ID: 1152255720

View in Genome Browser
Species Human (GRCh38)
Location 17:79238368-79238390
Sequence GCCTTGGAAGGGTACGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152255708_1152255720 29 Left 1152255708 17:79238316-79238338 CCCCACTGAACAAACACACAGCC 0: 1
1: 0
2: 1
3: 31
4: 302
Right 1152255720 17:79238368-79238390 GCCTTGGAAGGGTACGTCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1152255713_1152255720 8 Left 1152255713 17:79238337-79238359 CCAGGCATTTGGATCTGAAGCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1152255720 17:79238368-79238390 GCCTTGGAAGGGTACGTCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1152255709_1152255720 28 Left 1152255709 17:79238317-79238339 CCCACTGAACAAACACACAGCCA 0: 1
1: 0
2: 3
3: 28
4: 336
Right 1152255720 17:79238368-79238390 GCCTTGGAAGGGTACGTCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1152255710_1152255720 27 Left 1152255710 17:79238318-79238340 CCACTGAACAAACACACAGCCAG 0: 1
1: 0
2: 3
3: 32
4: 309
Right 1152255720 17:79238368-79238390 GCCTTGGAAGGGTACGTCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152255720 Original CRISPR GCCTTGGAAGGGTACGTCTG TGG Intronic
903354869 1:22740485-22740507 GGCTTGGGATGGTACCTCTGTGG + Intronic
904861910 1:33544649-33544671 GCCTGGGAAGGGTGAGTCAGGGG + Intronic
907043474 1:51284238-51284260 ACCTTGGAAGGCTGCATCTGAGG + Intergenic
910725986 1:90339539-90339561 CCCATGGAAGAGTAAGTCTGTGG - Intergenic
922564832 1:226594953-226594975 GCCCTGGAAGGGGACTTATGAGG + Intronic
1067539137 10:47138924-47138946 TCCTTGGAAGGGCACTTCAGTGG - Intergenic
1074873243 10:117594500-117594522 GCTTTGGAAGGGGAGGCCTGTGG - Intergenic
1084965122 11:72740671-72740693 CCCTTGGGAGGGTAAGTCGGGGG - Intronic
1092153046 12:6264255-6264277 GCTTTAGAAAGGTACCTCTGTGG + Intergenic
1092862000 12:12726086-12726108 GCCTTGGAAAGGTAGAACTGGGG + Exonic
1098671777 12:73239513-73239535 GACTTGGAAGGGTAAGAGTGTGG + Intergenic
1111914901 13:94350765-94350787 GCCCTGGAAAGGAAGGTCTGGGG + Intronic
1113808528 13:113123638-113123660 GCCTGGGAAGGGAATGTGTGAGG + Intronic
1121680018 14:95786035-95786057 GCCTTGGAAAGATCCCTCTGGGG - Intergenic
1121887293 14:97555311-97555333 GCCTGGGAAGGGTACATGGGTGG - Intergenic
1125535554 15:40439897-40439919 GGCTTGGGAGGGCACGTCTGTGG + Intronic
1126386694 15:48100690-48100712 GCCCTGGGAGGGCACCTCTGGGG - Intergenic
1126528223 15:49682210-49682232 GGCTTGGAAGGGTGCCTGTGGGG + Intergenic
1127843174 15:62847534-62847556 TCCTTGGGAGGGTAGGACTGAGG + Intergenic
1129056484 15:72824031-72824053 TGCTTGGAAGGATCCGTCTGTGG - Intergenic
1129264198 15:74385369-74385391 CCCTGGGAAGGGGACTTCTGGGG - Intergenic
1133966190 16:10533527-10533549 CCCTTTACAGGGTACGTCTGTGG - Intronic
1139468568 16:67166666-67166688 TCCTTGCAAGGGGACTTCTGGGG - Intronic
1150575278 17:66425284-66425306 GCCTTGGAGGGAGAGGTCTGTGG - Intronic
1151599889 17:75099801-75099823 GCCTTGGGAGGGCAGATCTGGGG + Intronic
1152161132 17:78669402-78669424 GCCATGGTAGGGGACGTCTGAGG - Intergenic
1152255720 17:79238368-79238390 GCCTTGGAAGGGTACGTCTGTGG + Intronic
1155290339 18:24334623-24334645 GCCTTGGAAAGGTAGGTAAGTGG + Intronic
1160871950 19:1281722-1281744 GCCTAGGACGGGGACGTCAGTGG - Intergenic
1161588875 19:5119707-5119729 CCCTGGGGAGGGTACGGCTGGGG + Exonic
1162917646 19:13882848-13882870 CCCTTGGAAGGGTAAGGCAGGGG + Exonic
1162944493 19:14034012-14034034 GCCTCCGAAGGTTAAGTCTGAGG + Intronic
1163064849 19:14785263-14785285 TCCTGGGAAGGGGAAGTCTGGGG + Intergenic
1164528038 19:29026284-29026306 GCCTGGGGAGGGGAGGTCTGAGG - Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
925981896 2:9183997-9184019 GCCTTGGGAGGGCAGGTCAGCGG - Intergenic
928625530 2:33135949-33135971 GTCTTGGAAGTGTGTGTCTGGGG + Intronic
928654044 2:33431219-33431241 GGCTTGGAAAGGAAGGTCTGAGG + Intergenic
932751157 2:74372533-74372555 GCCTTGGGTGGGGATGTCTGAGG - Intronic
936061976 2:109300818-109300840 GCCTTGGAAGGCAAAGACTGTGG - Intronic
939382084 2:141448534-141448556 GCCTTGGTGGTGTAGGTCTGTGG + Intronic
941215704 2:162706040-162706062 GACTTGAAAGTGTACCTCTGTGG - Intronic
943082979 2:183278894-183278916 GCCTGGGAAGGGTATGTGGGTGG + Intergenic
1169103385 20:2972445-2972467 GCTTTGGAAGGCTAAGGCTGAGG - Intronic
1169408755 20:5349062-5349084 GCCTGGGAAAGGTGGGTCTGGGG - Intergenic
1169632834 20:7652331-7652353 GCTTTGGAAGGGTACCGCTATGG - Intergenic
1178018721 21:28383892-28383914 GCCTTGGAATGGTAAGTGTCAGG - Intergenic
1180595025 22:16967479-16967501 GCCCTGGAAGGTGACGTATGGGG + Intronic
1180756361 22:18164631-18164653 TCCCTGGAAGGATATGTCTGCGG - Intronic
1181075409 22:20372803-20372825 TCCCTGGAAGGATATGTCTGCGG + Intronic
1182432174 22:30305822-30305844 GCCTTGGAACTGAACGTCTGAGG + Intronic
950287687 3:11757988-11758010 GCCATGGAAGTGTAAGTCTGGGG + Intergenic
953709488 3:45258129-45258151 GCCTTGGGAGGGTATGAATGAGG + Intergenic
955392559 3:58531895-58531917 GTTTTGGATGGGTACCTCTGGGG + Intronic
955898791 3:63729398-63729420 GCCTGGGAAGGGTATGTGGGTGG + Intergenic
959988896 3:112608295-112608317 GCCATGGGAGGGTACTTCTAAGG + Intronic
975126837 4:70792452-70792474 GCCTAGAAAGGGTTAGTCTGTGG - Intronic
995683080 5:114742647-114742669 GACTAGGAAGAGTACGTTTGTGG - Intergenic
1002626884 5:180535165-180535187 GGCTAGGAAGGGGGCGTCTGGGG + Intronic
1004320406 6:14627553-14627575 CCCTTGGAAGGGTAGGTTTCAGG + Intergenic
1006088975 6:31616619-31616641 ACCTTGGAAGGGTCCCTCTAAGG - Intronic
1007258372 6:40544509-40544531 GCTTTGGAAGCAAACGTCTGTGG - Intronic
1008475769 6:51934210-51934232 GCCTTGGAAGGGCTTGTCTTCGG + Exonic
1013272413 6:108557414-108557436 CCCTTGGAAGGGGGAGTCTGGGG - Intergenic
1016623784 6:146142767-146142789 GCCCTGAAAGGGTAAGTCTCAGG - Intronic
1017646563 6:156544582-156544604 GCCTTGGAAGGGTTCTCGTGTGG - Intergenic
1021331074 7:19339789-19339811 GCCATGGAAGGGGAAGGCTGGGG - Intergenic
1022163454 7:27734625-27734647 CCCTGGAAAGGGCACGTCTGTGG + Intergenic
1029710218 7:102295246-102295268 GCCTGGGAAGGGTAGGTGTGGGG - Intronic
1032704802 7:134412580-134412602 GCCTTGGATTGGTACAGCTGAGG + Intergenic
1033413027 7:141137549-141137571 GACTGGGAAGGGTATGTGTGGGG + Intronic
1034465316 7:151224748-151224770 GCCTTGGAAGGGGAGGTGGGAGG - Intronic
1042501355 8:69512804-69512826 GCCCATGAAGGGTATGTCTGAGG - Intronic
1042675945 8:71322196-71322218 TACTTGGAAGGGTAAATCTGTGG + Exonic
1043882595 8:85562312-85562334 TCCTAGGAGGGGTATGTCTGAGG + Intergenic
1056571971 9:87824611-87824633 GCCTCGGATGGGTCCCTCTGTGG - Intergenic
1057699862 9:97355965-97355987 GCCTGGGAAGGGTTCGGGTGGGG + Intronic
1058414929 9:104777577-104777599 GCCTTGAAAGGGCAAGTCCGTGG + Intergenic
1058724934 9:107793573-107793595 CCTTTGGAAGGGAACTTCTGGGG - Intergenic
1061848616 9:133401936-133401958 GTCTTGGAAGGGTTGGTTTGGGG + Intronic
1192162703 X:68800500-68800522 GCCATGGAAGGGTATTTCAGAGG - Intergenic
1193241307 X:79173199-79173221 GCTTTAGAATGGTATGTCTGGGG - Intergenic
1193294237 X:79815678-79815700 GCCTTGGAAGGGTGTGTTTCAGG + Intergenic
1195675350 X:107503410-107503432 GCCTAGGAAGGGAAGGTGTGGGG + Intergenic
1195799486 X:108691152-108691174 GACTTGGAAGGGTAAGTGTGGGG + Intronic
1196538273 X:116873603-116873625 GCTTTAGAAGGGTACCTCTATGG + Intergenic