ID: 1152258984

View in Genome Browser
Species Human (GRCh38)
Location 17:79256391-79256413
Sequence GCTGAAGCCCAGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 1, 2: 9, 3: 82, 4: 563}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152258973_1152258984 22 Left 1152258973 17:79256346-79256368 CCCTACACATAGCAAGTTTGCTT 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG 0: 1
1: 1
2: 9
3: 82
4: 563
1152258980_1152258984 -8 Left 1152258980 17:79256376-79256398 CCACCGGCTCCGGGAGCTGAAGC 0: 1
1: 0
2: 2
3: 20
4: 225
Right 1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG 0: 1
1: 1
2: 9
3: 82
4: 563
1152258974_1152258984 21 Left 1152258974 17:79256347-79256369 CCTACACATAGCAAGTTTGCTTG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG 0: 1
1: 1
2: 9
3: 82
4: 563
1152258979_1152258984 -4 Left 1152258979 17:79256372-79256394 CCGGCCACCGGCTCCGGGAGCTG 0: 1
1: 0
2: 5
3: 28
4: 546
Right 1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG 0: 1
1: 1
2: 9
3: 82
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152258984 Original CRISPR GCTGAAGCCCAGAGTGAGGA TGG Intronic
900092491 1:926476-926498 GCTGAAGGCCAGAGGGTGCAAGG + Intronic
900292527 1:1929582-1929604 GCCGAAGGCCTAAGTGAGGAAGG - Intronic
900332769 1:2144457-2144479 GCTGCAGCCCAGAGCTAGGACGG - Intronic
900506906 1:3033948-3033970 GCTGCAGCACAGATGGAGGATGG + Intergenic
900571576 1:3361247-3361269 GCTGAAGCCCATGCTGAGGAGGG - Intronic
900792802 1:4691023-4691045 GCTGAGGCCTGGGGTGAGGAGGG + Intronic
901655796 1:10768548-10768570 GCTGGAGTCCAGGGAGAGGAGGG - Intronic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
901874826 1:12161522-12161544 GCTGAAGCCCAGAGAGGGGTAGG + Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902778173 1:18687821-18687843 ACCGAAGCCCAGACTGGGGAAGG - Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
902983283 1:20140320-20140342 GCAGAAGCCCAGAGACAGGAAGG - Intronic
903189367 1:21648193-21648215 ACTGAAGCCCAGAGAGGGGATGG + Intronic
903368794 1:22821483-22821505 CCTGAAGCCCAAAGAGAGGAAGG + Intronic
903538602 1:24083685-24083707 GCTTAAACCCAGAGAGAGGTGGG - Intronic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903653222 1:24933457-24933479 TGTGAGGCCCAGAGAGAGGAGGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903930345 1:26858359-26858381 ATTGAAGCCCAGAGGCAGGAAGG + Intergenic
903972737 1:27129640-27129662 GATGAAGCCCAGAGAGGGGACGG + Intronic
904031911 1:27538481-27538503 CCTGAAGCCCAGAGAGGGAAGGG - Intronic
904050710 1:27636537-27636559 ACTGAACCCCAGATTGAGGAGGG - Intergenic
904198101 1:28801143-28801165 GCTGAAATTCAGAGTGATGAAGG - Intergenic
904199883 1:28812640-28812662 GCTGGAGCCCGGGGTGAGGGTGG + Intronic
904268309 1:29330857-29330879 GCTGAAGCTCAGAGAAATGAGGG + Intergenic
904373097 1:30063079-30063101 GCTCAGGCCCAGACTGATGATGG - Intergenic
904461704 1:30684608-30684630 ACTGAGGCCCAGATTGAGGCAGG - Intergenic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
905525471 1:38635177-38635199 GCTGAAGCGGGGAGTGAGGGGGG - Intergenic
905726461 1:40256161-40256183 GCTGAAGTCAAGAGTGAAGAGGG + Intergenic
906039489 1:42777031-42777053 TCTGAAGGCCTGAGTGGGGAAGG + Intronic
906478106 1:46183500-46183522 TCTGAGGCCTAGATTGAGGAGGG - Intronic
906659189 1:47570589-47570611 GCTGGAGCACAAAGTGAGGTAGG - Intergenic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
907115749 1:51966981-51967003 GCTGAGGCTCAGAGTGAGATAGG - Intronic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907711283 1:56884323-56884345 GCTGAAGCACAGGGTGGGAAAGG + Intronic
910347779 1:86260048-86260070 GCTGAAGCTCAGAGAGATTAAGG - Intergenic
911725890 1:101240238-101240260 GCTGCAAGCCAGAGGGAGGAAGG + Exonic
912274272 1:108240167-108240189 GCTGAAGTTCAGAGAGAGGCTGG - Intronic
912286995 1:108379695-108379717 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912293947 1:108454156-108454178 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912530125 1:110314542-110314564 CCTGGAGCCCAGACGGAGGATGG + Intergenic
912674463 1:111664578-111664600 CTTGAAGCCCAGGGAGAGGAAGG - Intronic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
912711896 1:111956066-111956088 ACTGAAGCTTAAAGTGAGGAAGG + Intronic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
913437846 1:118865686-118865708 GCTGCAGCCAAGGGTGAGCACGG - Intergenic
914347985 1:146816074-146816096 GCTGAAGGGGAGAGAGAGGAAGG - Intergenic
914451619 1:147797926-147797948 GCTGAAATCCAAAGTCAGGAAGG + Intergenic
914807025 1:150999150-150999172 GCTGGGTCCCAGAGTGAAGATGG + Intronic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
915367723 1:155324898-155324920 GCAGAAGCCCAGAGTGGGACTGG + Exonic
915916403 1:159943410-159943432 GCTGATGACCAGGCTGAGGACGG + Exonic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
916063598 1:161118776-161118798 GATGAAGCCCAGCCTGAGGAAGG - Exonic
916315431 1:163443187-163443209 CCTGAAGCCCGGTGTGAGGCTGG + Intergenic
916676495 1:167068297-167068319 GATGAAGCCCAGAGAAAGGAAGG - Intronic
916709164 1:167387037-167387059 GCTGAATGCAAGAGTGAGGTTGG + Intronic
917225891 1:172781942-172781964 GCTCCAGGCCAGAGTAAGGATGG + Intergenic
917265426 1:173216185-173216207 GCTGATGCCTAGGGTGGGGATGG - Intergenic
917478043 1:175385759-175385781 CCTGAGGCCCATAGTGGGGAAGG + Intronic
919762253 1:201105657-201105679 ACTGAGGCCCAGAGAGAGCAAGG - Intronic
920801646 1:209194051-209194073 GCTGAGGCCCAGAGAGGGCATGG - Intergenic
922741004 1:228014205-228014227 CCTGAAGCTCTGAGAGAGGAGGG - Intronic
923019231 1:230150050-230150072 GATGGACCCCAGGGTGAGGATGG + Intronic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
924407595 1:243767123-243767145 GCTCAAGAACAGAGTAAGGATGG + Intronic
924775775 1:247113803-247113825 ACTGGAGCCCTGAGTGAGGAAGG - Intergenic
1063961021 10:11305409-11305431 GCAGAGGCCCAGAGTGTTGAAGG - Intronic
1063970599 10:11379000-11379022 GCTGAGGCCCAGAGAGGGCAAGG - Intergenic
1064506409 10:16035046-16035068 GCTCAAGAGCAGAGTGAAGAGGG + Intergenic
1065293393 10:24253103-24253125 GCTGAGACCCAGAGGAAGGAAGG + Intronic
1068361724 10:55982457-55982479 GCTGAAAACCAGAATGAGAAAGG + Intergenic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1070811627 10:79301014-79301036 GCTGAGGACCAGAGTGGGGCAGG - Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1072276125 10:93825232-93825254 GATGAAGTCCAGAGAGAGAAAGG - Intergenic
1072619416 10:97069680-97069702 GCAGAAACCCAGAGACAGGAAGG + Intronic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1074162766 10:110847498-110847520 GCTGCAGCCCAGGGCCAGGATGG - Intergenic
1074249172 10:111726712-111726734 ACTGAGGCTCAGAGTGAAGAAGG - Intergenic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1074383160 10:112996505-112996527 GCTGAAGGCCAAGGTGAGGGGGG - Intronic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1074896048 10:117778479-117778501 GATGTGGCCCAAAGTGAGGAGGG + Intergenic
1075216290 10:120539143-120539165 GCAGAAGCCCTCAGAGAGGAAGG - Intronic
1075287410 10:121198927-121198949 GCTTATGGCCAGGGTGAGGAAGG + Intergenic
1076531399 10:131147615-131147637 GCCGAGGCCCAGAGAGGGGAGGG - Intronic
1076920831 10:133453972-133453994 GCTGAAGCCCAGAGGGCTGTGGG + Intergenic
1077333329 11:1992928-1992950 GCTGAACCTCAGGGTGAGGCGGG - Intergenic
1078520313 11:12057673-12057695 ACTCAAGGCCAGGGTGAGGATGG - Intergenic
1078867288 11:15309783-15309805 GCTTAGGTCCAGAGTCAGGATGG + Intergenic
1078886188 11:15502411-15502433 GCTGAAGTCCAGAGAGGAGAAGG - Intergenic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1080798738 11:35589708-35589730 GCTGAAGCCAAGAGAGAGCTAGG - Intergenic
1081600230 11:44487805-44487827 GGGGAAGCCCCGAGTGTGGATGG - Intergenic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1081706712 11:45186440-45186462 GCTGAAGCCCGGAGAAGGGAGGG + Intronic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1082580689 11:54864298-54864320 ACTGAAGCCTAGAGTGAAAAAGG - Intergenic
1083159834 11:60848180-60848202 TCTGAAGGCCGGAGGGAGGAAGG + Intronic
1083718765 11:64593677-64593699 GCTGAAGCCCAGAGAGTTCAAGG - Exonic
1083962664 11:66022967-66022989 CCGGAAGCCCTGAATGAGGAAGG + Exonic
1084083988 11:66846351-66846373 GCAGCAGTCCAAAGTGAGGAAGG - Exonic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1084164935 11:67371179-67371201 GCAGCAGCCCAGAGGGTGGAAGG - Intronic
1084264810 11:67999406-67999428 ACTGAGGCCCAGAGGGCGGAAGG + Intronic
1084411792 11:69009961-69009983 GCAGAAGCCCAGAGAGAGGGTGG + Intronic
1084974774 11:72790721-72790743 CCTGAGGCCAAGAGTGAAGATGG - Intronic
1085259814 11:75198034-75198056 GCTGATGCCCAGCATGAGGGTGG - Intronic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085309434 11:75507403-75507425 ACTGAGGCCCAGAGGGAGAAAGG + Intronic
1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG + Intergenic
1085709583 11:78816942-78816964 GGTGAGGCCCAGAGAGGGGAAGG - Intronic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1088383367 11:109221356-109221378 GCTGAGGCCCAGGGAGATGAGGG + Intergenic
1089060625 11:115623264-115623286 CCAGAAGCCCAGTGTGAGCAAGG + Intergenic
1089360878 11:117885655-117885677 GCTGAGGCACAGAGGTAGGAAGG + Intergenic
1089634768 11:119805049-119805071 GCTTAAGCCCAGAGAGGGGAAGG + Intergenic
1089634915 11:119805852-119805874 GCTGAAGATCAGAGTGAGCCAGG - Intergenic
1089651967 11:119920426-119920448 GCTGAAGCACAAAGGGAGGCAGG - Intergenic
1090730252 11:129567233-129567255 GCTTAAGCCCAGAGGGTCGAGGG + Intergenic
1091227321 11:133965306-133965328 TCTGAAGCCCAGCGAGGGGAGGG - Intergenic
1202816309 11_KI270721v1_random:48109-48131 GCTGAACCTCAGGGTGAGGCGGG - Intergenic
1091544311 12:1490896-1490918 GCCGAGGAACAGAGTGAGGAAGG - Exonic
1091770838 12:3150289-3150311 GCTGATGCCCAGAGAGATTAGGG + Intronic
1091980502 12:4860483-4860505 GCTGAAGTCCTGGGTGAAGAGGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095110851 12:38294211-38294233 GCTGAAGACCAGGTTGAAGAGGG + Intergenic
1095598067 12:43981389-43981411 GCTGGAGCACAGAAAGAGGAAGG + Intronic
1095949505 12:47773993-47774015 GCTGAGACCCACAGGGAGGACGG + Intronic
1096500326 12:52060695-52060717 GCTGAAGGTCCGAGTGAGGCTGG + Intergenic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1096820304 12:54228645-54228667 GCAGAAGCTAAGAGAGAGGAGGG + Intergenic
1096913628 12:55009336-55009358 GCTGGGGGCCAGAGTGGGGATGG + Intergenic
1097711680 12:62924199-62924221 ACTGAGGCCCAGAGTGGGGGGGG + Intronic
1097839912 12:64311675-64311697 GCTTAGGGCAAGAGTGAGGATGG + Intronic
1098234546 12:68406188-68406210 GCAGAAGCCCAGGGTTGGGAAGG - Intergenic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101747293 12:107552659-107552681 ATCGAAGCCCAGAGTGATGAGGG + Intronic
1101811800 12:108113686-108113708 GCTGAAGCTCTGAGTTTGGAAGG + Intergenic
1102496771 12:113325040-113325062 ACTGAAGCTCAAAGAGAGGAAGG - Intronic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1104496322 12:129243620-129243642 GATGAAGCCCTGTGTTAGGAAGG - Intronic
1104684558 12:130776267-130776289 GCTGAAGCCGAGAGTTCTGACGG + Intergenic
1104955454 12:132463035-132463057 GCTGAAGCTGAGAATGGGGAAGG - Intergenic
1105706672 13:22971595-22971617 CCTGAGGCCCAGTGTGGGGATGG + Intergenic
1105797237 13:23867245-23867267 GCTGAAGCGCAGCGTGTGCAAGG - Intronic
1105962671 13:25356186-25356208 CCTGGAGCCCAGAGTGGGGCAGG + Intergenic
1106422962 13:29598742-29598764 ACTGAGGCACAGAGTGAGCAGGG - Intergenic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1111146276 13:84184988-84185010 GATGAAGCCCAAAGTGCTGATGG - Intergenic
1113600155 13:111562919-111562941 GCTGCAGCCCTGGGGGAGGAGGG + Intergenic
1114142253 14:19926713-19926735 ACTGAAGACCAGAGTTAGTACGG - Intergenic
1115707355 14:36012860-36012882 GCTCATGCCCAGAGAGAGAAAGG - Intergenic
1115907181 14:38212412-38212434 GCTGGAACCCAGAGGGAGCAGGG - Exonic
1116247785 14:42438592-42438614 GATAAAGGTCAGAGTGAGGATGG + Intergenic
1117637057 14:57754875-57754897 ACTGAAGCCCAGAGAGGGAAAGG + Intronic
1118497621 14:66324512-66324534 GGTGGAGCCCAGAGAGATGAAGG + Intergenic
1118815807 14:69313174-69313196 GCTGTAGCCCAGAGTATGGGGGG - Intronic
1119161666 14:72458017-72458039 TCTGAAGGTCAGGGTGAGGAGGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119377232 14:74204509-74204531 AATGAAGGCCAGAGTGAGGGGGG - Intergenic
1119399074 14:74349561-74349583 GCTAGAGCCCAGAATGAGGCTGG + Intronic
1119681221 14:76593575-76593597 GGTGAAGCTCAGAGTGAGGGTGG + Intergenic
1120020223 14:79521726-79521748 GCTGAAGACCAGAATGAAAATGG - Intronic
1121625895 14:95385197-95385219 ACTGGGGGCCAGAGTGAGGAAGG + Intergenic
1121639344 14:95474968-95474990 ACTGAAGCCCAGAGTGGGGCAGG + Intronic
1121664677 14:95663426-95663448 ACCGAAGCCCAGAGAGTGGATGG + Intergenic
1122067172 14:99181807-99181829 CCTGAAGTCCAGAGTGGGGAAGG - Intronic
1122152187 14:99731280-99731302 GCTGGAGCCCGGGGTGAGGCTGG - Intergenic
1122327817 14:100893003-100893025 GCAGATGCCCAGAGTGGGGTTGG + Intergenic
1122351433 14:101095583-101095605 CCTGAACCCCAAAGGGAGGAGGG - Intergenic
1122794106 14:104197130-104197152 GGTGAGGCCCAGAGAGGGGAAGG - Intergenic
1122826231 14:104372143-104372165 TCTGAAGCAGAGAGTGAGAAAGG + Intergenic
1122829616 14:104389413-104389435 GCTGATGCCCAGAGAGATGTGGG + Intergenic
1122861453 14:104584397-104584419 GCTAAAGCCCAGGGTGGGGTTGG - Intronic
1123042974 14:105497985-105498007 GCTGGTGCCCAGAGCGAGGCTGG - Intronic
1123144168 14:106111648-106111670 ACTGAATCTCTGAGTGAGGAAGG + Intergenic
1123220940 14:106854737-106854759 ACTGAATCTCTGAGTGAGGAAGG + Intergenic
1123786874 15:23683412-23683434 GCTGAAGCCCAGACTGCTGTGGG - Intergenic
1123954718 15:25323427-25323449 TCTGAAGCACAGAGAGGGGATGG - Intergenic
1124027922 15:25983885-25983907 CCTGAATCCCAAAGGGAGGAGGG + Intergenic
1127736513 15:61845038-61845060 ACTGCAGCCCAGAATGATGAAGG - Intergenic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128028861 15:64461538-64461560 CCTCAACCCCAGAGGGAGGAAGG - Intronic
1128090651 15:64916689-64916711 GCAGAAGCCCTGAGGTAGGAAGG + Intronic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128343119 15:66836520-66836542 ACTGAAGCCCAGAGGGGAGATGG + Intergenic
1128674904 15:69601376-69601398 GCTGAAGCTGAGGCTGAGGAGGG - Intergenic
1128878769 15:71224113-71224135 GCAGAGCCCAAGAGTGAGGAGGG + Intronic
1128995229 15:72290070-72290092 TATGTGGCCCAGAGTGAGGAAGG + Intronic
1129251961 15:74314147-74314169 CCTGCACCCCAGGGTGAGGAGGG + Intronic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129377779 15:75145080-75145102 GCTGGTGCCCAAAGTCAGGAGGG + Intergenic
1129382609 15:75177686-75177708 GCTGAGGCTCAGAGAGAGCAGGG - Intergenic
1129465955 15:75724325-75724347 GCCCAAGCCCAGGGTGGGGATGG - Intronic
1129467697 15:75733103-75733125 GCTGATGCCCAGAGAAAGGAGGG + Intergenic
1129523114 15:76198175-76198197 GCTGAAGCTCAGAGTGGCTAAGG + Intronic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129658046 15:77537606-77537628 CCAGAATCCCAGACTGAGGATGG + Intergenic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1129689755 15:77706464-77706486 CCTGAGGCCAATAGTGAGGAGGG - Intronic
1129719516 15:77870488-77870510 GCGGATGCCCAGAGAAAGGAGGG - Intergenic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1129981156 15:79872528-79872550 GCAGTAGCCCAGAGTCAGCAAGG + Intronic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1130550877 15:84889253-84889275 GTAGAAGCCCAGAGAGGGGAAGG + Intronic
1131371055 15:91882217-91882239 ACTGAAACTCAGTGTGAGGATGG + Intronic
1131442907 15:92472197-92472219 GCTGACCCCCAGAGTGGGGAAGG + Exonic
1131507061 15:93028517-93028539 GGTGCAGCCCAGACAGAGGAAGG + Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1132264932 15:100461461-100461483 ACTGAAGCCCAGAGAGATTATGG - Intronic
1132299606 15:100767827-100767849 GCTGAAGCTCAGAGAGTGGCAGG + Intergenic
1132716840 16:1294786-1294808 CCTGAATCCCAAAGGGAGGAGGG - Intergenic
1133424194 16:5673444-5673466 GCTGAAAGCCAGAGAGAGGAAGG - Intergenic
1134183041 16:12062820-12062842 GCTGAAGCACAGAGGCAGGGCGG + Intronic
1135063866 16:19292823-19292845 CCTGGAGCACAGAGTAAGGAGGG + Intronic
1136139817 16:28281449-28281471 GCAGCAACCCAGAGTCAGGATGG + Intergenic
1136141754 16:28292900-28292922 GCGGGGGCCCAGACTGAGGAGGG - Exonic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1137403223 16:48170315-48170337 GCTGGAGCGTAGAGAGAGGAGGG - Intronic
1137545961 16:49403732-49403754 ACTGAAGACTAGAGTGAGGTGGG - Intergenic
1137547164 16:49412137-49412159 GCTGATGCCCAGAGAAGGGAAGG + Intergenic
1137726180 16:50658239-50658261 GCTGAGGCCCAGAGAGGGAAAGG - Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1138542174 16:57695087-57695109 GCTATAGCCCAGTGTGGGGAAGG - Intronic
1139354633 16:66360202-66360224 GCAGAAGCCCAGAGAGGGCAAGG - Intergenic
1139986050 16:70899458-70899480 GCTGAAGGGGAGAGAGAGGAAGG + Intronic
1141141568 16:81499938-81499960 GGTGAAGCCCAGAGTGCGTGGGG - Intronic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142121747 16:88389945-88389967 GGTGAAGCCGCGAGTGAGGTGGG + Intergenic
1142178671 16:88656739-88656761 GCTGGAGCCCTGTGGGAGGAGGG - Intronic
1142187671 16:88702104-88702126 GCTGGAGCCCGGAGTGCGCACGG - Intronic
1142195686 16:88738337-88738359 GCTGAAGCCCCGAGTGCTGATGG + Exonic
1142348767 16:89570452-89570474 GCTGAAGCCCAAGCTGAGCAGGG - Intergenic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1142489674 17:270125-270147 ACAGCAGCCCAGAGTGAGGCAGG + Intronic
1143318552 17:6052425-6052447 CCTGAAGCGCAGGATGAGGAGGG + Intronic
1144278940 17:13704970-13704992 GTTGAAGCCCAGATTGACCAAGG - Intergenic
1144378360 17:14668007-14668029 GCTGAAGACTGGAGTGAAGATGG + Intergenic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1144829964 17:18125848-18125870 CCTGGACCCCAGAGTGGGGATGG + Intronic
1146461853 17:33052411-33052433 ACTGCAGCCCAGAGAAAGGACGG - Intronic
1146558607 17:33848782-33848804 GCAGAACCCCAGAGTGTTGAGGG - Intronic
1146570770 17:33950654-33950676 GCTGAAGTTCAGAGAGGGGAAGG + Intronic
1147006187 17:37406329-37406351 TCTGAAGCCCAAAGAGGGGATGG + Intronic
1147110343 17:38257063-38257085 GCTGAAGACGAGAAGGAGGAGGG + Intergenic
1147561320 17:41511143-41511165 ACTGAAACCCAGAGAGAGGCAGG + Intergenic
1147716120 17:42509838-42509860 GCTGAATCCCTGAGTGAGCTGGG - Intronic
1147945559 17:44078345-44078367 GGTGAAGCCCAGAGGGATGGGGG + Exonic
1148199996 17:45743895-45743917 CCTGGAGCCCAGACTGAGGGTGG + Intergenic
1148419167 17:47531368-47531390 GCTGAAGACGAGAAGGAGGAGGG - Exonic
1148431741 17:47649180-47649202 ACTGAAGCCCAGAGAGGGTATGG - Intergenic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148945786 17:51260644-51260666 GCGGAAGCCCGGAATGAGGCCGG + Exonic
1148957465 17:51365568-51365590 GCTGGTGCCCAGAGAGAGAAAGG - Intergenic
1149599879 17:57886292-57886314 CCTGAAGACCTGAGTGAGGCAGG + Intronic
1150218816 17:63484541-63484563 GGTAAAGCCCTGAGTGAGGATGG + Intergenic
1150621485 17:66811287-66811309 GCTGACACTCAGAGTGGGGACGG - Intergenic
1150805052 17:68312169-68312191 CCTGAAGTCCAGAGCTAGGAGGG - Intronic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151890844 17:76949592-76949614 GGAGAAGCCCAGAGTGAAAAGGG - Exonic
1151974980 17:77479676-77479698 CCTGGAGCCCAGAGCGAGGGAGG - Intronic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152534140 17:80940805-80940827 TCTGCAGCCCAGAGTGGGGAGGG + Intronic
1152613069 17:81324993-81325015 GCAGAAGCCCACAGTCAGGATGG + Intronic
1152685114 17:81690097-81690119 GCAGCTGCCGAGAGTGAGGAAGG + Intronic
1153047918 18:873293-873315 ACTAAAGCCGGGAGTGAGGAGGG + Intergenic
1153226847 18:2906495-2906517 GCCGGAGCCAAGAGTGAGGCCGG + Intronic
1153527835 18:6014650-6014672 GCTGGAGCTCAGAGTGGGGCAGG + Intronic
1155426649 18:25714310-25714332 ACTGAAGCTCAGAGTGGGAAAGG - Intergenic
1156449682 18:37259763-37259785 GCTGCAGGCCAGGGGGAGGATGG - Intronic
1158547438 18:58408174-58408196 GCAGAAGTCCAGACTGAGGGAGG - Intergenic
1159044196 18:63353361-63353383 GCTGAAGAACAGGTTGAGGAGGG + Intronic
1159891658 18:73958778-73958800 ACTGATGCCCAGAGTGATGGAGG - Intergenic
1160149652 18:76389314-76389336 ACTGCAGCCAAGATTGAGGAGGG + Intronic
1160231927 18:77055240-77055262 GCAGAAACCCAGAGGCAGGAAGG + Intronic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1160558846 18:79743656-79743678 AGTGAAGCACAAAGTGAGGAGGG + Intronic
1160583647 18:79901228-79901250 CCTGCAGCCCAGGGTGGGGAGGG - Intergenic
1160688133 19:446808-446830 ACCGAAGCCCAGAGAGGGGATGG + Intronic
1160702277 19:513389-513411 ACTGAGGCCCAGAGGCAGGAGGG - Intronic
1161455510 19:4367876-4367898 GATGCCGCACAGAGTGAGGATGG + Intronic
1161623030 19:5309249-5309271 GCTGAAGCCCAGAGAGGTTAAGG - Intronic
1161703505 19:5807007-5807029 GGGGAAGCTCAGAGTGGGGATGG + Intergenic
1162735719 19:12745867-12745889 GGAGAAGTCCAGAGTGAGAAGGG - Intronic
1163092917 19:15033688-15033710 CCTGCAGCACAGAGGGAGGAGGG - Intergenic
1163309766 19:16506888-16506910 GCTTGAGCCCAGTTTGAGGACGG - Intronic
1163315539 19:16538237-16538259 GCTGAAGCCCAGAGTAGGAGGGG - Intronic
1164579465 19:29425585-29425607 GCTGGAGCTGAGAGTGAGGTAGG - Intergenic
1164588142 19:29490426-29490448 ACTGAAGCCCAGAGAGGGGACGG + Intergenic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166119185 19:40674727-40674749 ACTGGAGCCCAGAGAGGGGAGGG - Intronic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1167526790 19:49989236-49989258 GCCGAAGCCCTGGGAGAGGATGG - Intronic
1167704033 19:51067835-51067857 GCTGGAGCCTGGAGTGAGGGTGG + Intergenic
1168276851 19:55283715-55283737 GCTGAGGCAGAGAGGGAGGAAGG - Intronic
1168611281 19:57802569-57802591 CCTGAAGGCCACAGTGAGCAAGG - Intronic
1168677161 19:58286887-58286909 GATGAAGCAGAGAGGGAGGAAGG - Intronic
925900210 2:8503878-8503900 GCTGGTGCCCAGACTGAGGGTGG - Intergenic
926075498 2:9939673-9939695 TCTGAAGCCCAAACCGAGGAGGG + Intergenic
926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG + Intergenic
926244749 2:11114236-11114258 GCTGGAGCACAGGGAGAGGAAGG + Intergenic
926368667 2:12157790-12157812 GCTGAAGCTAGGAGTGAGAATGG - Intergenic
926479688 2:13377155-13377177 GCCGAAGCCAAGACTGAAGAGGG + Intergenic
926633566 2:15158626-15158648 TCTGCAGCCCTGAGGGAGGAAGG - Intergenic
926793930 2:16603279-16603301 TCTGCAGGCCAGAGTGAGGAGGG + Intronic
927849147 2:26487969-26487991 ACTGAAGCCCAAGGTGATGAAGG - Intronic
927870499 2:26619959-26619981 CCTGAAGCCCACAGCGGGGAAGG + Intronic
927879628 2:26681459-26681481 ACAGAGGCCCAGAGTGGGGAAGG - Intergenic
927939965 2:27097410-27097432 GCTGAAACTCTGGGTGAGGAGGG - Intronic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
929083591 2:38146586-38146608 GCTGAGGCCCGTTGTGAGGAGGG + Intergenic
929563346 2:42969390-42969412 GCCAAGGCCCAGAGAGAGGAGGG + Intergenic
929580372 2:43078516-43078538 GCAAAAGAGCAGAGTGAGGAGGG - Intergenic
929962188 2:46505155-46505177 TCTGAAGCCCAGAGTAAGCCAGG - Intronic
931213474 2:60219747-60219769 GCAGAAGCCCAGAGAGGTGAAGG - Intergenic
932569765 2:72932396-72932418 ACTGAAGCCCAGAGGGGGAAGGG + Intronic
933167451 2:79092152-79092174 GCTTCAGCCCCAAGTGAGGAAGG + Intergenic
933350760 2:81149575-81149597 GCTGGAGGCCAGAGTTAGGTAGG - Intergenic
933885406 2:86715175-86715197 GGTGAAGGCCACAGTGAGGAGGG + Intronic
933924769 2:87081516-87081538 GGTGAAGGCCACAGTGAGGAGGG - Intergenic
933939457 2:87233280-87233302 GCTGAGGCACAGAGAAAGGAAGG - Intergenic
934538426 2:95155928-95155950 CCTGAAGCTCAGAGAGAAGAGGG + Intronic
935120551 2:100180128-100180150 ACTGGAGCCTGGAGTGAGGAGGG - Intergenic
935418910 2:102846373-102846395 GCTGAAGCCCTGAATTAGAAAGG + Intergenic
935902430 2:107806827-107806849 GGTGGAGGCCTGAGTGAGGAAGG + Intergenic
935987490 2:108688881-108688903 GCTGGAGGCAAGAGTGAGGAAGG + Intergenic
936126316 2:109791578-109791600 GCTGGAGGCAAGAGTGAGGAAGG + Intergenic
936218377 2:110579890-110579912 GCTGGAGGCAAGAGTGAGGAAGG - Intergenic
936353678 2:111732493-111732515 GCTGAGGCACAGAGAAAGGAAGG + Intergenic
936469795 2:112788920-112788942 TCTGGAGCTCAGAGAGAGGAGGG + Intergenic
936938812 2:117861967-117861989 GTTGAGGCCCAAAGTGGGGAAGG - Intergenic
937159696 2:119748262-119748284 GCTGAAGGCCAGAATGGGGCTGG - Intergenic
937421541 2:121760391-121760413 GCTGAAGCACAGAGAGAGGTAGG + Intronic
937851399 2:126639446-126639468 GCAGAAGCACAGAGGGAGGTTGG - Intergenic
937983016 2:127625884-127625906 GCTGAGGCCCAGAGGCAGGCAGG - Intronic
938051710 2:128178999-128179021 GCTGAGGCCCCGAGTGTGAAGGG + Intronic
938236572 2:129710819-129710841 CCTGCAGCCCAGAATGGGGAGGG - Intergenic
938418561 2:131124703-131124725 ACAGAAGCCCACAGTGTGGAAGG - Intronic
938757833 2:134397105-134397127 GCAGAAGCCCAGATTGTGAAGGG + Intronic
938882089 2:135600938-135600960 GCTGCAGGGGAGAGTGAGGAAGG - Intronic
939475363 2:142679960-142679982 TCAGAAGCACAGAGTGAAGAAGG + Intergenic
939636443 2:144588672-144588694 TCTGAAACCCAGAGTTAGGCAGG - Intergenic
939708824 2:145489484-145489506 GCTGAAGCCCAGAGTCAGCAGGG - Intergenic
941820532 2:169840245-169840267 GCTCAGGCCCAGAGGGAGGTGGG - Intronic
941953093 2:171176795-171176817 GGTGAAGCAGAGAGTGAGCAAGG - Intronic
943369860 2:187002840-187002862 GCTGGAGCCAACACTGAGGAGGG + Intergenic
944111596 2:196137683-196137705 GCTGTAGCCAAGAATGAGAAAGG + Exonic
944280055 2:197885476-197885498 GCTGATGCCCACAGTGGGGAGGG + Intronic
944856772 2:203775599-203775621 GCTGGATTTCAGAGTGAGGAGGG + Intergenic
945933407 2:215879431-215879453 GCAGCAGCCCAGAGTGAGTCTGG + Intergenic
945950615 2:216035440-216035462 GCTGACACCCAGATTGAGTAGGG - Intronic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946362031 2:219224672-219224694 GCGGAAGCGCAGAGGCAGGAGGG + Exonic
946427903 2:219609122-219609144 GGAGAAGCGCAGACTGAGGATGG - Exonic
947158288 2:227185934-227185956 GGTGATGCCCAGAGAGAGGCAGG - Intronic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
947817410 2:233047565-233047587 ACTGGAGCCCAGAGTGAGTGTGG + Intergenic
948036649 2:234863438-234863460 GCTGAAGCCCATTCTGAGGGGGG + Intergenic
948136061 2:235637133-235637155 GCTGAATCCCACAGTGAGTCAGG - Intronic
948804384 2:240447164-240447186 GCTGGACCCCAGAGCCAGGAGGG + Intronic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1168865937 20:1086589-1086611 GATCAAGCCCAGTGTGGGGAGGG + Intergenic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1172183005 20:33015005-33015027 ACGGAGGCCCAGAGTCAGGAAGG + Intronic
1172761742 20:37328133-37328155 GCTGAAGCTTAGAGTGATGCGGG - Intergenic
1172766264 20:37352687-37352709 GCTGAAGCTCAGAGAGAGGCGGG + Intronic
1173027281 20:39320203-39320225 GATGAAGCCCACAGTTAAGATGG + Intergenic
1173242857 20:41313176-41313198 GCTGAAGGGGAGAGTAAGGAAGG + Intronic
1173705578 20:45108066-45108088 ACAGAAGCCCAGAGTGCAGAAGG + Intergenic
1173721356 20:45260859-45260881 ACTGAGGCCCAGAGAAAGGAAGG - Intergenic
1173910934 20:46670306-46670328 GCTCAAGCCATGAGTCAGGAAGG - Intronic
1173978830 20:47207502-47207524 CCTGAAGACCAGAGAAAGGAGGG - Intergenic
1175182321 20:57157335-57157357 ACGGAAGCCCTGGGTGAGGAGGG - Intergenic
1175920090 20:62446582-62446604 GCTGATGCCCCTGGTGAGGAAGG - Intergenic
1176218017 20:63957345-63957367 GCTGACCCCCAGAGTGTGGTGGG - Exonic
1177121684 21:17144828-17144850 GCTTAAGGCCAGATTCAGGATGG + Intergenic
1179514723 21:41898778-41898800 GAGCAAGCCCAGACTGAGGAAGG + Intronic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181652998 22:24271161-24271183 CCCGAAGCCCAGAACGAGGACGG - Intronic
1181749317 22:24977685-24977707 GCTGAAGCCTAGAGAGGGCAGGG + Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1182024592 22:27108133-27108155 GCTGAGGCCCAGAGAGGGAAGGG - Intergenic
1182052281 22:27322719-27322741 ACGGAAGCCCAGAGTGGGGAAGG + Intergenic
1182097915 22:27638402-27638424 GCTGAGGCCCAGAGAGGGGTTGG + Intergenic
1182557266 22:31136007-31136029 GCTGAGGCCCAGAGAGAGAGGGG + Intronic
1182770925 22:32795766-32795788 GCAGAATCCCAGAGAGAGTAGGG + Intronic
1182785590 22:32905020-32905042 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1183103032 22:35595432-35595454 CCTGAAATCCAAAGTGAGGAGGG - Intergenic
1183210707 22:36449623-36449645 GCTGAGGCCCAGAGATGGGAAGG - Intergenic
1183292420 22:37010830-37010852 GATGGAGCCCAGAGAGAGGCAGG + Intergenic
1183347358 22:37315223-37315245 GCTGAGGACCAGAGAGGGGAAGG - Exonic
1183947191 22:41333105-41333127 ACTGAGGCACAGAGTGGGGAGGG + Intronic
1184296226 22:43527201-43527223 GCTTCAGCCCAGAATAAGGAAGG - Intergenic
1185011144 22:48315400-48315422 CCTGGAGCCCAGAGAGAGAAAGG + Intergenic
1185159527 22:49214843-49214865 TCAGAAGCCCAAAGTGCGGAGGG - Intergenic
949876239 3:8627876-8627898 GCTAAGGCCCAGGGGGAGGAAGG - Intronic
950067870 3:10127703-10127725 GCTGAAGCACAGTGTCAGCATGG - Intergenic
950195664 3:11007511-11007533 GCTGAGGCACAGAGAGGGGAAGG + Intronic
950361498 3:12452599-12452621 ACTGAAGCCCAGAGAGAAAAGGG + Intergenic
950432125 3:12956834-12956856 ACAGAAGCCCAGAGAGTGGAGGG - Intronic
950463944 3:13142264-13142286 GCAGAAGCCCAGAGAGGGGAAGG + Intergenic
950705321 3:14775954-14775976 ACTGAAGCCCAGAGGAAGGATGG + Intergenic
950720374 3:14878150-14878172 GCAGAGGCCCTGAGTCAGGAAGG + Intronic
951109037 3:18779410-18779432 GCTGAAGCCTGGAGATAGGATGG - Intergenic
951662686 3:25087178-25087200 GCTGAATTCCAAAGGGAGGAAGG + Intergenic
952129924 3:30349762-30349784 GCTGCAGCCCCAAGTGGGGAAGG + Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
952841129 3:37646428-37646450 GATGAAGACCAAGGTGAGGAAGG + Intronic
952961820 3:38596856-38596878 ACTGAGGCCCAGAGACAGGAGGG - Intronic
954423460 3:50430943-50430965 GCTGGGGCCAAGAGTCAGGAGGG - Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
954854907 3:53635589-53635611 GCTGAAACCCAGATAGAGAAAGG - Intronic
959410079 3:106009920-106009942 CCTGTATCCCAGGGTGAGGATGG - Intergenic
959577687 3:107952025-107952047 ACTGAAGCCCAGAGTTAAGAAGG + Intergenic
960683749 3:120275969-120275991 GCAGAAGATCAGAGTGAAGAGGG - Intronic
961424030 3:126830893-126830915 GCTGGAGCCGAGAGTGAGTGAGG - Intronic
961513366 3:127418100-127418122 GCAAAAGCCAAGAGTCAGGAGGG + Intergenic
961646235 3:128394167-128394189 GCTGAGGCCCAGGGTGAGCGTGG - Intronic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
963026307 3:140922730-140922752 GGAGAAGCCCAGGGTGGGGAGGG - Intergenic
964766857 3:160187768-160187790 ACTGAAGCCCAGAGTGGCTAGGG + Intergenic
966918516 3:184597769-184597791 ACTGAGGCCCAGGGAGAGGAGGG - Intronic
966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG + Intronic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
967949825 3:194832181-194832203 GCGGCGGCCCAGAGTGGGGAGGG + Intergenic
968508854 4:986572-986594 TCTGAAGCCAAGTGTAAGGAGGG + Intronic
968961315 4:3745179-3745201 GCTGACGCCGTGTGTGAGGAGGG + Intergenic
969044135 4:4324228-4324250 GCTTGAGCACAGAGGGAGGAGGG + Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969615720 4:8251620-8251642 GCTGAGGCCCAAAGAGGGGAAGG + Intergenic
969630170 4:8331254-8331276 GCAGAAGGCCAGAGGAAGGAAGG + Intergenic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
971470847 4:27024928-27024950 GCTGGAGCACGGAGTGAAGATGG + Intronic
972322870 4:37988862-37988884 CCTGAATTCCAGAGAGAGGAAGG - Intronic
976011096 4:80489516-80489538 GATGTAGCCCAGATAGAGGAAGG - Intronic
976443262 4:85101668-85101690 GCTGAAGTGCAAAGTGAGGATGG + Intergenic
978260285 4:106748384-106748406 GAAGAAGGCCAGAGTAAGGAGGG + Intergenic
980259815 4:130433651-130433673 CCTGAATTCCAAAGTGAGGAAGG - Intergenic
981550703 4:145938053-145938075 CCAGCAACCCAGAGTGAGGAGGG + Intronic
981625198 4:146747393-146747415 GCAGAAGCTCTGATTGAGGATGG - Intronic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
985420380 4:189779424-189779446 GCTGAGCCCCAGTGTGAGGCTGG - Intergenic
986751516 5:10792167-10792189 GCTGAAGCCCAGAGCATGGATGG - Intergenic
988298440 5:29393390-29393412 CCTGAAGCCTTGAGGGAGGATGG - Intergenic
989612086 5:43303976-43303998 GTTGAAGCTCAGAGTGAGGATGG - Intronic
990245241 5:53857808-53857830 GCTTAAGGCCAGAATGTGGAAGG + Intergenic
990503217 5:56418074-56418096 ACTCAAGCTCATAGTGAGGAAGG - Intergenic
991037488 5:62142670-62142692 GCTGAAAGACTGAGTGAGGATGG - Intergenic
991709325 5:69392324-69392346 GCTGGAGCCCAGTGTTAAGAGGG - Intronic
991945377 5:71894170-71894192 GCTGGAGACCACAGTCAGGAGGG + Intergenic
992390365 5:76325602-76325624 TCTGAAGCCTTGAGTCAGGAAGG - Exonic
993985400 5:94591498-94591520 GCTAAAGACCAGAATGAGGCAGG - Intronic
994018292 5:94994219-94994241 CCTGAAGGCCTGAGTGAGGCTGG + Intronic
995144322 5:108769346-108769368 GCAGAAACCCTGAATGAGGAAGG + Intronic
995596838 5:113756387-113756409 CCTGAATTCCAAAGTGAGGAAGG - Intergenic
995646564 5:114319493-114319515 CCTGAAGCTCAGAGTGATAAAGG + Intergenic
995672662 5:114624644-114624666 GCTGAAGCCCAGAGCACTGAAGG + Intergenic
996315004 5:122151927-122151949 GCAGAAGCCCAAAGTGAGTCTGG + Exonic
996708774 5:126523403-126523425 TCTGATGCACAGAGAGAGGATGG - Intergenic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997366246 5:133327032-133327054 ACTGAGGCCCAGGGTGGGGAAGG + Intronic
997473779 5:134131149-134131171 GCTGGAGCACAGAGTGAGAAGGG + Intronic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998979495 5:147686008-147686030 GCTGAAGCTAGGAGTGAGGCTGG + Intronic
999202781 5:149828053-149828075 ACTGTGGCCCAGAGTGGGGAGGG + Intronic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999364935 5:151016754-151016776 ACTGCAGCCCAGAGTTTGGAAGG + Intergenic
999501655 5:152152552-152152574 ACTGAAACACAGAGAGAGGAAGG - Intergenic
999519365 5:152334799-152334821 GCTGAGGCCCAGAGAAAAGAAGG - Intergenic
999658927 5:153838722-153838744 GCTGAAGCCCACAGTCAGGCAGG + Intergenic
1000293369 5:159891700-159891722 GCTGAAGACCTGAGGGAGGAGGG - Intergenic
1000971582 5:167720784-167720806 GTGGAAGCCCAGAGGAAGGAAGG + Intronic
1001253754 5:170168124-170168146 ACTGAAGCCCAGAGAGAGGAAGG - Intergenic
1001333986 5:170782907-170782929 GCTGGAGCCAAGAGTGAGTTTGG + Exonic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1001974574 5:175986992-175987014 GCTGTAGCCCAGAGAAATGATGG + Intronic
1002242859 5:177856787-177856809 GCTGTAGCCCAGAGAAATGATGG - Intergenic
1002816909 6:689570-689592 GCAGAAGCTCAGAGGTAGGAAGG - Intronic
1005469014 6:26143543-26143565 ACTTAAGCCCAGAGTGGTGAAGG - Intergenic
1005500685 6:26426579-26426601 GATGGAGCCCAGAGCGGGGATGG + Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006516513 6:34548577-34548599 AATGAAGCCCAGAGTGGGGAAGG + Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1006922108 6:37633889-37633911 GCTGAAGCCCAGAGTGGGGAAGG - Exonic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1009973410 6:70648426-70648448 GTTGAACCCGAGTGTGAGGATGG + Intergenic
1010237631 6:73588591-73588613 GCTGAACCTAAGGGTGAGGAGGG + Intergenic
1010785389 6:79994146-79994168 GCAGAATGCAAGAGTGAGGAAGG + Intergenic
1011245165 6:85314704-85314726 GCTGAAGCCTGGTGTGGGGAGGG - Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1012980068 6:105819916-105819938 GCTGAAGCTCAGAATGAGGATGG + Intergenic
1013088515 6:106876987-106877009 AGTGAAGTCCAGACTGAGGAGGG - Intergenic
1013108531 6:107046758-107046780 GGTGAAGCCCAGGGTGTGGTAGG + Intronic
1013508821 6:110826323-110826345 GATGCAGCCCAGACTAAGGAAGG + Intronic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1015516107 6:134083993-134084015 GCTGAGGCCCTAATTGAGGATGG - Intergenic
1016729903 6:147417949-147417971 TCTGAAACCCAGAGTGGAGAGGG + Intergenic
1017246092 6:152226817-152226839 GCTGAACCTCAGACTGTGGAGGG + Intronic
1018255940 6:161919346-161919368 GCTGAAGGTGGGAGTGAGGATGG + Intronic
1018301015 6:162403229-162403251 GCTGGAGGCCAGAGTGAGTGAGG - Intronic
1018604238 6:165579979-165580001 GATGTAGAACAGAGTGAGGAGGG - Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018972245 6:168537783-168537805 GCTGGAGCCCACAGGGTGGATGG + Intronic
1019138730 6:169929593-169929615 GATGAAGCCAACAGGGAGGATGG + Intergenic
1019138799 6:169929945-169929967 GATGAAGCCCACAGGGAGGGTGG + Intergenic
1019138913 6:169930939-169930961 GCTGAACCCCAGTGTGACCAAGG + Intergenic
1019267383 7:125453-125475 ACTGAGGCCCAGAGGGAGAAGGG + Intergenic
1019276834 7:180203-180225 CCTGAAGCCCACCCTGAGGAGGG + Intergenic
1019475664 7:1242908-1242930 GCAGAGGCCCAGAGAGGGGAAGG + Intergenic
1019572965 7:1721871-1721893 ACTGAAGACCAGAGAGGGGAAGG - Intronic
1019864893 7:3698499-3698521 ACTGACGCTCTGAGTGAGGAGGG - Intronic
1021297614 7:18927834-18927856 GCTGAATGGCAGAGTGAGGATGG + Intronic
1021784251 7:24136527-24136549 GCTGAAGCCCTCAGTGGGGAGGG - Intergenic
1022496437 7:30855842-30855864 GCTGCCTTCCAGAGTGAGGAGGG - Intronic
1023141922 7:37110324-37110346 GATGAAGCTGAGAGTGAGGCTGG - Intronic
1023564079 7:41506198-41506220 GTTGCAGCCCAGAGAGAGGCAGG - Intergenic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024230837 7:47362073-47362095 GCTGAGACCCAGAGTGGGGCGGG + Intronic
1024707677 7:51979050-51979072 GCAGCAGCCCAGGGTGGGGACGG + Intergenic
1024970176 7:55061956-55061978 GCTGGAGGCCAGAGTGGGGAGGG + Intronic
1026112040 7:67466131-67466153 CCAAAAGCCCAGAGTGAGTAAGG + Intergenic
1029609070 7:101617025-101617047 ACTGAAGCCCAGAGAGAGGAAGG + Intronic
1029736622 7:102469015-102469037 GCTGAAGCACAGGGTGGCGATGG - Exonic
1033563937 7:142560554-142560576 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033564326 7:142563868-142563890 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1035583788 8:756749-756771 ACTCAAGCTCAGGGTGAGGAGGG - Intergenic
1035846937 8:2875257-2875279 GAGGAAGCCCATTGTGAGGATGG - Intergenic
1035976300 8:4315240-4315262 CTTGAAGACCAGAGTGAGGTAGG + Intronic
1036012296 8:4740000-4740022 GCTGAAGCTCAGGGTGGGAAAGG - Intronic
1036224047 8:6943413-6943435 GCAGAAGCCCATAGCCAGGATGG + Intergenic
1036434583 8:8722031-8722053 ACTGAAGTCCAGAGAGAGGAAGG - Intergenic
1036585355 8:10118606-10118628 GCTGGAGCCCAGGGTGTGGGCGG - Intronic
1036686914 8:10917823-10917845 GTTGAAGCCCAGAGAGATCAAGG - Intronic
1036699294 8:11001410-11001432 GCTGAAGTTGACAGTGAGGAAGG + Intronic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1037884047 8:22586985-22587007 CCTGAGGCCCAGGGAGAGGAAGG - Intronic
1038447186 8:27612192-27612214 GCTGAAGCCCAGAGAGGGCATGG + Intronic
1039033487 8:33333868-33333890 GCTGAAATACAGAGTGAGGAAGG + Intergenic
1039809146 8:41028973-41028995 GCTGGAGCACAGAGTGAGAGAGG - Intergenic
1041246113 8:55889815-55889837 GCAGCAGCCCACAGTTAGGAAGG - Intronic
1042052868 8:64730971-64730993 GGAGAAGTGCAGAGTGAGGAGGG - Intronic
1042229260 8:66540442-66540464 CCTGCAGCCCAGAATGAGGCTGG - Intergenic
1042472332 8:69205650-69205672 CATGTAGCCTAGAGTGAGGAAGG - Intergenic
1044218765 8:89645489-89645511 ATGGAAGCCCAGAGTGATGAAGG - Intergenic
1044375086 8:91460741-91460763 GATTAAACCCAGAGAGAGGAAGG - Intergenic
1044634099 8:94305363-94305385 GCTGAAGTCCAGTCTAAGGAAGG - Intergenic
1045051102 8:98326798-98326820 GCTGAAGCCCAGAATCATGAAGG + Intergenic
1045098312 8:98821160-98821182 GCTGGAGCCCAGAGCAAGGGCGG - Intronic
1045930544 8:107620662-107620684 GCTGAAGGACAGTATGAGGAAGG - Intergenic
1046097792 8:109580840-109580862 GCTGTAGTACAGAGGGAGGAGGG - Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046729019 8:117705293-117705315 GCTGGAGCCAAGGGTGATGATGG - Intergenic
1046791619 8:118328244-118328266 GCAGAAGCACATAGTAAGGAAGG - Intronic
1046886239 8:119370478-119370500 GCTGAACTCCATAGTGATGATGG + Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1047535682 8:125717609-125717631 GCAGCAGCCAAGAGTGAGCACGG + Intergenic
1048267327 8:132999049-132999071 ACTGCAGCCCAGAGTGAAGGAGG + Intronic
1048270741 8:133026227-133026249 GCTGTATCCCAGAGTGAAAACGG + Intronic
1048359981 8:133689412-133689434 AGTGAAGCCCAGAGAGAGGAAGG + Intergenic
1048870575 8:138793813-138793835 CCTGCAGCCCACAGGGAGGAAGG + Intronic
1049107737 8:140624228-140624250 GCTGCCTCCCAGAGTGAGGCAGG - Intronic
1049381840 8:142320067-142320089 GTGGCAGCCCAGGGTGAGGAGGG - Intronic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1049660081 8:143815930-143815952 GCTGAAGACCGGAGGGCGGAGGG - Intergenic
1050119069 9:2289364-2289386 GCTGATGCCCAGAGAGGCGAGGG - Intergenic
1050343929 9:4667514-4667536 GCTGACACCCAGAGTGATGTGGG + Intergenic
1051665665 9:19465085-19465107 TCTGCAGCCCAGAGTCAGCACGG - Intergenic
1051719771 9:20024434-20024456 GCTGAAGGCCAAAGCCAGGAAGG - Intergenic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1052940369 9:34127475-34127497 CCTGAATCCAAGAGTGAGGCAGG - Intergenic
1052969077 9:34365410-34365432 ACTGAAGCTCTGAGAGAGGAGGG - Intergenic
1053146293 9:35714406-35714428 ACCCAAGCCCAGAGGGAGGATGG - Intronic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1054808142 9:69412516-69412538 GCTGGAGCCCAGAGGCAGGAGGG - Intergenic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1056283654 9:85066475-85066497 CCTGAATCCCAAAGGGAGGAGGG - Intergenic
1056764475 9:89436417-89436439 GCAGAGGCCCTGCGTGAGGATGG - Intronic
1056777595 9:89525092-89525114 GCTGCAGCCGAGACTGAGGCCGG - Intergenic
1057186422 9:93059686-93059708 GCTGAGGCCCGGAGTGGGGTGGG + Intronic
1057880119 9:98786912-98786934 ACTGAAGCCCAAAGCGAGGAAGG - Intronic
1057928217 9:99171182-99171204 GCTGAGCCCCAGGGGGAGGAAGG - Intergenic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059422619 9:114201648-114201670 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1059464928 9:114462432-114462454 ACTGAGGCCCAGGGAGAGGAAGG + Intronic
1059695387 9:116725615-116725637 ACTGAAGCTCAGAGAGAGGCAGG + Intronic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1059761383 9:117340852-117340874 ACTGAAGCCTAGAGGGAGGAAGG - Intronic
1060212507 9:121719213-121719235 GCTGAGGCCAGGAATGAGGAGGG + Intronic
1061086199 9:128400206-128400228 ACTGAAGCCCAGAGTGGGCAAGG - Intergenic
1061087659 9:128408780-128408802 ACTGAGGCCCACAGTGGGGAAGG + Intergenic
1061195188 9:129103521-129103543 ACAGAGGCCCAGAGTGGGGAAGG - Intronic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061395079 9:130339417-130339439 GCTGAGGCCCAGAGTGGGAAGGG + Intronic
1061422562 9:130480177-130480199 ACTGAGGCCCAGAGAGAGCAGGG - Intronic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061670224 9:132184384-132184406 CCTGAAGCACACAGTGGGGAGGG + Intronic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061765032 9:132876179-132876201 GCTGAGGCCCAGAGAAGGGAAGG - Intronic
1061872472 9:133528216-133528238 GCAGAGGCCCAGAGTCTGGAGGG - Intronic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1061927466 9:133812994-133813016 GAGGAAGCCCAGTGTGGGGAGGG - Intronic
1062024617 9:134334625-134334647 ACTGAAGCCCACAGAGGGGAAGG - Intronic
1062040396 9:134401845-134401867 GCTGAAGCCCAGGGTGGGTGTGG - Exonic
1062231419 9:135484115-135484137 GTGGAAGCCCGGAGTGAGAAGGG + Intronic
1062424746 9:136500893-136500915 GCTGCAGCCCAGGGGGAGGGGGG + Intronic
1062590354 9:137271843-137271865 GCTGCAGCCCAGGGACAGGAGGG - Intronic
1185641773 X:1592428-1592450 GCTGGAGGCCAGAGTGGGGAGGG + Intronic
1186641647 X:11461926-11461948 CCTGAAGCCCAGGGCTAGGAGGG + Intronic
1186919490 X:14262449-14262471 GAGGATGCCCAGAGTCAGGATGG + Intergenic
1187274423 X:17805605-17805627 GCTGAGGCCCAGTGGGATGAAGG + Intronic
1187348837 X:18493051-18493073 GCTAAAGCCCCAAGTCAGGAGGG - Intronic
1187850091 X:23583168-23583190 GAGGATGCCCAGAGTCAGGATGG - Intergenic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1189607405 X:42694631-42694653 CCTGAGGCCCTGAGTGAGGATGG + Intergenic
1189705550 X:43755780-43755802 CCTGAAACCCAGACTGAGGATGG - Intergenic
1190094460 X:47467478-47467500 GCTGAGGCCCAGCGTGAACATGG - Exonic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1191046442 X:56143078-56143100 GCAGAAGCCCAGAGTGCATAAGG - Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1192234087 X:69285260-69285282 ACTGAAGCCCAGGGAGAGGATGG + Intergenic
1194614901 X:96088086-96088108 GCTGAAACACTGAGTCAGGAGGG + Intergenic
1195111771 X:101657254-101657276 GCTGAGGCTCAGAGTGGGGCAGG - Exonic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1195876152 X:109543464-109543486 GCTGAAGCCAAAAGTAAGGAGGG + Exonic
1197191100 X:123648611-123648633 GCTGGAGCTCAGCGGGAGGAGGG + Intronic
1197717337 X:129718978-129719000 ACTGTAGCCCAGGGAGAGGATGG - Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1200056239 X:153462835-153462857 GCTGATGCCCAGAGAGGGGTGGG - Intronic