG - Intronic
1024762082 7:52611080-52611102 TGTCCTCTGGGCCCAGCAGGTGG + Intergenic
1024962203 7:54989285-54989307 TGGAGTGTGAGTTCTGCAGGAGG + Intergenic
1025027360 7:55527598-55527620 TGGAATGAGGGTCCATGAGGAGG - Intronic
1025740628 7:64192852-64192874 GGGTTTGTGGGGCCAGCAGGGGG + Intronic
1029375662 7:100175673-100175695 TGTACTGTGGGTGCAGCAGCGGG + Exonic
1030177682 7:106671881-106671903 TGGACAGTGGGTGCAGCCCGTGG + Intergenic
1030457723 7:109795110-109795132 TGGACAGTGGGTGCAGCACAGGG + Intergenic
1031175034 7:118339076-118339098 TGGGCTGTGGCTTCAGAAGGTGG + Intergenic
1032906281 7:136371040-136371062 TGAACTGTGAGCCCAGGAGGAGG - Intergenic
1034205240 7:149308997-149309019 TGGACTGTAGGTCAAGAAGTTGG - Intergenic
1034270855 7:149802911-149802933 TAGCATGTGGGTCCACCAGGAGG - Intergenic
1034417960 7:150975064-150975086 GGGACTGGGGTCCCAGCAGGGGG + Intronic
1034487813 7:151376939-151376961 TGGACAGTGTGGCCAGCAAGAGG + Intronic
1035458239 7:159023432-159023454 GGGACTGTGGGCACAGCCGGGGG - Intergenic
1035458325 7:159023756-159023778 GGGACTGTGGGTGCAGCCAGGGG - Intergenic
1035458359 7:159023886-159023908 GGGACTGTGGGTGCAGCCAGGGG - Intergenic
1035601083 8:897101-897123 TGGAGTGGGGGTTCAGCAGCAGG + Intergenic
1035628863 8:1093159-1093181 TGGACTGTGGGTGAAGGAGATGG - Intergenic
1036495101 8:9263113-9263135 TGGAATGTGGATGCAGCTGGGGG + Intergenic
1037780459 8:21864978-21865000 AGGTCTGTGGGTAGAGCAGGTGG - Intergenic
1039165522 8:34675320-34675342 GGGAGTGGGGATCCAGCAGGAGG - Intergenic
1039410624 8:37352282-37352304 TGGGATGTGGCTCCAGGAGGAGG + Intergenic
1040413550 8:47178797-47178819 GGGGCTGTGGGGCCTGCAGGTGG + Intergenic
1041362364 8:57066848-57066870 AGGACTGTGGCCACAGCAGGTGG - Intergenic
1044309747 8:90679864-90679886 TGTACTGTGGTTCTAGAAGGGGG + Intronic
1046016760 8:108614726-108614748 TGGGGTGAGGGGCCAGCAGGTGG + Intronic
1046656326 8:116899166-116899188 TGGGCTGTGGGTTCAGAGGGTGG + Intergenic
1049258756 8:141627682-141627704 CGGGCTGGGGGTCCAGCATGAGG - Intergenic
1049367302 8:142246564-142246586 TGGACTTAGGGTCAAGCAGACGG + Intronic
1049515085 8:143050092-143050114 TGGACTCTGCGCCCTGCAGGTGG + Intronic
1049597725 8:143492401-143492423 TGGACTGAGGGTCCAGATGGTGG - Intronic
1049653421 8:143787328-143787350 TAGCCTGTGGATCCATCAGGTGG + Intergenic
1049696965 8:143988988-143989010 TGGACTGGTTGTCCAGCTGGGGG + Intronic
1049780694 8:144427488-144427510 TGGAGTGTGGTTCAAGCTGGAGG + Intronic
1053534592 9:38913219-38913241 TGGACTTTGGGACCACCTGGGGG - Intergenic
1054206811 9:62137639-62137661 TGGACTTTGGGACCACCTGGGGG - Intergenic
1054631541 9:67450708-67450730 TGGACTTTGGGACCACCTGGGGG + Intergenic
1056392057 9:86149637-86149659 TGGACTGTTTGTTAAGCAGGGGG + Intergenic
1056731057 9:89167100-89167122 TGCCCTGGGGGTCCAGCAGGAGG + Intronic
1056944843 9:90985409-90985431 GGAGCTGTGGGTCCAGCAGAGGG + Intergenic
1056975019 9:91245183-91245205 TCAAGTGTGGGCCCAGCAGGTGG + Intronic
1057725412 9:97564818-97564840 TGGTCTCTGGGCTCAGCAGGTGG - Intronic
1059405276 9:114095297-114095319 TCCGCTGTGGGTCCAGCAGCAGG + Exonic
1061849822 9:133407818-133407840 TGGGCTCCAGGTCCAGCAGGCGG - Exonic
1061948486 9:133922057-133922079 TGGGCTTGGGGTCCAGCAGGCGG - Intronic
1062594794 9:137294733-137294755 TTGTCTGTGGGGCCAGCAGATGG + Intergenic
1062650591 9:137574816-137574838 TGGACAATGGCTCCAGCACGTGG + Exonic
1203632040 Un_KI270750v1:79763-79785 TGGACTCTGATTGCAGCAGGTGG - Intergenic
1189728236 X:43990491-43990513 AAGACTGTGGGTCCAGTAGTGGG - Intergenic
1190596832 X:52060040-52060062 TGGACTGCGCGTCCTGCAGAAGG - Intergenic
1190611992 X:52194033-52194055 TGGACTGCGCGTCCTGCAGAAGG + Intergenic
1190929450 X:54935233-54935255 TGGACTGGGTGTCCTGCAGGAGG + Intronic
1191043275 X:56107715-56107737 GGGACTGTGGGTGCAGCACACGG - Intergenic
1191645614 X:63478142-63478164 TGGACTGTGGGTGCAGCCCACGG + Intergenic
1191987313 X:66995457-66995479 TGGACTGTGGGTGCAGCCCATGG - Intergenic
1192822083 X:74656519-74656541 TGGACTGTGTTCCCAGGAGGAGG - Intergenic
1193406342 X:81106720-81106742 TGGACAGTGAGTCCAGCCTGAGG + Intergenic
1196080775 X:111628112-111628134 GGGACTGTGGATCCAGAAGCAGG - Intergenic
1196562322 X:117164919-117164941 TTGAATGGGGGTACAGCAGGAGG + Intergenic
1198043257 X:132875172-132875194 GAGACTATGGTTCCAGCAGGTGG + Intronic
1199728009 X:150604059-150604081 TGGAGTGTGTGGCCAGGAGGAGG + Intronic
1199806750 X:151307845-151307867 TGACCTTTGGGTGCAGCAGGTGG + Intergenic
1201623125 Y:15981915-15981937 GGCACTGTGGGACCAGAAGGCGG - Intergenic