ID: 1152258750

View in Genome Browser
Species Human (GRCh38)
Location 17:79255250-79255272
Sequence TGTACTGGGGGTGTGGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152258744_1152258750 23 Left 1152258744 17:79255204-79255226 CCTGTGGTCACATGTGTGCGTGT 0: 1
1: 0
2: 1
3: 11
4: 170
Right 1152258750 17:79255250-79255272 TGTACTGGGGGTGTGGCATGAGG 0: 1
1: 0
2: 3
3: 22
4: 297
1152258743_1152258750 24 Left 1152258743 17:79255203-79255225 CCCTGTGGTCACATGTGTGCGTG 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1152258750 17:79255250-79255272 TGTACTGGGGGTGTGGCATGAGG 0: 1
1: 0
2: 3
3: 22
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152258750 Original CRISPR TGTACTGGGGGTGTGGCATG AGG Intronic
900436361 1:2633093-2633115 TCCACTGGGGGTGTGGCATGGGG + Intergenic
900795070 1:4702853-4702875 TGTCCTGGGGATGGGGCATTGGG + Intronic
903010190 1:20324369-20324391 TCTCCTGGGGGTGGGGCAGGGGG - Intronic
904094222 1:27965258-27965280 TGCACTGTGAGTGTGGCAGGGGG + Intronic
905013175 1:34760511-34760533 TGTACTGGTGCTGGGGCCTGAGG - Intronic
905196541 1:36282797-36282819 TGGACTGGGGGGTTGGCTTGAGG + Intronic
905912730 1:41664857-41664879 TGTTTTGGGGGGTTGGCATGGGG - Intronic
907086635 1:51681719-51681741 GGTACTGGGGGTGGGGAGTGGGG - Intronic
907391234 1:54159941-54159963 TGACCTGGGGGTGTGGCAGAGGG + Intronic
907923142 1:58931615-58931637 GGCACTGGGAGTGAGGCATGGGG - Intergenic
911189703 1:94935810-94935832 TCTACTGGAGCTGTGGCTTGAGG - Intergenic
912216385 1:107617973-107617995 GGTGCTGGGGGCGTGGCAGGTGG + Intronic
915713099 1:157920097-157920119 TGTGGTGGGGGAGTGGGATGGGG - Intergenic
917458174 1:175203721-175203743 TCTACTGTCAGTGTGGCATGAGG - Intergenic
918438442 1:184541425-184541447 TGTGCTGGGGTGGAGGCATGTGG - Intronic
918942037 1:191013096-191013118 TGTTGTGGGGGTGGGGGATGGGG - Intergenic
919944030 1:202307063-202307085 TGTGCTGGGGGTGGGGGCTGTGG - Intronic
920126406 1:203696903-203696925 TGTATAGTGTGTGTGGCATGTGG + Intronic
920773468 1:208912513-208912535 TATATTTGGGGTGTGGCTTGAGG + Intergenic
921825592 1:219668542-219668564 TATACTTGGGGTTTGGCAGGTGG + Intergenic
921867084 1:220097283-220097305 TGTGCTGGGGGTCTGGGGTGGGG - Intronic
922728121 1:227935210-227935232 TGAACTGGGGGTGTGATCTGGGG - Intronic
923914800 1:238490410-238490432 TTTTCTGTGTGTGTGGCATGAGG + Intergenic
924927290 1:248695629-248695651 TGTAGTGGTGGAGAGGCATGTGG + Intergenic
1064695169 10:17957704-17957726 TCTACTGGGGCTGTTGGATGAGG - Intronic
1065007624 10:21394268-21394290 GGTGCTGGGAGTGTGGGATGGGG - Intergenic
1068117553 10:52751398-52751420 TGTGCTGGGGGTGAGGGATCAGG - Intergenic
1069412521 10:68168225-68168247 TGTACTGGGGAGGGGGCAGGAGG - Intronic
1069702266 10:70435475-70435497 TGTCCTGGGAGTGGGGCAAGAGG - Exonic
1069744641 10:70707263-70707285 TGTATTAGGGGTGTGGCAGCAGG - Intronic
1070550520 10:77487529-77487551 TGCAATGGGGGTGTGGTAAGGGG - Intronic
1070688807 10:78509683-78509705 TGTGCTGGGGCTGGGGGATGAGG - Intergenic
1071558080 10:86621780-86621802 TGTTGTGGGGGTGGGGCATTGGG + Intergenic
1072171584 10:92868234-92868256 TTTTCCTGGGGTGTGGCATGAGG + Intronic
1072539088 10:96384808-96384830 TGTGCTGGGGGTCTGGGGTGGGG - Intronic
1072682110 10:97515042-97515064 TAGCCTGGGGGTGTGGCATAGGG + Intronic
1072797591 10:98367829-98367851 TGCTCTGGGAGTGTGGCAGGAGG + Intergenic
1073599684 10:104834560-104834582 TGGGCTGGGGGGGTGGCAGGTGG - Intronic
1074831453 10:117252537-117252559 TGCTCTGTGGGTGGGGCATGAGG - Intronic
1075080522 10:119380584-119380606 TGGACTGGGGGTGTGGGGTGGGG + Intronic
1075727495 10:124618069-124618091 TGCACTGGGGGTGAGGCCTGGGG + Exonic
1076214040 10:128678655-128678677 TGGACTGGGGGTGGGGTAGGTGG + Intergenic
1077407607 11:2389600-2389622 TGTGCTGGGAGTCTGGCAGGTGG - Intronic
1077892858 11:6431861-6431883 TGTATTGGGGGAGAGGCTTGAGG - Intronic
1079127942 11:17732088-17732110 TGGGCTGGGGGTGTGTCATCAGG + Intergenic
1082081876 11:48018709-48018731 CGAACTGGGGGTGCGGAATGTGG + Intronic
1083189548 11:61040089-61040111 TGTCCCAGGGGTGTGGCCTGAGG - Intergenic
1085385262 11:76153976-76153998 GGAACTGGCAGTGTGGCATGTGG + Intergenic
1086286855 11:85261372-85261394 TGTGGTGGGGGTGGGGGATGTGG - Intronic
1087119176 11:94554700-94554722 TGTACTGGGATGGGGGCATGGGG + Intronic
1088374191 11:109121788-109121810 TGCAGAGGGGATGTGGCATGAGG + Intergenic
1090203966 11:124874904-124874926 TGGACTGTGAGTGTGGTATGGGG + Exonic
1091214882 11:133894637-133894659 TGTCCTGGGACTGTGTCATGTGG + Intergenic
1091353244 11:134914400-134914422 GGTACTTGGGGTGCCGCATGAGG + Intergenic
1094522371 12:31206299-31206321 TGTGGTGGGGCTGTGTCATGAGG + Intergenic
1095143088 12:38690928-38690950 GACACTGGGAGTGTGGCATGTGG + Intronic
1096257548 12:50072564-50072586 AGTGCTGGGGGTGGGGCAGGGGG - Intronic
1099244017 12:80172930-80172952 TGTTGTGGGGGTGTGGGAGGAGG + Intergenic
1101828499 12:108239465-108239487 TGCCCTGGGGGTGGGGGATGGGG - Intronic
1102800176 12:115725479-115725501 TGTATTGGGAGGGTGGCATTTGG + Intergenic
1104304858 12:127600408-127600430 TCTAGTGGGGGTGTGGCAGGTGG + Intergenic
1104737066 12:131141788-131141810 ATATCTGGGGGTGTGGCATGTGG - Intergenic
1106375863 13:29187778-29187800 TGTACTGGGTGTGTGTTCTGAGG - Intronic
1107351748 13:39522012-39522034 TGTACTAGGGGTTTGGGGTGAGG - Intronic
1113491623 13:110696926-110696948 TGTACTTGGAGGGTGTCATGGGG - Intronic
1113914419 13:113862307-113862329 TGCACAGGGACTGTGGCATGGGG - Intronic
1117693847 14:58338907-58338929 TGTATTGGGGGTGGGGGGTGGGG - Intronic
1117790581 14:59336954-59336976 TTTACCGGGTGTGTGGCTTGGGG - Intronic
1119234543 14:73008545-73008567 TGAACTGGGTGTGTTGGATGTGG - Intronic
1121410741 14:93746655-93746677 TAAACTGGGTGTGTGGCGTGGGG + Intronic
1121662976 14:95649707-95649729 TGAGCTGGGGGCCTGGCATGAGG + Intergenic
1124602684 15:31148303-31148325 TGAGCTGGGGGTGTGCAATGAGG + Intronic
1125611791 15:40976389-40976411 TGTGCTGGGGGGGTGGTAGGAGG + Intergenic
1125717588 15:41827959-41827981 GGTGCTGGGGGTGTGGCCTGCGG + Intergenic
1125717606 15:41828008-41828030 GGGTCTGGGGGTGTGGCCTGCGG + Intergenic
1125717623 15:41828056-41828078 AGTGCTTGGGGTGTGGCCTGCGG + Intergenic
1126175636 15:45732908-45732930 TGGACTGAGGGTGTTGCCTGGGG + Intergenic
1128726400 15:69991496-69991518 TGGACTGGGGGCATGGCCTGGGG + Intergenic
1129399256 15:75270137-75270159 TGTACCGGGGGGTTGTCATGGGG - Exonic
1131436442 15:92426351-92426373 GGAACCGGGGGTGAGGCATGGGG + Intronic
1131759544 15:95605627-95605649 TTTACTGTTTGTGTGGCATGGGG - Intergenic
1132606643 16:796391-796413 GGTGGTGGGGGTGAGGCATGGGG + Intronic
1132655845 16:1041374-1041396 TGAGCTGGGGGTCTGGCAGGAGG - Intergenic
1132698580 16:1212642-1212664 GGTGCTGGGCGTGTGGCGTGAGG + Intronic
1132902112 16:2262630-2262652 AGGACTGGGGTGGTGGCATGTGG - Intronic
1133180924 16:4053972-4053994 TGGAGTGGGGGTGAGGGATGTGG - Intronic
1133356119 16:5138204-5138226 TGACCTGGGGCTGGGGCATGTGG + Intergenic
1133898316 16:9949920-9949942 TGAACAGGGGGTGTGAAATGAGG + Intronic
1136986107 16:35106642-35106664 TCTAATGGGGGTGTGCCCTGTGG + Intergenic
1137411208 16:48229825-48229847 TGTGATGTGGGTGTGGCATGAGG - Intronic
1138195020 16:55045483-55045505 TTCACCGGGGCTGTGGCATGGGG + Intergenic
1138726012 16:59139987-59140009 TGTGATGGAGGTGAGGCATGAGG - Intergenic
1138919388 16:61508741-61508763 TGCACTGGGGGTCTTGCATGTGG - Intergenic
1140449763 16:75061288-75061310 GGTACTGGGGGTGTGGGGGGAGG - Intronic
1140625812 16:76793172-76793194 TGTTATGGGGGCGTGGGATGGGG + Intergenic
1141974013 16:87502297-87502319 TGTGTTGTGTGTGTGGCATGTGG + Intergenic
1142346394 16:89556808-89556830 TGTCCTGGGGAGGTGGCAAGAGG - Intronic
1142737427 17:1910029-1910051 TGTCCTGGGAGTTTTGCATGAGG + Intergenic
1144040232 17:11403966-11403988 TGTGCTTGGGGTGTGGCCTCAGG - Intronic
1144253201 17:13440150-13440172 TATAGTGGGGGTGGGGGATGGGG + Intergenic
1144415497 17:15042423-15042445 TGGACTGTGGGTGTGGGAGGGGG + Intergenic
1144630533 17:16869923-16869945 TGTGCTGGGGATATGGCCTGGGG - Intergenic
1144650788 17:17005532-17005554 TGTGCTGGGGATATGGCCTGGGG + Intergenic
1144686598 17:17230028-17230050 TAAAATGGGGGTGTGTCATGGGG + Intronic
1145898531 17:28474842-28474864 AGTTCTGGGGGTGTGGGGTGGGG - Intronic
1146055816 17:29580513-29580535 TGTGCTGGGTGAGTGGCAGGGGG + Intronic
1146657221 17:34641745-34641767 TGGACAGGGGGTGAGGGATGAGG - Intergenic
1147128326 17:38389040-38389062 TGTTTTGGGAGTCTGGCATGGGG - Intronic
1147133759 17:38423729-38423751 TGTGGTGGGGGTGTTGCCTGTGG + Intergenic
1148852004 17:50560115-50560137 TGTCCTGGGGGTGGGGCTTCAGG - Intergenic
1150100065 17:62415526-62415548 TATCCTGGAGGTGTGGCAGGAGG - Intronic
1150140484 17:62724499-62724521 TGTGCTGGGGGTCTCTCATGAGG + Intronic
1150228102 17:63534648-63534670 TGCACTGGGGGAGTGGCCTGGGG - Intronic
1151009140 17:70473145-70473167 TGCACTGGCGGTGTGGCAACAGG - Intergenic
1151184775 17:72355740-72355762 TGTACTGGGGGTAGGGCCTTTGG - Intergenic
1152169530 17:78735192-78735214 AGTGATGGGGGTGGGGCATGAGG - Intronic
1152201100 17:78946765-78946787 TGCCCTGGGCGTGGGGCATGCGG + Intergenic
1152258750 17:79255250-79255272 TGTACTGGGGGTGTGGCATGAGG + Intronic
1152263276 17:79278569-79278591 TGTGCTGTGGGCGTGGCCTGTGG + Intronic
1152303581 17:79508928-79508950 TGGACTGGGGGTGTGGTCTGAGG - Intronic
1152695716 17:81793307-81793329 TGTGCTGTGTGTGTGGCGTGTGG - Intergenic
1152699239 17:81810991-81811013 TGCACTGGGGGTGTGGGGGGAGG - Exonic
1152863458 17:82709220-82709242 TGTACAGGGGGTGGGGCATGAGG - Intergenic
1152863475 17:82709264-82709286 GGTACAGGGGGTGGGGCATGGGG - Intergenic
1154010163 18:10567514-10567536 TGGCCTGGGGGTCAGGCATGAGG + Intergenic
1155907721 18:31472325-31472347 TCTACTGGGGGAGTGACAGGTGG + Exonic
1160400437 18:78606988-78607010 TGTAGTGTGTGTGTGGTATGTGG - Intergenic
1160443715 18:78911946-78911968 TGGCCTGGGGCTGTGGCCTGAGG - Intergenic
1160898411 19:1413966-1413988 TTCACTGGGGGTGGGGCAAGAGG - Intronic
1160975633 19:1790935-1790957 TGGCCAGGGGGTGGGGCATGTGG - Intronic
1161249680 19:3273815-3273837 AGCAGTGGGGGTGTGGCAGGCGG - Intronic
1162021571 19:7870557-7870579 TGCACTGGGGGTGAGGGAGGGGG + Exonic
1162086879 19:8254651-8254673 TGCCCTGGGGGTGGGGCGTGGGG + Intronic
1163118417 19:15201219-15201241 TGTACTGGGGGATGGGGATGGGG - Intergenic
1164555280 19:29246380-29246402 TGTTCTGTAGGTGTGGGATGGGG + Intergenic
1165279318 19:34783090-34783112 TGTACTCTGGGCCTGGCATGTGG + Intergenic
1165343532 19:35228683-35228705 TGGACTGGGGCTGTGGCAGTGGG + Exonic
1166110942 19:40622604-40622626 TGTACTGTGGGTGAGGGCTGGGG + Exonic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166783566 19:45354549-45354571 TGTACTGGGGGCGGGGCATGGGG + Intronic
1167713418 19:51125772-51125794 GGTCCTGGGGCTGTGGGATGAGG - Exonic
1167716290 19:51144581-51144603 GGTGCTGGGGCTGTGGGATGAGG - Exonic
1167768440 19:51499519-51499541 GGTCCTGGGGCTGTGGGATGAGG + Exonic
1168060395 19:53888922-53888944 TGTGCAGGGGGAGTGGCAGGGGG - Intronic
925339443 2:3126021-3126043 CGTGCTGAGCGTGTGGCATGAGG - Intergenic
925556197 2:5133730-5133752 TGTAATGTGGGTGGTGCATGTGG - Intergenic
926004860 2:9365821-9365843 TGTGCTGGGCATGAGGCATGAGG - Intronic
926200493 2:10792853-10792875 TGGACTGCAGGTGTGGCAAGAGG + Intronic
926698327 2:15785827-15785849 TGTACTCTGAGGGTGGCATGTGG - Intergenic
926749291 2:16185814-16185836 TGGGCTGGGGCTGTGGGATGAGG + Intergenic
928634304 2:33227543-33227565 TTCACTAAGGGTGTGGCATGGGG - Intronic
932820326 2:74894367-74894389 AGTACTGGGACTGTGGAATGGGG + Intergenic
935533260 2:104261456-104261478 AGTACCTGTGGTGTGGCATGGGG - Intergenic
935708013 2:105873052-105873074 GGAACTGGGGGTGTGGGATATGG - Intronic
936947382 2:117942719-117942741 AGGACTGGGGCTGTGGAATGTGG - Intronic
938771341 2:134503772-134503794 ACAGCTGGGGGTGTGGCATGGGG + Intronic
939104920 2:137937869-137937891 TGAACTGGCAGGGTGGCATGGGG - Intergenic
939882894 2:147650203-147650225 TAAACTGGGTGTGTGTCATGTGG - Intergenic
940416812 2:153432610-153432632 AGCACTGGGGGTGGGGGATGGGG - Intergenic
940525718 2:154811165-154811187 TGCAGTAGGGGTGTGGCTTGGGG + Intronic
942298240 2:174537704-174537726 TGTGCTGGGGGGGTGGGGTGGGG + Intergenic
942450378 2:176105214-176105236 TGTGCTGGGGGTCTGGGTTGAGG + Intronic
943240919 2:185382848-185382870 TGTACTGTGTGTGTGGGAAGGGG - Intergenic
945119210 2:206441638-206441660 TGCACTTGGGGTATGGAATGAGG - Intergenic
946075327 2:217069235-217069257 TGTGGTGTGTGTGTGGCATGTGG + Intergenic
946075375 2:217069596-217069618 TGTAGTGTGTGTGTGGCGTGTGG + Intergenic
946477234 2:220018859-220018881 TGCACTGGAGGTTTGGCTTGTGG + Intergenic
946884644 2:224210786-224210808 TGCACTGGGGATGTGCCCTGGGG + Intergenic
947379222 2:229528904-229528926 TGTCCCGGGGCTGTGGCAGGTGG + Intronic
947542134 2:230986612-230986634 TGGACTGGGGGTGGGGGTTGGGG + Intergenic
948563759 2:238870756-238870778 TGTACTGTGTGTGTGGGGTGTGG - Intronic
948563880 2:238871342-238871364 TGTACTGTGTGTGTGGGGTGTGG - Intronic
948807207 2:240458206-240458228 TGGAATGGGTGTGTGGCATCAGG - Intronic
1168786716 20:545555-545577 GGTACTGGGGATGTGTTATGAGG + Intergenic
1170990664 20:21299123-21299145 GGTAATGGGGGTGTGTCCTGAGG + Intergenic
1171101690 20:22389741-22389763 TTCACAGGGGGTGGGGCATGTGG - Intergenic
1172323462 20:34016123-34016145 GGTACTCGGTGTGTGGCATCTGG - Intronic
1173911418 20:46673757-46673779 GGCACTGGGAGTGTGGCAGGGGG - Intronic
1173934293 20:46847744-46847766 GGTGCTGGGGGAGTGGCGTGTGG - Intergenic
1174136852 20:48385726-48385748 TGTGGTGTGTGTGTGGCATGTGG + Intergenic
1174307800 20:49626871-49626893 CGTGCTGGGAGGGTGGCATGGGG - Intergenic
1175297787 20:57921105-57921127 TGCACTTGGGGTGGGGCATGTGG + Intergenic
1175309095 20:57999085-57999107 GGTCCTGGTGGTGTGGCACGTGG + Intergenic
1175764767 20:61584697-61584719 CTTAGTGGGGGTGGGGCATGTGG + Intronic
1176242785 20:64082827-64082849 GGGTGTGGGGGTGTGGCATGGGG + Intronic
1176250095 20:64116520-64116542 TCTGCAGGGGCTGTGGCATGAGG + Intergenic
1177048699 21:16203953-16203975 GGTATTGGGGGTGTAGCATGTGG + Intergenic
1179304153 21:40139659-40139681 TGTACGTGTGGTGTGGTATGTGG + Intronic
1179358807 21:40686342-40686364 TGTGGTGTGTGTGTGGCATGTGG - Intronic
1179467292 21:41584799-41584821 TGTGGTGTGTGTGTGGCATGGGG - Intergenic
1179595402 21:42439673-42439695 TGTAGTGTGTGTGTGGCGTGTGG - Intronic
1179938990 21:44626340-44626362 TGACCTGGGGGTGTGTGATGGGG + Intronic
1180624986 22:17188435-17188457 TGTCCTGCAGGTGGGGCATGAGG - Exonic
1181763853 22:25077216-25077238 TCTACTGGGTGTGTGGCTTTTGG + Intronic
1182052926 22:27326971-27326993 TGTACTGAGAGTCTCGCATGGGG + Intergenic
1183174499 22:36212926-36212948 TGTCATGGGAGTGGGGCATGGGG - Intergenic
1185056684 22:48582942-48582964 TGTGGTGTGTGTGTGGCATGTGG - Intronic
1185351102 22:50339383-50339405 TGTAGTGTGTGTGTGGTATGTGG + Intergenic
950162502 3:10771034-10771056 GGTTCTGGGGGTGGGTCATGGGG + Intergenic
951204271 3:19909544-19909566 TGGACTGGGGGTGGGGTAGGTGG + Intronic
953339599 3:42122415-42122437 TGTTGTGTGGGTGTGTCATGCGG + Intronic
953688680 3:45098595-45098617 TGTTGTGGGGGTGTGGGGTGTGG - Intronic
955021878 3:55129844-55129866 TGTGCTGGGGGCTTGGCATCTGG + Intergenic
955669008 3:61382568-61382590 TTTACTGGGTGTGTGACATTGGG - Intergenic
955784936 3:62527444-62527466 TGTGCTGGGGGTGGGGGGTGGGG + Intronic
956952636 3:74299746-74299768 AGTGCTGGGGGTGTGGCTGGTGG - Intronic
957047230 3:75385431-75385453 TGGACTAGGGGTGTTTCATGTGG + Intergenic
957060776 3:75479643-75479665 TGATCTGGGGCTGGGGCATGTGG + Intergenic
957331159 3:78766375-78766397 TGTACTGGGGGTTGGGGTTGGGG - Intronic
961292602 3:125859758-125859780 TGATCTGGGGCTGGGGCATGTGG - Intergenic
961380708 3:126494900-126494922 TGTACAGGGGGTGTGTTGTGAGG - Intronic
961798675 3:129427984-129428006 TGTGCTGAGGGTATGGGATGGGG - Intronic
961879299 3:130049530-130049552 TGGACTAGGGGTGTTTCATGTGG + Intergenic
964413257 3:156421663-156421685 AGTACTGAGGGTGTGACCTGGGG + Intronic
965140100 3:164821862-164821884 TGTGCTGTGTGTGTGGTATGTGG + Intergenic
965274197 3:166659607-166659629 TGTACTGGGGGTCTGGGTGGGGG + Intergenic
968143506 3:196278211-196278233 TGTAATGGTGGTGTGGCTTTAGG - Intronic
968626560 4:1628716-1628738 TGGCATGGGGGAGTGGCATGGGG + Intronic
968626582 4:1628762-1628784 TGGCATGGGGGAGTGGCATGGGG + Intronic
968627599 4:1634182-1634204 TGACCTCGGGGTGTGGCAGGAGG + Intronic
968991526 4:3916551-3916573 TGGACTAGGGGTGTTTCATGTGG + Intergenic
969004677 4:4009707-4009729 TGATCTGGGGCTGGGGCATGTGG + Intergenic
969809219 4:9635000-9635022 TGATCTGGGGCTGGGGCATGTGG - Intergenic
969823822 4:9740970-9740992 TGGACTAGGGGTGTTTCATGTGG - Intergenic
970441400 4:16083565-16083587 TGTACTGGGGGTGTACAGTGAGG - Intronic
970999087 4:22302255-22302277 CTTCCTGGGTGTGTGGCATGAGG + Intergenic
971447970 4:26772618-26772640 TCTGTTGGGGGTGTGGGATGAGG - Intergenic
972667787 4:41183818-41183840 TGGACTGGGGGAGTTGCAGGGGG + Intronic
972863088 4:43195897-43195919 TGTGCTGGTGGTGTGGAATAAGG + Intergenic
974941316 4:68471943-68471965 TGTTCTGAGGGTGTGGTATATGG + Intronic
978756033 4:112303895-112303917 TGTAGTGGGGTTGGGGAATGGGG - Intronic
979598163 4:122557084-122557106 TGTAGTGGAGGTGGGGCACGGGG + Intergenic
980493935 4:133567175-133567197 TGAACTGGGTGTGTGGTATATGG + Intergenic
982959428 4:161818174-161818196 TCTACTGGTGGGGTGGCCTGCGG - Intronic
984646450 4:182225512-182225534 GAAACTGGGGTTGTGGCATGTGG + Intronic
985292913 4:188404886-188404908 GGTACTGGGGTAGGGGCATGAGG - Intergenic
986281043 5:6322860-6322882 GGTTCTGGGGGTTTGGCGTGGGG - Intergenic
988417104 5:30959342-30959364 AGTACTGGGGGTGGGGCCTGGGG + Intergenic
988528009 5:32003260-32003282 TGTGGTGTGTGTGTGGCATGTGG - Intronic
988710933 5:33773991-33774013 ACTACTGGGGGTGTGGCCTTTGG + Intronic
988845115 5:35119834-35119856 TGTGCTGGGGGTGGGACATCTGG + Intronic
989023498 5:37038938-37038960 TCTACTGAGGGTTTGGCTTGAGG - Intronic
989308700 5:39987731-39987753 AGTACTGGGGGGGTTGCATTGGG - Intergenic
989651073 5:43690796-43690818 TGAACTGGGGGTTATGCATGAGG + Intronic
992383122 5:76258068-76258090 AGTATGGGGGGTGTGGTATGTGG + Intronic
995004648 5:107177242-107177264 TGTTCTGGTGTTGTGGGATGGGG - Intergenic
996165268 5:120214984-120215006 GGTATTGGGGGTGGGTCATGAGG + Intergenic
997505598 5:134414121-134414143 TGTATTGTGAGTGTGGCCTGTGG + Intergenic
1000161046 5:158598143-158598165 TGTAGAGTGGGTGTGGCCTGGGG - Intergenic
1001300721 5:170531786-170531808 AGGACAGGGGGTGGGGCATGAGG - Intronic
1002297963 5:178241765-178241787 TGTCCTGGGGGTGAAGAATGAGG + Intronic
1002424986 5:179169586-179169608 TGTCCCTGGGGTGAGGCATGGGG + Intronic
1002671537 5:180871570-180871592 TGTACTGAAGGTGTGGACTGGGG + Intergenic
1003128146 6:3372563-3372585 TGTACTGGTGGCGTGGCCTGAGG + Intronic
1003662003 6:8071064-8071086 TGAACTGGGGGTGGGAGATGGGG + Intronic
1004216681 6:13710913-13710935 GGTACTGGGCGTGTGTCCTGCGG - Exonic
1004346036 6:14850177-14850199 CGTACTGGGGGAGTGGTATTTGG - Intergenic
1004897320 6:20161427-20161449 TGGAGTGGGGGTGGGGGATGGGG - Intronic
1005896242 6:30181729-30181751 TGTACTGGGGGGATGGGATCAGG + Intergenic
1006091033 6:31629197-31629219 GGAACTGGGGGTGTGGTAGGAGG - Exonic
1006933537 6:37701813-37701835 TCTGCTGGGGGTGTGGGATGAGG - Intergenic
1007110234 6:39309450-39309472 TGTACTGTGTGTGTGGGGTGGGG + Intronic
1008240296 6:49101878-49101900 TGTCATGGGGTTGGGGCATGGGG + Intergenic
1008361909 6:50630155-50630177 TGTCATGGGGTTGGGGCATGGGG - Intergenic
1010405224 6:75497069-75497091 GGTAGTGGGTGGGTGGCATGAGG + Intergenic
1011368887 6:86610934-86610956 TGTAATGGGGCTGGGGGATGGGG + Intergenic
1012855764 6:104499384-104499406 TGTGCTGGGGGTGTGGGGGGAGG - Intergenic
1013273924 6:108566075-108566097 TGTACTGGGGCTGTAGAAAGAGG - Intronic
1014017185 6:116546584-116546606 TTTACTGGCTGTGTGGCATTGGG + Intronic
1015245738 6:131072596-131072618 TGTACTGGGGGTGAGAGGTGAGG + Intergenic
1015787693 6:136934582-136934604 GGTACTGGGAGTGTGGAATCTGG - Intergenic
1016827779 6:148404585-148404607 TGGGCTGGGGGTGGGGCAGGTGG - Intronic
1017410560 6:154163222-154163244 TGTAGTGGGGATGGAGCATGGGG - Intronic
1019536672 7:1533108-1533130 TGGTCGGGGGGTGGGGCATGTGG - Intronic
1021998053 7:26200338-26200360 TTCACTGGGGGTGGGGGATGGGG - Intronic
1022086778 7:27076197-27076219 AATAGTGGGGGTGAGGCATGAGG + Intergenic
1023131329 7:37006076-37006098 TGTACTGCAGGTGAGGCAGGGGG - Intronic
1023995657 7:45157706-45157728 TGGTCTGGGGGTGCGGCCTGAGG + Intergenic
1024236454 7:47402573-47402595 TGTAGTGAGTGTGGGGCATGGGG - Intronic
1026551629 7:71373757-71373779 TGAACCGGGGGTGTGGCGTGGGG - Intronic
1026847024 7:73704124-73704146 TGAGCTGGGGGTGGGGCCTGGGG - Intronic
1029115250 7:98233356-98233378 TGCCCTGGGGGTGTGGGGTGTGG - Intronic
1029676985 7:102076621-102076643 TGCCCTGGGGGTGTGGTGTGGGG - Intronic
1030781368 7:113604269-113604291 TGTAATGGGGCAGAGGCATGAGG + Intergenic
1031895231 7:127340507-127340529 TGCAGTGGGGGTGTGGGATAGGG - Intergenic
1032971962 7:137174857-137174879 TGGACTGGGGGTGGGGGGTGGGG + Intergenic
1035028909 7:155844755-155844777 TGTGCTCGGGCTGGGGCATGGGG - Intergenic
1036703191 8:11027686-11027708 TCTACTGGCAGTGTGGCCTGGGG + Intronic
1036801760 8:11797755-11797777 TGTAATGGAGGCGTGGCAGGTGG + Intronic
1038481127 8:27902396-27902418 TGTACTGGGGTTGGGCCCTGAGG - Intronic
1038714714 8:29981268-29981290 TGTTCCCGGGGTGCGGCATGGGG - Intergenic
1043921304 8:85986857-85986879 GATACTGGTGGTGGGGCATGGGG + Intergenic
1044362517 8:91304799-91304821 TGTACTGGGCATGTGTCATGTGG + Intronic
1047861746 8:128974710-128974732 TGTACTGGGGGTGTAGATTGTGG - Intergenic
1048819629 8:138369045-138369067 TGTGCTGGTGGTGTGGCCTTTGG + Intronic
1049562077 8:143316959-143316981 AGCACTGGGGCTGTGGGATGCGG - Intronic
1052090034 9:24316615-24316637 TGGACTGAAGGTGTGGAATGAGG + Intergenic
1053226369 9:36361868-36361890 TGTTTAGGGGGTGTGGCAGGAGG - Intronic
1055611466 9:78030451-78030473 TGTACTGGGGGCGAGGCGGGAGG - Intronic
1056772027 9:89484526-89484548 TGGACTGGGTGTGTGGGGTGGGG + Intronic
1056816963 9:89808902-89808924 TGTACTGGGTATGGGGTATGGGG - Intergenic
1056826764 9:89881282-89881304 TGTGCTGTGTGTGTGGTATGGGG - Intergenic
1056826823 9:89881821-89881843 TGTGCTGTGCGTGTGGTATGGGG - Intergenic
1057041719 9:91853109-91853131 GGGACTGGGGCTGAGGCATGAGG + Intronic
1057124257 9:92603727-92603749 TGCTCTGGGGGTGTGGCATCAGG - Intronic
1059043855 9:110843139-110843161 TGTATTGGGGGTGAGGGTTGGGG + Intergenic
1060812523 9:126617900-126617922 TGTGCTGGGGGTGGGGGGTGGGG + Intronic
1062139217 9:134946097-134946119 GGTGCTGGGGGTGTGGGGTGGGG + Intergenic
1062180589 9:135189194-135189216 CATAATGGGGGTGTGGCATGGGG - Intergenic
1187425892 X:19176849-19176871 TGTGCTGGGGGTGGGGCGGGGGG - Intergenic
1187832578 X:23397821-23397843 TGTCTTGGGGGTGTGGCAAGAGG + Exonic
1190415035 X:50172560-50172582 TGTGCTTGGGCTGTGGGATGTGG + Intergenic
1190479451 X:50861368-50861390 TGTGTGTGGGGTGTGGCATGTGG - Intergenic
1190692058 X:52920358-52920380 GGTACAGGGGGTGTGTCACGTGG + Intergenic
1191978678 X:66901946-66901968 TGTATTGGGAATGTGGCTTGTGG + Intergenic
1192166158 X:68828895-68828917 TGCTCTGGGGGCGTGGTATGGGG + Intergenic
1192173770 X:68873411-68873433 TGTCCTGGGGCTCTGGCATCTGG - Intergenic
1192366082 X:70474492-70474514 AGTAATGGGGGTTTGGCATGAGG + Intronic
1194248109 X:91539121-91539143 TGTGCTGGGGGTGGGAAATGAGG - Intergenic
1196411195 X:115420933-115420955 TGAATGGGGGGTGTGGCATGGGG + Intergenic
1200143255 X:153912663-153912685 TGTACAGGTGGGCTGGCATGTGG + Intronic
1200567123 Y:4780650-4780672 TGTGCTGGGGGTGGGAAATGAGG - Intergenic