ID: 1152255714

View in Genome Browser
Species Human (GRCh38)
Location 17:79238339-79238361
Sequence AGGCATTTGGATCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152255708_1152255714 0 Left 1152255708 17:79238316-79238338 CCCCACTGAACAAACACACAGCC 0: 1
1: 0
2: 1
3: 31
4: 302
Right 1152255714 17:79238339-79238361 AGGCATTTGGATCTGAAGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 231
1152255710_1152255714 -2 Left 1152255710 17:79238318-79238340 CCACTGAACAAACACACAGCCAG 0: 1
1: 0
2: 3
3: 32
4: 309
Right 1152255714 17:79238339-79238361 AGGCATTTGGATCTGAAGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 231
1152255709_1152255714 -1 Left 1152255709 17:79238317-79238339 CCCACTGAACAAACACACAGCCA 0: 1
1: 0
2: 3
3: 28
4: 336
Right 1152255714 17:79238339-79238361 AGGCATTTGGATCTGAAGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 231
1152255707_1152255714 4 Left 1152255707 17:79238312-79238334 CCAGCCCCACTGAACAAACACAC 0: 1
1: 0
2: 2
3: 29
4: 313
Right 1152255714 17:79238339-79238361 AGGCATTTGGATCTGAAGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152255714 Original CRISPR AGGCATTTGGATCTGAAGCC AGG Intronic
900228690 1:1545035-1545057 AGGCATCTGTGTATGAAGCCTGG + Intronic
901119109 1:6875728-6875750 AGGAATCTGGATGTGCAGCCAGG - Intronic
901878262 1:12179389-12179411 AGGCATTTGGGTCTCAACCTTGG - Intronic
902645806 1:17797135-17797157 AGGGATTTGGATCCCAACCCTGG - Intronic
904420554 1:30388265-30388287 AGGAATTTGGAACTGAATTCAGG - Intergenic
905174629 1:36127717-36127739 TGGCACTTGGATTTGAACCCAGG - Intergenic
905771707 1:40642216-40642238 AGGCCTTTGGAATTCAAGCCCGG - Intronic
906006577 1:42478030-42478052 AGGCATTTGGATTTGACACCTGG + Intronic
906339944 1:44970842-44970864 AGGCAATCTGATATGAAGCCAGG + Intronic
907187938 1:52625400-52625422 TGTCCTTTGGATTTGAAGCCAGG - Intergenic
909330861 1:74408744-74408766 TTGCATTTGGATTTGAAGCAGGG - Intronic
910179216 1:84463084-84463106 AGGCACTTGGACATGTAGCCTGG - Intergenic
910244161 1:85120942-85120964 ATGGATTGGGATCTGTAGCCAGG - Intronic
911829026 1:102526669-102526691 AGTCATTGGGTTTTGAAGCCTGG + Intergenic
912475192 1:109930298-109930320 AGGCATTGGAAGCTGAGGCCTGG - Exonic
914743229 1:150482414-150482436 AGGCAGGTGGATCTGAGGTCAGG - Intergenic
915956610 1:160225466-160225488 AGTCATCTGGATTTGAATCCTGG - Intronic
916906393 1:169289511-169289533 AGTCACTTGGATTTGAATCCTGG - Intronic
917368623 1:174262689-174262711 AGAAATTTGGATATGTAGCCTGG + Intronic
919474370 1:198016674-198016696 AGGTATTTGGATCATGAGCCTGG - Intergenic
920582045 1:207119165-207119187 ATGTACTTGGATCAGAAGCCAGG + Intronic
922412851 1:225392585-225392607 GGGCATTTGGACTTGAAGCAGGG - Intronic
1065268413 10:24001256-24001278 AGACATTTGCATATGAAGCATGG - Intronic
1067289833 10:44932663-44932685 GGACATCTGGATCTGAAGACTGG - Intronic
1069850374 10:71400255-71400277 AGAGATTTGGATCAGAGGCCTGG + Intronic
1071821590 10:89285987-89286009 AGGCATTTGGGTTTTAAGTCGGG - Intronic
1073791231 10:106942385-106942407 AGGCATTTGGTTATGATTCCAGG - Intronic
1075677365 10:124304611-124304633 AGGCATTTGCTTCAAAAGCCAGG - Intergenic
1076741465 10:132487904-132487926 AGGGAATTGGATCAGAGGCCTGG + Intergenic
1078192337 11:9101751-9101773 AGGCAGGGGGATCAGAAGCCAGG - Intronic
1078453686 11:11458799-11458821 TGGGATTTGGATCTCAAGGCTGG - Intronic
1078847951 11:15138609-15138631 AGCTCTTTGGATCTGAAGTCTGG + Intronic
1080386634 11:31814428-31814450 AGGCTCTTGGTTCTGAAGCTGGG - Intronic
1083864273 11:65445334-65445356 AGACATGTGGATGTGAAGCTGGG + Intergenic
1083908884 11:65693525-65693547 AGCCATTTGGATCTGAGGAGGGG - Intergenic
1084940545 11:72610443-72610465 TGAAATTTGGAGCTGAAGCCTGG - Intronic
1085319909 11:75567715-75567737 AGGCATCTGGGCCTGAGGCCTGG - Intronic
1085706635 11:78792345-78792367 AGCCATTTGTATTTGTAGCCTGG + Intronic
1085745048 11:79107909-79107931 TAGCACTGGGATCTGAAGCCAGG + Intronic
1085786857 11:79459902-79459924 AGGGATTTGGCCCTGAAGTCAGG - Intergenic
1087496869 11:98902546-98902568 AGGTATTTGAATAGGAAGCCAGG - Intergenic
1088390533 11:109309552-109309574 AGCAATTTGCATCTGAAACCTGG - Intergenic
1088690517 11:112322656-112322678 AGGACTTTGAATCTGACGCCAGG + Intergenic
1088725847 11:112633866-112633888 AGGCATTTGGAACTGAACACTGG - Intergenic
1088886087 11:114008195-114008217 AGGCATTAGGATCAGAATCAAGG - Intergenic
1089570312 11:119403626-119403648 ATGCTTTTGGATCTGAAGCCTGG + Intergenic
1090583230 11:128182291-128182313 AGGCATTGGGCTGAGAAGCCAGG - Intergenic
1091400700 12:179000-179022 AGGCTTTGGGAGCTGATGCCTGG - Intergenic
1092203833 12:6603606-6603628 TGGCATTTGGACCTGGGGCCAGG - Intronic
1092615014 12:10209104-10209126 AAGCATTTGAATCTGAAAACAGG - Intergenic
1093000612 12:13991976-13991998 TGGCATTTGGATATGAACTCAGG + Intergenic
1094451023 12:30583190-30583212 AGGCATGTGGAACTCAAGACAGG + Intergenic
1094526469 12:31234405-31234427 TGGCCTTGGGATCTAAAGCCAGG + Intergenic
1095903724 12:47355588-47355610 AGGCATTTGGATATGAAGTCTGG + Intergenic
1096229297 12:49888477-49888499 AGGCCTTGAGATCTGAATCCTGG - Intronic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1098297798 12:69021838-69021860 TGGCACTTGGACCTGAAGCTGGG + Intergenic
1098655439 12:73023399-73023421 GGCCATTTGTATCTGAAGCATGG - Intergenic
1098940440 12:76528518-76528540 AGGCATTTGGTTATTAAGACTGG - Intronic
1099897405 12:88666630-88666652 TGGAATTTGGATGTGTAGCCTGG + Intergenic
1100148578 12:91708022-91708044 ACACATTTGGTTCTGAATCCTGG - Intergenic
1101441178 12:104705264-104705286 ATGAATTTGGAGCCGAAGCCTGG - Intronic
1101499852 12:105293022-105293044 AGACATTTGGAACTGAGGGCTGG + Intronic
1106634125 13:31508880-31508902 TGGCATTTGGATATGAGGCTGGG + Intergenic
1106722100 13:32445700-32445722 AGGCATTTGGGCCTGAGGCCAGG + Intronic
1109703409 13:66056938-66056960 AGGCATTAGGCTGTGAAGGCAGG + Intergenic
1111466353 13:88616553-88616575 AGGTATTTGGATCTAGAGCCTGG - Intergenic
1113625968 13:111846693-111846715 ATGCATTTGCGTATGAAGCCAGG - Intergenic
1115738056 14:36356125-36356147 AGGACTTTGGAACTGAAGGCAGG - Intergenic
1119141968 14:72275492-72275514 AAGCTTTTGAATCTGTAGCCTGG - Intronic
1120923293 14:89774127-89774149 AGACATTTGGAGTTGATGCCTGG - Intergenic
1121349392 14:93161472-93161494 AGGATTTTGCATCTGGAGCCAGG - Intergenic
1124392906 15:29276210-29276232 AGCCATTTGGCCCAGAAGCCTGG + Intronic
1126342395 15:47655338-47655360 AGGGATTTTGATGTGAAACCAGG + Intronic
1127405193 15:58636920-58636942 AGGCATTTGGCTTTCAAGTCTGG + Intronic
1127628618 15:60804489-60804511 CAGCATCTGAATCTGAAGCCAGG + Intronic
1127730952 15:61801522-61801544 TGGAATCAGGATCTGAAGCCAGG + Intergenic
1128060782 15:64734458-64734480 AGGCAGGTGGATCTGAGGTCAGG + Intergenic
1129635517 15:77312702-77312724 AGGAATATGGAACTGATGCCTGG - Intronic
1130691830 15:86088197-86088219 AGGCCTTTGAATCACAAGCCTGG + Intergenic
1132062104 15:98700720-98700742 AGGCAGCTGGAGCTGATGCCTGG - Intronic
1132367540 15:101268363-101268385 AGGCATTTGTTTCTGGAGGCTGG - Intergenic
1133178402 16:4033763-4033785 AGGAATTGGGATCTGAACCCAGG - Intronic
1136358345 16:29761275-29761297 AGGCAGGTGGATCTGAGGTCAGG + Intergenic
1139084253 16:63564831-63564853 AGTCATTTGGATGTCAAGCAAGG + Intergenic
1140521476 16:75585572-75585594 AGGCATTTTGCTCTGCAGCCGGG - Intergenic
1141845886 16:86608692-86608714 AGGGCTTTGGGTCTGGAGCCAGG + Intergenic
1142192262 16:88723404-88723426 AGGGATCTGGATCTGGCGCCCGG - Intronic
1142630574 17:1223489-1223511 AGCCCTTAGGATTTGAAGCCAGG - Intronic
1142757544 17:2024914-2024936 AGGGATTTGAATCTGGACCCCGG - Exonic
1143202397 17:5121974-5121996 AGGGATTTGGAGCTGAAGAGGGG + Intronic
1146164113 17:30574802-30574824 AGGGATTTGGAGCTGAAGAGGGG - Intergenic
1146729823 17:35183701-35183723 AGGCAGTAGGAACAGAAGCCTGG - Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147887112 17:43691460-43691482 AGGCACTTGGATCTGATCGCTGG + Intergenic
1148032076 17:44628436-44628458 AGGCCCTGGGATCTGAGGCCTGG - Intergenic
1149385133 17:56135414-56135436 AGGAATTTGGATTAGAACCCAGG + Intronic
1151092526 17:71459300-71459322 AAGCATTTGGATTTTCAGCCTGG + Intergenic
1151387351 17:73763172-73763194 AGGCAATTGGACCAGCAGCCAGG - Intergenic
1152255714 17:79238339-79238361 AGGCATTTGGATCTGAAGCCAGG + Intronic
1153262292 18:3236319-3236341 AGTCATTTTCATCTCAAGCCTGG - Intergenic
1154016105 18:10619360-10619382 AGCCATCTGGGCCTGAAGCCAGG - Intergenic
1154189408 18:12216281-12216303 AGCCATCTGGGCCTGAAGCCAGG + Intergenic
1155757063 18:29512825-29512847 AGACACTTGGGTCTGAAGGCAGG + Intergenic
1156608362 18:38696345-38696367 TGGCATTTGGATTTGAAGGGAGG - Intergenic
1157234818 18:45954373-45954395 AGGTATTTTGATCAGAAGCCTGG - Exonic
1158337673 18:56431687-56431709 AGTCACTTGGAACTTAAGCCAGG - Intergenic
1161539223 19:4839584-4839606 AGGCGATCGGAGCTGAAGCCAGG + Intronic
1164477190 19:28584949-28584971 AGGCATTGGGACCTGAGGCTGGG + Intergenic
1165192657 19:34078265-34078287 ATGGATTTGGATTTGAAGGCAGG - Intergenic
1165527665 19:36369736-36369758 AGGTATTTGTCTCTGAAGCAAGG + Intronic
1166019277 19:40010908-40010930 AGGCAGGTGGATCTGAGGTCAGG - Intronic
1166673004 19:44722718-44722740 GGGCATCTGGATTTGAACCCAGG + Intergenic
1166974850 19:46600100-46600122 TGGGGTTTGGATCTGCAGCCTGG - Intronic
1168171754 19:54594398-54594420 AGGAATTTGCCCCTGAAGCCTGG - Intronic
1168718775 19:58543640-58543662 AGGCGGTTGGATCTTAAGTCAGG - Intergenic
925662835 2:6221255-6221277 AGGCATTCGGAAGTGGAGCCAGG + Intergenic
925767618 2:7251837-7251859 TGGCATATGGTTCTGAAGGCTGG - Intergenic
928036162 2:27825574-27825596 AGTGATTTGTATCTGAAACCAGG + Intronic
930106235 2:47642138-47642160 TGGCATTTGTATCTCTAGCCTGG + Intergenic
931636081 2:64341726-64341748 AGGCAGTTGGCTCTGGAGCCTGG - Intergenic
940330136 2:152465511-152465533 AGGCTTTTGGATGTGAGTCCAGG + Intronic
941724666 2:168848426-168848448 TGACATTTGGATTGGAAGCCTGG - Intronic
942464948 2:176197923-176197945 AGGCATTTGGATGGAAAGACAGG + Intergenic
944400162 2:199316961-199316983 TGGCATTTGGACCTGAAGGGAGG - Intronic
944684425 2:202105601-202105623 AGGGCTATGGAACTGAAGCCTGG - Intronic
945459409 2:210088047-210088069 AGGCATTTGGATTGGATACCAGG - Intronic
946816209 2:223581091-223581113 AGGCTATTGGAGCTGAAGTCAGG - Intergenic
948499102 2:238378772-238378794 TCGCAGTTTGATCTGAAGCCGGG + Intronic
1168939140 20:1694418-1694440 AGGCATTTGGAGCTGAGTCTGGG + Intergenic
1169123906 20:3113570-3113592 AGGCAGTGGGAGCTGCAGCCAGG + Intronic
1169399887 20:5270846-5270868 AGGCACCTGGAGCCGAAGCCAGG - Intergenic
1172107441 20:32525092-32525114 AGGCATATGGACGAGAAGCCAGG + Intronic
1175189827 20:57203913-57203935 AGGCATTTCAACCTGGAGCCTGG - Intronic
1175198345 20:57261746-57261768 AGGCATTTGCAGCTGTAACCTGG - Intronic
1175344446 20:58262300-58262322 AGGCATCCTGATCTGAAGGCAGG + Intergenic
1180840401 22:18956422-18956444 AGGCAGTTGGAACTCAGGCCAGG - Intergenic
1181061090 22:20282354-20282376 AGGCAGTTGGAACTCAGGCCAGG + Intronic
1182893574 22:33839916-33839938 ATGCATCTGGGTTTGAAGCCTGG - Intronic
1183207320 22:36428428-36428450 TGGCATCTGGCTTTGAAGCCAGG - Intergenic
1183939837 22:41287564-41287586 AGGCAGGAGGATCTGGAGCCTGG + Intergenic
1184168318 22:42743593-42743615 AGGCATTTGGAGCAGAGCCCAGG + Intergenic
949822872 3:8135073-8135095 AGGAATTGAGATCTGCAGCCAGG + Intergenic
950536189 3:13580175-13580197 AGGCATAAGGACCAGAAGCCTGG - Intronic
950684657 3:14607856-14607878 TGGGATTTGGATCTGCAGCTGGG - Intergenic
950787096 3:15445973-15445995 ACACATCTGGATTTGAAGCCTGG - Intronic
953137161 3:40190876-40190898 ACACAGTTGGATCTGAACCCAGG - Intronic
953533663 3:43760089-43760111 ATGCAGTGGGCTCTGAAGCCAGG - Intergenic
954394669 3:50287205-50287227 TGCCATTTGGATCTGGGGCCTGG + Exonic
956144774 3:66181680-66181702 GGGGATCTGGATTTGAAGCCTGG - Intronic
956407993 3:68948788-68948810 AGGCATCAGGATTTGAATCCTGG + Intergenic
959949961 3:112168837-112168859 TGGCATATTGATCTGAAGACAGG + Intronic
960519240 3:118636487-118636509 AGGCATTTGGATGGGAAGGAAGG - Intergenic
960641138 3:119824514-119824536 GGGCAGTTGGATCTGAATGCAGG + Intronic
960996260 3:123342507-123342529 AGTCCTGTGGATCTGCAGCCAGG - Intronic
961078136 3:124000735-124000757 AGGCATTAGAATCTGAATCAAGG - Intergenic
961305382 3:125956041-125956063 AGGCATTAGAATCTGAATCAAGG + Intergenic
961562602 3:127740945-127740967 AGGCATTGGTACCTGCAGCCTGG - Intronic
963525312 3:146408869-146408891 AGGAATTTGGGTCTCAGGCCAGG + Intronic
965699554 3:171445872-171445894 TGGCAGTTTCATCTGAAGCCAGG + Intronic
967604193 3:191424889-191424911 AGGCCTTTGAATCTGACACCAGG + Intergenic
967982387 3:195073429-195073451 AGGTATTTGGTTCTGAGTCCTGG + Intronic
969946630 4:10790149-10790171 TGGCCAATGGATCTGAAGCCAGG + Intergenic
970974619 4:22029082-22029104 AGTTATTTGGTTCTGAAACCTGG - Intergenic
972377484 4:38486152-38486174 AGGCATGTGCATAGGAAGCCTGG + Intergenic
977007861 4:91594531-91594553 ATGCATTTGGATCGGAAGGATGG - Intronic
984058331 4:174957875-174957897 AGGCATTTGGTGATGATGCCTGG + Intronic
985528853 5:422019-422041 AGGCATCTGCACCTGGAGCCTGG - Intronic
985764198 5:1768279-1768301 AGGTATGTGGGTCAGAAGCCAGG + Intergenic
986587478 5:9334014-9334036 AGGTACTTGGATCTGAATTCAGG - Intronic
987023895 5:13903792-13903814 AGGCATTTGGGTGTAAAGACTGG + Intronic
988436618 5:31182572-31182594 AGGCATTTGGGTCCAATGCCAGG + Intergenic
990570121 5:57070069-57070091 AGGCACTAGGATTTGAACCCTGG + Intergenic
990813341 5:59753503-59753525 AGGCATATGGAACTTGAGCCTGG + Intronic
991296911 5:65091315-65091337 AGGCATGTGGAGCAGAAGGCTGG + Intergenic
992091647 5:73322942-73322964 AGCCATCTGGGTCTGCAGCCTGG - Intergenic
992703258 5:79362147-79362169 AGTCTTATGGATCTGAAGCATGG - Intergenic
992891660 5:81209744-81209766 AGACATGTGGGTCTGGAGCCTGG - Intronic
993072081 5:83177830-83177852 AGGCTTTAGAATCTTAAGCCAGG + Intronic
993784290 5:92109437-92109459 AGAATTTTGGCTCTGAAGCCAGG + Intergenic
994909324 5:105882569-105882591 AGGCAGGTGGATCTGAGGTCAGG + Intergenic
995560088 5:113371241-113371263 AGACAGTTGAATCAGAAGCCAGG + Intronic
995879246 5:116825528-116825550 AGGCATCTGGATCTGGAATCAGG - Intergenic
996150413 5:120027935-120027957 AGGCAGGTGGATCTGAGGTCAGG + Intergenic
997766459 5:136508661-136508683 GGGCCTTTCTATCTGAAGCCAGG - Intergenic
1000849743 5:166325369-166325391 AGGCTTTAGGATCCGAACCCTGG + Intergenic
1004690915 6:17991338-17991360 AAGCATTTGGATTTGGAGCCAGG + Intergenic
1004767054 6:18741530-18741552 AGGCATCTGGCTCTGTGGCCTGG - Intergenic
1007841363 6:44718522-44718544 AGACATTAAGATCTGCAGCCAGG - Intergenic
1011455462 6:87543681-87543703 AGCCCTTTAGATCTGAAGCTTGG - Intronic
1012044924 6:94261351-94261373 ATGCCTTTGGATATGAAGCATGG + Intergenic
1013353074 6:109323345-109323367 ATGCATTTGCATCTGCAGGCAGG - Intergenic
1017997110 6:159541666-159541688 AGGAATTGGTATCTGAACCCAGG + Intergenic
1019825471 7:3280590-3280612 TGGCATTGGGATCTGCAGCCTGG + Intergenic
1021231734 7:18093271-18093293 TGGCATTAGGATTTGAATCCAGG + Intronic
1021482127 7:21129686-21129708 AGGTATTTGAATCTGAGGACGGG - Intergenic
1022913855 7:34926863-34926885 AGGCCTCTGAATCTGAAGTCTGG + Intergenic
1023451291 7:40288395-40288417 AGGCTGTTGGTTCTCAAGCCTGG + Intronic
1027117179 7:75490494-75490516 AGGCAGGTGGATTTGAGGCCAGG + Intergenic
1029921129 7:104265370-104265392 AGCCATTTGGATCTGTGGCTTGG + Intergenic
1030297720 7:107945636-107945658 AAGAACTGGGATCTGAAGCCAGG - Intronic
1030825610 7:114153840-114153862 AGGTATTTGAAACTGAAGCCAGG - Intronic
1032403940 7:131642472-131642494 AGGCATGTGGCTCTGTGGCCTGG - Intergenic
1034357844 7:150467054-150467076 AAGTGTTTGGAGCTGAAGCCAGG + Exonic
1034377321 7:150657538-150657560 AGGAATTTGCACCTTAAGCCTGG - Intergenic
1034780923 7:153881787-153881809 AGCCATTAGGACCTGGAGCCAGG - Intergenic
1034948373 7:155279330-155279352 ATACATTTTAATCTGAAGCCAGG + Intergenic
1035729313 8:1843381-1843403 AGGCATCTGGAGCTGCAGCATGG + Exonic
1036476816 8:9101119-9101141 AGGGATTTAGATTTTAAGCCAGG - Intronic
1036783385 8:11666742-11666764 AGGCAGGTGGATCTGAGGTCAGG + Intergenic
1038018692 8:23535259-23535281 AGACATGTGGAGCTGAGGCCAGG - Intronic
1038373427 8:27014363-27014385 TGGCAAGTGCATCTGAAGCCTGG + Intergenic
1038439000 8:27558731-27558753 AGGCCTGTGCAGCTGAAGCCTGG - Intergenic
1038566006 8:28620533-28620555 AGGCATTTGGACCGGAATCCAGG + Intronic
1040309705 8:46230443-46230465 AGGCACTCTGCTCTGAAGCCTGG - Intergenic
1040324463 8:46334690-46334712 AGGCATCATGCTCTGAAGCCTGG - Intergenic
1040337383 8:46422980-46423002 AGGCAGTTGGCTCAAAAGCCTGG - Intergenic
1040933650 8:52761483-52761505 AGGCAGGTGGATCCGAGGCCAGG - Intergenic
1042657187 8:71112615-71112637 AGGGATTTGGTGGTGAAGCCAGG + Intergenic
1042697032 8:71565578-71565600 AGACAGTTGGGTCTGAATCCTGG + Intronic
1044797285 8:95916726-95916748 GGGTATTAGGGTCTGAAGCCTGG - Intergenic
1045104219 8:98875609-98875631 AGGCATTGTGTTCTGAAACCTGG - Intronic
1046733818 8:117754185-117754207 AGGCTTTTGGATCTGTAGAGTGG - Intergenic
1046817762 8:118604105-118604127 AAGCAGTTGGAAGTGAAGCCTGG - Intronic
1048276681 8:133071351-133071373 AGGCATCTGGCTCTAGAGCCTGG + Intronic
1051613254 9:18981917-18981939 AGGCATTTGGCTTTGCAGCCTGG + Intronic
1053018287 9:34676557-34676579 AGGCAGTTGGCTCTGCAGCCTGG - Intergenic
1057743029 9:97728641-97728663 TGGCATTTGGATCTCAAAGCAGG + Intergenic
1058693831 9:107542220-107542242 AGCCACTTAGATCTGATGCCTGG - Intergenic
1059264215 9:113011101-113011123 AGGCATTTGTACCTTAAGCTGGG - Intergenic
1059492186 9:114677204-114677226 AGTCTTTTGGATCTGCTGCCAGG + Intergenic
1060639226 9:125224844-125224866 TGGGATTTGGAGCTGAAACCAGG - Intronic
1061368370 9:130184317-130184339 AGGCCTTGGGATTTGAATCCAGG - Intronic
1187252725 X:17613370-17613392 GGCCATTTGGATCTTAACCCTGG - Intronic
1187386407 X:18852557-18852579 AGGCCTGTGGACCAGAAGCCGGG + Intergenic
1188637632 X:32454089-32454111 ATGGATTTGGAGGTGAAGCCTGG - Intronic
1188750262 X:33896306-33896328 TGGCTTATGGTTCTGAAGCCTGG - Intergenic
1189275144 X:39779978-39780000 AGGAATTTGGATGTGATGGCTGG - Intergenic
1189739682 X:44105122-44105144 AGGCATTAAGAGCTGGAGCCAGG + Intergenic
1192215688 X:69156657-69156679 TGGCATTTGCCTCTGCAGCCTGG - Intergenic
1193102388 X:77629059-77629081 AGGCTATTAGATCAGAAGCCTGG - Intronic
1193536811 X:82727193-82727215 AGACATTTGGTGCTGAAGACTGG + Intergenic
1194462054 X:94182999-94183021 TGGCATATGGATGTGAAGCTTGG - Intergenic
1195805899 X:108764752-108764774 AGGCATTGGCATCTGGTGCCTGG + Intergenic
1196698043 X:118634952-118634974 AGGCGGGTGGATCTGAAGTCAGG - Intronic
1198506445 X:137306009-137306031 AAGCAGTAGGATTTGAAGCCTGG - Intergenic
1199460672 X:148081194-148081216 TAGCATTTGGATCTGATGTCAGG + Intergenic
1200311773 X:155085759-155085781 AGGCAATTGGATCTCAAGCAGGG + Intronic
1201467672 Y:14302203-14302225 AGCCACTTGCATTTGAAGCCCGG - Intergenic