ID: 1152254065

View in Genome Browser
Species Human (GRCh38)
Location 17:79227276-79227298
Sequence GAACATCCACAGAGGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152254060_1152254065 8 Left 1152254060 17:79227245-79227267 CCTGAGAGGTCCAGCGAAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 207
1152254061_1152254065 -2 Left 1152254061 17:79227255-79227277 CCAGCGAAGCAGCGAGCCAGAGA 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152254065 Original CRISPR GAACATCCACAGAGGCAGGT TGG Intronic
901324146 1:8356921-8356943 GAGCAGCCACAGAGGCAGAGCGG - Intronic
902541622 1:17159582-17159604 GAACACCCACAGAGGCAGAATGG + Intergenic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
904038513 1:27571367-27571389 GACCAGGCACAGAGGCAGGCTGG + Intronic
908038132 1:60078094-60078116 TAACATCCACAGAGGAAGTAAGG - Intergenic
908901354 1:68959937-68959959 AAACATACACAGAGGGAGGCTGG - Intergenic
912338543 1:108887317-108887339 AAAAAACCACACAGGCAGGTGGG + Intronic
914431323 1:147622296-147622318 GGATATTCACAGAGGCAGGCTGG - Exonic
914703329 1:150152188-150152210 GAACATCTACTGAGGCATCTAGG + Intronic
915300254 1:154947611-154947633 GAATGTCTCCAGAGGCAGGTGGG - Intronic
919933603 1:202237087-202237109 GACCAGACACAGAGGCAGGAGGG - Intronic
920862522 1:209722096-209722118 GAACATCCACAGTTGAAGGGTGG - Intronic
920993540 1:210964029-210964051 GAGCATCCAGAGAGAAAGGTTGG + Intronic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
921221790 1:212978746-212978768 GACCATCCACAGAGCCCAGTTGG + Intronic
921452985 1:215331848-215331870 ATACATCCAGAGAGGCAGTTTGG + Intergenic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
923323707 1:232861440-232861462 GAACATTCGCAAAGGCAGGATGG + Intergenic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1066233114 10:33457134-33457156 GAACAGGCACAGAGGCAAGCTGG + Intergenic
1067059244 10:43069497-43069519 GAAGATCCTCCCAGGCAGGTGGG + Intergenic
1067525181 10:47034190-47034212 GGACAGCCAGAGAGGCAGATTGG + Intergenic
1067710742 10:48649334-48649356 GGACAACCACAGAGTCAGGGAGG + Intronic
1067714947 10:48683648-48683670 GAACTTCCACAGAGGCAGGAAGG - Intergenic
1067930659 10:50558175-50558197 GAAGAAGCACAGAGGCAGGAGGG - Intronic
1068630198 10:59290208-59290230 GAACACCCACACAGGCTGGATGG + Intronic
1069086197 10:64142318-64142340 AAACAACCTCAGAGGCAGTTTGG - Intergenic
1069670404 10:70197476-70197498 CAAGAGCTACAGAGGCAGGTAGG + Intergenic
1071682417 10:87719363-87719385 CAACATCCAATGAGGTAGGTAGG - Intronic
1072619652 10:97071317-97071339 GGACGTCCACAGAGTCAGGAAGG + Intronic
1072728489 10:97829330-97829352 CATCATTGACAGAGGCAGGTGGG - Intergenic
1075817266 10:125274244-125274266 GTACATCCAAAGAAGGAGGTAGG - Intergenic
1076281350 10:129249402-129249424 GCACATCCACACAGGCACGTGGG - Intergenic
1076419888 10:130323917-130323939 GATCATCCACAGAGGAAGGGTGG - Intergenic
1077438336 11:2555672-2555694 GAACAGTCAAAAAGGCAGGTGGG - Intronic
1078325315 11:10375831-10375853 TCGCATCCAGAGAGGCAGGTTGG + Intronic
1081779957 11:45703384-45703406 CAACATTTCCAGAGGCAGGTGGG + Intergenic
1081848763 11:46260403-46260425 AAAAACCCACAGGGGCAGGTGGG + Intergenic
1082095039 11:48122959-48122981 GAAGACCCAGAGAGGCAGGGGGG - Intronic
1084012790 11:66362049-66362071 GAATGTTCACAAAGGCAGGTGGG + Intronic
1084136135 11:67183805-67183827 GTACAGACAAAGAGGCAGGTGGG + Intronic
1084657919 11:70529729-70529751 GCAAATCCACAGAGACAGGGAGG - Intronic
1085391695 11:76185466-76185488 GAACAGCCAGGGAGGCAGGAGGG - Intergenic
1085699105 11:78730436-78730458 GCTCATCCACAGAGAGAGGTTGG + Intronic
1085703003 11:78761837-78761859 GCACATCCACAGTGGGAGGTTGG - Intronic
1090394361 11:126408978-126409000 GAACATCCACACAGGTAGAAGGG - Intronic
1090895937 11:130975488-130975510 GAACAGCCAGAGAGAAAGGTCGG - Intergenic
1091919440 12:4292733-4292755 AAACAGCCAGAGAGGCAGTTTGG + Intronic
1092290493 12:7157244-7157266 GAACAAACACAGAGGGAGGCAGG - Intronic
1094439373 12:30457606-30457628 GAAAATCAAGAGAGGGAGGTAGG - Intergenic
1097914844 12:65010106-65010128 CAACGTCCAGAGAGGCAGGCTGG + Intergenic
1098504595 12:71234638-71234660 GAACATCCACAGAGCCAAAATGG - Intronic
1098646001 12:72901669-72901691 GAGCATTCACAGAGTCAGGTAGG - Intergenic
1098963250 12:76761249-76761271 AAATATCCACAGAGCCAGGCAGG + Intergenic
1099235929 12:80082671-80082693 GGACAGCCACAGAGAAAGGTCGG - Intergenic
1102200163 12:111052326-111052348 GACAATCCACAGAGGGAGGCCGG - Intronic
1102468303 12:113143303-113143325 GAGCATGCACAGGGGCAGGGAGG - Intergenic
1102552470 12:113701860-113701882 GCACAGCCACAGAGGCAGGAGGG - Intergenic
1103919325 12:124391201-124391223 CAACATCCCCAGATGCAGGTGGG - Intronic
1103992974 12:124811671-124811693 GACCACCCAGAGGGGCAGGTGGG - Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1105002391 12:132699172-132699194 GAACATCGGCTGAGGCAGGAAGG + Intronic
1105500425 13:20966765-20966787 GAACATCCAAAGAGGCTGAGTGG + Intergenic
1107843825 13:44489920-44489942 GAACATTCACAGACACAGCTAGG + Intronic
1114691419 14:24586091-24586113 GAACAGCCAGAGAGAAAGGTCGG - Intergenic
1114802045 14:25787001-25787023 GAAAATCCACAGAGACATGAAGG - Intergenic
1115437070 14:33387266-33387288 ACACTTCCACAGAGGCAGCTTGG + Intronic
1118250641 14:64156918-64156940 GCACATCCACAGTGACAGGGAGG - Intronic
1119585534 14:75831525-75831547 GAACCTCCAGCCAGGCAGGTGGG - Intronic
1120264920 14:82236647-82236669 GAACAGCCACAGACACAGTTGGG + Intergenic
1120553931 14:85906320-85906342 GAGCATCCAGAGAGAAAGGTTGG - Intergenic
1122297121 14:100711960-100711982 GATCAGCCCCAGAGGCAGGAGGG + Intergenic
1122607320 14:102955495-102955517 GAACATCAACAGAGGTCGGTGGG + Intronic
1124831545 15:33154081-33154103 GCAGCTCCACAGAGGCAGGAGGG - Exonic
1127982485 15:64045398-64045420 TATCTTCCACAGAGGCAGTTGGG + Intronic
1128747408 15:70124220-70124242 GATCATCCTGAGAGGCAGGGAGG - Intergenic
1128765457 15:70248446-70248468 GAACAGTCACAGAGGCAGGAAGG + Intergenic
1131465846 15:92654574-92654596 GAACATTCACAGGGGCATGAGGG - Intronic
1134073577 16:11275532-11275554 GCCCTTCCTCAGAGGCAGGTAGG - Intronic
1134205451 16:12233796-12233818 GCACATCCACAGAGACAGGAAGG - Intronic
1134397751 16:13880842-13880864 GAACATAAACAGAAGTAGGTAGG - Intergenic
1139973909 16:70793698-70793720 GAACATCCTCAGCTGTAGGTGGG + Intronic
1142428466 16:90013073-90013095 CAGCACCCTCAGAGGCAGGTGGG + Intronic
1142799976 17:2338537-2338559 CAACAGCCACAGAGGCAGGCAGG - Intronic
1143954819 17:10659992-10660014 GTACTTCCACAGCAGCAGGTCGG + Intergenic
1144948449 17:18981631-18981653 AAGCAACCACAGAGGCAGGCAGG + Intronic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1149324055 17:55511651-55511673 CAGCATCCACACAGGCAGTTTGG + Intergenic
1149658150 17:58320870-58320892 GAGCATCCAGAGAGGTAGGGGGG - Intronic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1152143073 17:78549938-78549960 GAACAGCCACAGAGGAGGCTGGG + Intronic
1152242953 17:79169654-79169676 GCAAATCCACAGAGGCTGGCAGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1153833133 18:8940675-8940697 GAATTTCCACAGAAGCAGGAAGG + Intergenic
1154191512 18:12234523-12234545 GAACATCCAAACAGCCAGGAGGG + Intergenic
1160132144 18:76235012-76235034 GACCATTCACAGAGGAAGGGGGG - Intergenic
1160688209 19:447257-447279 GCCGATCCACAGAGGCAGGAAGG + Intronic
1160712675 19:559698-559720 GCCCATCCACAGAGACAGGGAGG - Intergenic
1160730064 19:637832-637854 GCCCATCCACAGAGGCAGGAAGG + Intergenic
1160794227 19:936929-936951 GCCAATCCACAGAGGCAGGAGGG - Intronic
1160881189 19:1321397-1321419 GCAGATCCACAGAGACAGGGAGG - Intergenic
1160893595 19:1392494-1392516 GCCCATCCACAGAGACAGGGAGG - Intronic
1160961471 19:1723581-1723603 GCCCATCCACAGAGACAGGAGGG + Intergenic
1161104264 19:2435503-2435525 GCCCATCCACAGAGACAGGGAGG + Intronic
1161140503 19:2644662-2644684 GCCGATCCACAGAGGCAGGGAGG - Intronic
1161160477 19:2758931-2758953 GCCCATCCACAGAGACAGGAAGG + Intronic
1161167001 19:2793353-2793375 GCCCATCCACAGAGACAGGAGGG - Intronic
1161249798 19:3274461-3274483 GCACATGCACACAGGCAGGAAGG - Intronic
1161282047 19:3451247-3451269 GGCCAGCCACAGAGGCAGGAAGG + Intronic
1161306334 19:3570934-3570956 GCCCATCCACAGAGACAGGAGGG - Intronic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1161361700 19:3853627-3853649 GCCAATCCACAGAGGCAGGAAGG + Intronic
1161476693 19:4489941-4489963 GCCCCTCCACAGAGGCAGGAAGG - Intronic
1161509833 19:4664125-4664147 GCCCATCCACAGAGACAGGAGGG + Intronic
1161736799 19:5996501-5996523 GCCGATCCACAGAGGCAGGAGGG + Intronic
1164678821 19:30120718-30120740 GGACAGCCACACAGGCTGGTAGG - Intergenic
1166450696 19:42898038-42898060 GAACATGGAAAGTGGCAGGTGGG + Intronic
1167980860 19:53273599-53273621 AGACATCCACAGAAGCAGGAAGG - Intergenic
926693886 2:15757143-15757165 GTAAATCCACAAAAGCAGGTTGG + Intergenic
926994915 2:18724415-18724437 GAGCTTCCACAGAGGGATGTGGG + Intergenic
929420278 2:41783348-41783370 GAACACCCACAGATACAGGATGG - Intergenic
931217236 2:60257463-60257485 GAACATCCACATATGCAGAGTGG + Intergenic
931848378 2:66228422-66228444 GAACACCTCCAGAGGCAGGCTGG - Intergenic
936062781 2:109306522-109306544 AAGCATCCACAAGGGCAGGTCGG - Intronic
937540323 2:122942782-122942804 CAACAACCACAGAGGCAGGGAGG + Intergenic
937730957 2:125228363-125228385 GAACTTCCAAAGAGGAAGCTGGG + Intergenic
939232292 2:139444448-139444470 TTACCTCCACAGAGGCAGCTTGG + Intergenic
941376918 2:164742518-164742540 GGCCATCCACAGCTGCAGGTGGG + Intronic
941664047 2:168226122-168226144 AAACAGCCAGAGAAGCAGGTGGG + Intronic
943771957 2:191727651-191727673 GAAAAACCACAGAGGCAGGAAGG + Intergenic
1169152875 20:3304300-3304322 GCACAGCCACTGAGGCAGGCAGG - Intronic
1171213782 20:23337037-23337059 GAACAGCCACACAGGGAGGCTGG - Intergenic
1173298801 20:41782355-41782377 GGCCCTGCACAGAGGCAGGTGGG + Intergenic
1175149049 20:56918683-56918705 GAAGACCCAGAGAAGCAGGTGGG + Intergenic
1175642505 20:60642795-60642817 GAACAGCCACAGAGGGAGGCTGG - Intergenic
1175700897 20:61136342-61136364 GTTCATTCACAGAGGCAGGGAGG + Intergenic
1177146789 21:17415263-17415285 GTACTTCCATAGAGGCAGGTGGG - Intergenic
1177844001 21:26267824-26267846 GAACATGCAGACAGTCAGGTCGG + Intergenic
1179434987 21:41355632-41355654 GAAAATCCACAGAGTCAGAAAGG + Intronic
1180950217 22:19717469-19717491 GAATGTCCACAGAAGCACGTGGG + Intronic
1181893376 22:26084512-26084534 GAACAGCCACATAGGGAGGAGGG + Intergenic
1182168638 22:28203708-28203730 GTTAATCCACAGAGGCAGGTGGG - Intronic
1183866507 22:40708472-40708494 GATCATCCAGAGAGGCAGGAGGG + Intergenic
1185216285 22:49601725-49601747 CAACATCCACAGTGGCCGCTGGG + Intronic
949605525 3:5648871-5648893 GAAACTCCACAGAATCAGGTTGG + Intergenic
950196359 3:11011825-11011847 GAGCATCCACTGAGGAAGGATGG + Intronic
953439777 3:42907380-42907402 CACCAGCCACAGAGGCAGCTAGG - Intronic
955037650 3:55284416-55284438 TAACATCCTTAGAGGCAGGCAGG + Intergenic
956397947 3:68845919-68845941 GAGCATCCAGAGAGAAAGGTCGG - Intronic
956672230 3:71701916-71701938 GTACCTCCATAGAGGCAGATGGG - Intronic
963092957 3:141503249-141503271 AAACATCCACATAGGCACATAGG + Intronic
964698543 3:159537297-159537319 GAAAACCCACAGAGCCAGGATGG - Intronic
964768233 3:160198588-160198610 GAGCTTCCACAGTGGCAGCTTGG + Intergenic
969227334 4:5807575-5807597 GGGCATCCAGAGAGGGAGGTGGG + Intronic
969993352 4:11287194-11287216 GGACAACTACAGAGGCATGTAGG - Intergenic
970647367 4:18138062-18138084 GCCCACCCACAGAGGAAGGTGGG - Intergenic
970950621 4:21751067-21751089 GAAATTCTACAGAGGTAGGTAGG + Intronic
972742801 4:41905015-41905037 GGGCATCCAGAGAGACAGGTCGG - Intergenic
975398940 4:73911556-73911578 CCACATCCACTGAGGCAGATAGG - Intergenic
976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG + Exonic
976972786 4:91128063-91128085 TGACATCCACAGTGGCATGTGGG - Intronic
981959884 4:150523742-150523764 GACTATCCTCAGAGGGAGGTGGG + Intronic
985304371 4:188522351-188522373 GAAGAGCCACAGAGCCAGGAGGG + Intergenic
990769906 5:59231420-59231442 GAACATCAAGATAGGCATGTGGG - Intronic
991961349 5:72047615-72047637 GAAGATCCAAAGAAGCAGATAGG - Intergenic
993092658 5:83445547-83445569 CAACATACACAGAGGCATGCAGG + Intergenic
994622301 5:102178011-102178033 GAGCAGCCACAGAGAAAGGTCGG - Intergenic
994788716 5:104197141-104197163 GGAGATACACAGGGGCAGGTTGG + Intergenic
996195849 5:120605995-120606017 GCACACCAACAGAGGCAGGGGGG + Intronic
996580845 5:125030438-125030460 GTACATTCACAGAGGCAGGAAGG + Intergenic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
1001556450 5:172640852-172640874 GAACTTACACAGAGGCAGACGGG - Intergenic
1003051286 6:2783135-2783157 GCACACGCACAGAGGCAGGAGGG - Intronic
1003563846 6:7205656-7205678 GAACATTCAGGGAGGCAGGGAGG + Intronic
1004714867 6:18207292-18207314 GAACAGCCACCAAGGCAGGAGGG - Intronic
1005097916 6:22138666-22138688 GAACATGCACAGAGAAAGGCTGG + Intergenic
1005884332 6:30085009-30085031 GAACAGCCAGAGAGAAAGGTCGG - Intergenic
1006466167 6:34196193-34196215 AAACACCCAGTGAGGCAGGTTGG - Intergenic
1008910111 6:56722789-56722811 GAACATGTACAAAGGCAGGGAGG + Intronic
1011146204 6:84220022-84220044 GATAATGCACAGAGGCAGGGAGG + Intronic
1012405713 6:98894919-98894941 GAACAACCACTGATGCAGGGAGG + Intronic
1013424816 6:110001468-110001490 GAACATCCAAAAAGCCAGCTGGG + Intergenic
1014835763 6:126158772-126158794 GAAGTTCCACAAAAGCAGGTGGG - Intergenic
1016407607 6:143746703-143746725 GAACACCCACAGTGACAGGTGGG - Intronic
1019180246 6:170182338-170182360 GAGCATCCACACCTGCAGGTGGG + Intergenic
1020611486 7:10402906-10402928 GAACATCCTCAGAGACTGGCAGG + Intergenic
1022566402 7:31407039-31407061 ATACATCCACAAAGACAGGTTGG - Intergenic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1024709232 7:51996355-51996377 GAACATGCACAGAGGCCAGAAGG - Intergenic
1026371122 7:69700536-69700558 GAAAATCCCCAGAGGCAGCCAGG - Intronic
1031510748 7:122646448-122646470 GAACAGACACAGGGGCAGGAAGG + Intronic
1032486142 7:132288898-132288920 GAACATCCTGGGAGGCAGGGTGG + Intronic
1032994107 7:137426136-137426158 GGGCAGCCAGAGAGGCAGGTTGG + Intronic
1035053767 7:156020022-156020044 TAACAGGCACAGAGGCAGGTAGG + Intergenic
1035099737 7:156386571-156386593 CAAGATCCAGAGAGGCAGGGTGG - Intergenic
1035271713 7:157723638-157723660 GAACTTCCACAGTGGCTGGCAGG - Intronic
1035615840 8:1000801-1000823 GGCCATCCACAGAGGCTGCTTGG - Intergenic
1035634494 8:1134009-1134031 CAACATCCACAGGGGCCTGTGGG - Intergenic
1036682863 8:10888249-10888271 GAACATCCTCAGAAGCCAGTGGG - Intergenic
1037122469 8:15305255-15305277 GAAAAACCACAGTGGTAGGTAGG + Intergenic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1039637690 8:39183664-39183686 CAACATCCAGAGAGGTAGGAAGG - Intronic
1047380009 8:124352794-124352816 GTGTATCCACACAGGCAGGTTGG + Intronic
1047510123 8:125509517-125509539 GAAATTCCAAAGAGGCAGGGTGG - Intergenic
1048851483 8:138649571-138649593 GAACACCTTCAGAGGCAGATGGG + Intronic
1049185834 8:141252640-141252662 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185846 8:141252744-141252766 GGAAATTCACAGACGCAGGTGGG - Intronic
1049300578 8:141867377-141867399 CATCATCAACAGAGGCAGGACGG - Intergenic
1051580592 9:18669594-18669616 TAACATTTACAGAGGCACGTTGG - Intronic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1055755184 9:79550612-79550634 AATCACCCACAGAGGCATGTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058605519 9:106718222-106718244 ACACTTCCACAGAGACAGGTAGG - Intergenic
1061504362 9:131022973-131022995 GCAAATCCACAGAGACAGGAAGG - Intronic
1061630195 9:131867477-131867499 GAATATCCAAGGAGGCAGATTGG - Intronic
1061862151 9:133473560-133473582 GTACAGCCCCAGAGTCAGGTTGG + Exonic
1062443196 9:136582679-136582701 GAACAGCCACAGGGGCCAGTGGG - Intergenic
1186038494 X:5450039-5450061 GAATATTCACAAAGTCAGGTTGG + Intergenic
1186160205 X:6769432-6769454 ATTAATCCACAGAGGCAGGTGGG + Intergenic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1192763663 X:74121799-74121821 GTACATTCACAGGGGCAGGGGGG + Intergenic
1194421228 X:93674883-93674905 GAAAATCCACAGAGGTAATTTGG + Intronic
1195768298 X:108319991-108320013 GTTCATCCACAGTGACAGGTGGG + Intronic