ID: 1152260342

View in Genome Browser
Species Human (GRCh38)
Location 17:79263383-79263405
Sequence ATGTGATTTGTTTGGAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152260342 Original CRISPR ATGTGATTTGTTTGGAACGC TGG Intronic
912104745 1:106258244-106258266 ATGAGATTTGGTTGGGACACAGG - Intergenic
916421205 1:164639507-164639529 GGATGATTTGTTTGGAACCCTGG + Intronic
917994036 1:180415894-180415916 ATGTGAATTTTTTGGAGGGCAGG + Intronic
918056902 1:181029726-181029748 ATGTAATTTGGTTGGACAGCAGG + Intergenic
919360344 1:196584870-196584892 AAATGTTTTGTTTGGAACCCTGG - Intronic
924487162 1:244496215-244496237 ATGTGATTTCTTTTTAAAGCAGG - Intronic
1066426791 10:35314507-35314529 ATGAGATTTGGGTGGAACACAGG + Intronic
1073940068 10:108687041-108687063 GTGTGATTTTTTTGGTAGGCAGG - Intergenic
1078298876 11:10104660-10104682 ATGTGACTATTTTGGAACTCTGG - Intronic
1079318954 11:19434050-19434072 ATGTGATTTGTTTGCACCAATGG - Intronic
1083462996 11:62827107-62827129 AAGTGATCTGATTGGAATGCTGG + Intronic
1086675754 11:89605215-89605237 ATGAGATTTGTTTAGTACCCCGG - Intergenic
1087521061 11:99236720-99236742 ATGTAATTTGTTTGCAAAGGTGG - Intronic
1092185684 12:6476803-6476825 ATGTTGTTTGTCTGGAACCCAGG - Intergenic
1098348167 12:69527842-69527864 ATCTGCTTTGTTTGGAAAGTTGG - Intronic
1100932610 12:99627532-99627554 ATGTGAGTTGTTTGGCAGTCTGG - Intronic
1105336913 13:19480137-19480159 ATGGGATTTGTATTGAAGGCAGG + Intronic
1105940405 13:25142489-25142511 TTGTGATTTGTTTCTAACGTTGG + Intergenic
1107397708 13:40034615-40034637 ATGTGATTAGTTTGGAAATGCGG + Intergenic
1109510339 13:63363771-63363793 ATGTGATTTGTAAGGAAAACTGG + Intergenic
1109634022 13:65089758-65089780 ATATGATTTGTTTGTAACTTTGG - Intergenic
1109753476 13:66726684-66726706 ATGTGAGGTCTTTGGTACGCAGG - Intronic
1110379513 13:74834428-74834450 TTGTGATTTGTTTTGACCACTGG - Intergenic
1113340240 13:109415980-109416002 ATTTGGTTTGTTTGGATCTCAGG + Intergenic
1113811862 13:113147572-113147594 ATGGAATTTGTTGGGAACACTGG + Intronic
1118878998 14:69810349-69810371 ATGTGCCTTGGTTGGAAGGCTGG + Intergenic
1119378021 14:74210552-74210574 GTCTGATTTGCTTGGAACTCAGG + Intergenic
1120095377 14:80382144-80382166 ATGTGGTTTGTTTGGGAGCCTGG - Intronic
1131665238 15:94564441-94564463 ATGAGATTTGGTGGGAACACAGG + Intergenic
1133975196 16:10595603-10595625 ATATCATTTTTTTGAAACGCTGG + Intergenic
1134243968 16:12526146-12526168 GTGTGATTTGTATGAAATGCTGG + Intronic
1136066071 16:27759752-27759774 ACGTGATTTGCTTTGAACACTGG - Intronic
1138804224 16:60075406-60075428 ATGTTGTTTGTTTTGAATGCTGG - Intergenic
1141018026 16:80468444-80468466 ATGTGATTTCTTTAGATAGCTGG + Intergenic
1143529705 17:7495670-7495692 AGGTGATTTGTATGGAACCCAGG + Intronic
1150588819 17:66542852-66542874 ATGTGATTTTCTTGGAACGAGGG + Intronic
1151178844 17:72311235-72311257 ATGTGACTTTTTTGGAAAGAGGG + Intergenic
1152260342 17:79263383-79263405 ATGTGATTTGTTTGGAACGCTGG + Intronic
1152366021 17:79856902-79856924 ATGTGACTTATTTGGAACAAGGG + Intergenic
1157895219 18:51460188-51460210 TTTTGCTTTGTTTGGAAAGCAGG - Intergenic
1159001596 18:62979759-62979781 TTGTTGTTTGTTTGGAAGGCAGG + Exonic
1166327463 19:42059920-42059942 ATCTGATGTGTTTGGAAGGGAGG - Intronic
925339602 2:3126974-3126996 ATGTGATTTATTGGAAACACTGG + Intergenic
926681604 2:15668218-15668240 ATGTGAGTTGCTTTGAAAGCAGG + Intergenic
931069550 2:58629327-58629349 ATGTGATGGGTTTGGGAAGCAGG + Intergenic
933632680 2:84674820-84674842 ATGTGATTTGTTTGGCAGAGAGG - Intronic
935660993 2:105466883-105466905 ATGTGATCTGTTTGGAAATAGGG + Intergenic
941715573 2:168759913-168759935 ATGTGTTTTGTTTGGCCCACAGG + Intronic
943754513 2:191544021-191544043 TTGTGATCTGTTTGTAAAGCTGG - Intergenic
1171348885 20:24487707-24487729 ATGTGATGTGTTTGTAACAGGGG + Intronic
1172504179 20:35449042-35449064 ATGGGATGTGTTAGGAATGCCGG - Intronic
1175156124 20:56972860-56972882 CTGTCATTTGCTTGGAAGGCAGG - Intergenic
1175481301 20:59313143-59313165 ATGTCATATGTTTGGGACACTGG + Intronic
1175636950 20:60592617-60592639 ATGTGCTTTCATTGGTACGCAGG + Intergenic
1176378484 21:6099754-6099776 ATGGGAGGTGTTTGGACCGCAGG - Intergenic
1176736643 21:10555031-10555053 ATGGGATTTGTATTGAAGGCAGG - Intronic
1177419718 21:20840662-20840684 ATGTGATTTGTATTGAAAGAAGG + Intergenic
1178012410 21:28303214-28303236 GTGTGACTTGTGTAGAACGCTGG + Intergenic
1178465087 21:32840742-32840764 ATGAGATTTGGTGGGGACGCAGG - Intergenic
1179744991 21:43438482-43438504 ATGGGAGGTGTTTGGACCGCAGG + Intergenic
1183532490 22:38367644-38367666 ATGGGATTTGTATTGAAGGCAGG + Intronic
1184443057 22:44530506-44530528 ATGAGACCTGCTTGGAACGCTGG + Intergenic
949243930 3:1903207-1903229 TTGTGATTTGTTTGGAAAGAGGG + Intergenic
950980848 3:17302967-17302989 CAGTGATTTATTTGGAAAGCTGG + Intronic
952007149 3:28855045-28855067 ATGTGATTGGGTTGGAATCCTGG + Intergenic
953350442 3:42211331-42211353 ATGTGATTTGTTTAGCACATAGG + Intronic
959177183 3:102928312-102928334 ATGTGATTTGTTTTGACCACTGG - Intergenic
960144553 3:114186762-114186784 ATGTAATTATTTTGGAACTCTGG - Intronic
962188888 3:133289524-133289546 ATGTCATTTCTTTGGCAAGCTGG + Intronic
962481178 3:135800100-135800122 ATTTCATTTGTCTGGAACCCAGG - Intergenic
966380119 3:179336483-179336505 ATGTGAGTTGCTAGGAACACAGG - Intergenic
967825910 3:193877219-193877241 TTGTGATATGTTTGGAAACCTGG - Intergenic
968672454 4:1859045-1859067 ATGTGATTTGTGAGGAACATAGG - Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
970013769 4:11489627-11489649 ATGTAATTTATTTGAAACCCAGG - Intergenic
972862637 4:43189904-43189926 ACGTGATGAGTTTGGAAAGCTGG - Intergenic
974228309 4:59078001-59078023 ATGTGACTTGTTTGGAAATGGGG - Intergenic
977112834 4:92981608-92981630 ATGTGATTTGTTGGTGATGCAGG - Intronic
978838267 4:113179332-113179354 ATGTGATATTTTTGGAAAGCTGG - Intronic
980525102 4:133979856-133979878 ATCTGATTTTTTTGGAAGACAGG - Intergenic
983078588 4:163356606-163356628 ATGTAATTTGTTTTAAAGGCAGG + Intergenic
985091572 4:186368124-186368146 CTTTGCTTAGTTTGGAACGCAGG + Intergenic
986970147 5:13324461-13324483 ATGTGATTTGTTTGACTCACTGG - Intergenic
988984128 5:36600284-36600306 ATGAGATTTGATTGGAACAAAGG + Intergenic
990311689 5:54545908-54545930 ATGTGATGTGTTTGTAACACAGG + Intronic
992097431 5:73376036-73376058 ATGTGAATGGTTTGGAACAGTGG - Intergenic
995103666 5:108348724-108348746 ATGTGAGTTGGTTGAAACGGGGG - Intronic
997317960 5:132953777-132953799 ATGTGGTGTGTTTTGAACGGTGG - Intronic
1000047176 5:157531324-157531346 ATGTGATTTATTTGGAAATAGGG + Intronic
1002401527 5:178994021-178994043 TTGAGTTTTGTTTGGAACCCGGG - Intronic
1004813143 6:19281879-19281901 ATTTCATTTGTTTGGATCGCAGG + Intergenic
1006586566 6:35118637-35118659 ATTTGTTTTGTTTGGAAAGGGGG + Intronic
1009272282 6:61628524-61628546 AAGTAATTGGTTTGGAACACAGG - Intergenic
1010823592 6:80446044-80446066 ATGAGATTTGTTTGGAAAAATGG + Intergenic
1016196665 6:141351825-141351847 ATGTTATTTGATTAGAACACTGG - Intergenic
1022557320 7:31311513-31311535 ATGGGATTCGTTTGGAAGACAGG + Intergenic
1022735399 7:33071137-33071159 ATGAGATTTGGTGGGAACACAGG - Intergenic
1037329436 8:17729685-17729707 ATGTGATTGCTTTTAAACGCAGG + Intronic
1038882119 8:31626363-31626385 ATGTTCTTTGTTTGGAATTCTGG + Intergenic
1042789316 8:72586032-72586054 ATGTCATTTTTTAGGAATGCTGG - Intronic
1044708044 8:95027164-95027186 ATGTTATTTGTGTGGAATGGGGG + Intronic
1046301808 8:112303667-112303689 ATGTGATTATCTTGGAACACAGG + Intronic
1046693722 8:117315226-117315248 ATGTGATTTGTTTTGACCAAAGG + Intergenic
1047173256 8:122515404-122515426 ATGTGATTTGTTTATAACTTCGG - Intergenic
1049309365 8:141925132-141925154 ATAAGGTTTGATTGGAACGCAGG + Intergenic
1051133048 9:13884128-13884150 ATGTAATTATTTTGGAACTCTGG + Intergenic
1052332003 9:27280294-27280316 ATGGCATTTCTTGGGAACGCAGG - Intergenic
1055720383 9:79166760-79166782 ATTTGATTTGTATGGTAGGCAGG + Intergenic
1057939896 9:99272738-99272760 TTGTGTTTTGTTTGTAACACTGG - Intergenic
1060673619 9:125492526-125492548 ATGTGATTTAATTGGAACTGAGG + Intronic
1186893222 X:13980612-13980634 ATATGTTTTGTTTGGAAAGTGGG - Intergenic
1188838747 X:34989486-34989508 ATTTGATTTGTTTTGTAAGCAGG - Intergenic
1202594910 Y:26528225-26528247 ATGGGATTTGTATTGAAGGCAGG - Intergenic