ID: 1152260382

View in Genome Browser
Species Human (GRCh38)
Location 17:79263567-79263589
Sequence GGGGTGGCTCACGATGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152260382_1152260384 -8 Left 1152260382 17:79263567-79263589 CCCAGCTCATCGTGAGCCACCCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1152260384 17:79263582-79263604 GCCACCCCCACCTGCTCTCTAGG 0: 1
1: 0
2: 4
3: 48
4: 402
1152260382_1152260394 15 Left 1152260382 17:79263567-79263589 CCCAGCTCATCGTGAGCCACCCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1152260394 17:79263605-79263627 GTGGCCAGGTCATATCCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1152260382_1152260392 1 Left 1152260382 17:79263567-79263589 CCCAGCTCATCGTGAGCCACCCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1152260392 17:79263591-79263613 ACCTGCTCTCTAGGGTGGCCAGG 0: 1
1: 0
2: 3
3: 10
4: 153
1152260382_1152260388 -4 Left 1152260382 17:79263567-79263589 CCCAGCTCATCGTGAGCCACCCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1152260388 17:79263586-79263608 CCCCCACCTGCTCTCTAGGGTGG 0: 1
1: 0
2: 5
3: 26
4: 222
1152260382_1152260386 -7 Left 1152260382 17:79263567-79263589 CCCAGCTCATCGTGAGCCACCCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1152260386 17:79263583-79263605 CCACCCCCACCTGCTCTCTAGGG 0: 1
1: 0
2: 3
3: 44
4: 298
1152260382_1152260396 19 Left 1152260382 17:79263567-79263589 CCCAGCTCATCGTGAGCCACCCC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1152260396 17:79263609-79263631 CCAGGTCATATCCACCTGGAAGG 0: 1
1: 1
2: 3
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152260382 Original CRISPR GGGGTGGCTCACGATGAGCT GGG (reversed) Intronic
900666141 1:3816807-3816829 GGCGTGGCTCAGGAAGAGCAGGG - Intronic
901131062 1:6962764-6962786 GGGGTGGGTCCAGAGGAGCTCGG - Intronic
901131111 1:6962913-6962935 GGGGTGGGTCCAGAGGAGCTCGG - Intronic
901740710 1:11339978-11340000 GGGGTGGCTCAGGCTGAGCCTGG - Intergenic
903539729 1:24090149-24090171 GGGGTGGCACAGGAGGAGTTAGG + Intronic
903796662 1:25934081-25934103 AGGGAGGCTCACTAGGAGCTTGG + Intergenic
906468911 1:46110410-46110432 GTGGTGGCTCAGGCTGAGCCTGG - Intronic
911574811 1:99562701-99562723 TGGGTGGATCACTTTGAGCTCGG - Intergenic
922569487 1:226625572-226625594 GGGATGGCCCACCCTGAGCTGGG - Intergenic
923982725 1:239343541-239343563 GTGGTGGCTCAGGCTGAGCCGGG - Intergenic
1077212017 11:1375477-1375499 GGGGTGCCCCAGGGTGAGCTGGG + Intergenic
1077920799 11:6640583-6640605 GGTGGGGCTCACCCTGAGCTGGG - Exonic
1089352010 11:117826921-117826943 GGGGTGGCTGGGGATGAGGTGGG + Intronic
1089530026 11:119121678-119121700 GAGGTGGCTCGGGAAGAGCTTGG - Intronic
1090488201 11:127133881-127133903 GGGCTGGGGCAAGATGAGCTTGG + Intergenic
1097486080 12:60203031-60203053 GGGCTGGCTTAAGATGACCTTGG - Intergenic
1118249971 14:64150133-64150155 GCGGTGGCTCAAAATTAGCTGGG + Intronic
1122266359 14:100548721-100548743 GGGGAGGCAGACAATGAGCTAGG + Intronic
1122965646 14:105123979-105124001 GGGGTGGCTGAAGGTCAGCTGGG - Intergenic
1123192848 14:106587405-106587427 GGGGTGACCCACGCTGTGCTGGG - Intergenic
1128145822 15:65332014-65332036 GCGGTGGCTCACCCTGGGCTTGG + Exonic
1128509228 15:68303246-68303268 GGGGGTGCTCAGAATGAGCTGGG - Intronic
1142743226 17:1942403-1942425 GGGGGGGCTCACTAGGAGATGGG + Intronic
1144789263 17:17848334-17848356 GGAGTGGGGCAAGATGAGCTTGG + Intronic
1147945930 17:44080233-44080255 GGGATGGCTCAAGCTGAGCCCGG + Intronic
1149524521 17:57344456-57344478 GGGGAGACACAAGATGAGCTTGG - Intronic
1152260382 17:79263567-79263589 GGGGTGGCTCACGATGAGCTGGG - Intronic
1152519422 17:80846511-80846533 GGTGTGGCTCACCATGGGCGTGG + Exonic
1156328195 18:36093573-36093595 GGGGTGGCTCAGGAGCAGCACGG + Intergenic
1157914470 18:51651370-51651392 GGGCTGGCATACAATGAGCTAGG + Intergenic
1158757661 18:60346217-60346239 GTGCTGGCTCAGGGTGAGCTAGG - Intergenic
1161071435 19:2263740-2263762 GGGCAGCCTCAGGATGAGCTGGG - Intronic
1161074476 19:2278710-2278732 GGGGTGGCCCCCCATGAGCCGGG + Exonic
1161694366 19:5757838-5757860 GGGGTTGCTCACCATCACCTGGG - Exonic
1162503649 19:11069359-11069381 TGGGTGGATCAGGAGGAGCTGGG - Intergenic
1162938121 19:13992004-13992026 GGGGTGGGTCAAGATGGGATTGG - Intronic
1165496226 19:36153356-36153378 TGCGTGGCTCACGATGAGGCCGG - Intergenic
1166247846 19:41542894-41542916 GGGGTGGCTCACCGTGAGGGAGG + Intergenic
932416204 2:71575197-71575219 GGGGTGGCTCAGGATCTGTTGGG + Intronic
938042774 2:128090109-128090131 GCGGTGGCTCACGCTGAGGATGG - Intergenic
947621944 2:231596414-231596436 GGGGTGGCTATCGAGCAGCTGGG + Intergenic
1173166117 20:40688384-40688406 GGCGTGGCCCACGACGAGCTGGG - Exonic
1173263140 20:41454022-41454044 GGGGTGCCTCACAGTGGGCTGGG + Intronic
1176179126 20:63741356-63741378 GGGGTGGCTCTGGAGGAGATGGG - Exonic
1182704893 22:32270947-32270969 AGCGGGGCTCACGATGAGCTAGG + Intergenic
952152494 3:30607396-30607418 CGGGTGGCTCAGAAAGAGCTGGG - Intronic
952975065 3:38686895-38686917 GTTGTGGCTCACGATTAGATAGG + Intergenic
953075280 3:39564421-39564443 GGGGTGGCCCATGATGGACTGGG - Intergenic
954130597 3:48558790-48558812 TGGGCGGCTCCTGATGAGCTGGG + Intronic
962327473 3:134447770-134447792 GGGCTGTCTCAGGATGTGCTTGG + Intergenic
963975926 3:151480724-151480746 GGGGTGGCTCTGCAGGAGCTTGG - Intergenic
964646052 3:158959565-158959587 GGGATGGCTCAAGAAGAGCCTGG - Intergenic
978426498 4:108588266-108588288 CGGGTGGCTCACGTGAAGCTAGG + Intergenic
981386797 4:144141146-144141168 TGTGTGGCTCACCATGAGTTTGG - Intergenic
987642947 5:20634521-20634543 GGGGTGGCACCAGGTGAGCTGGG - Intergenic
997423237 5:133785719-133785741 GGTGTGGCTCAGGGTGAGGTTGG + Intergenic
998922188 5:147081743-147081765 GGGGTGGCTCACACAGAGTTTGG + Intronic
1000045710 5:157520302-157520324 CTGGAGTCTCACGATGAGCTTGG - Intronic
1004485082 6:16058746-16058768 GGGATGGCTCACCAGGAGCAAGG - Intergenic
1005989567 6:30894583-30894605 GGGGTGGCTCTCTAGGACCTGGG - Exonic
1007607177 6:43125413-43125435 GGGGTGGCCGAGGCTGAGCTGGG + Intronic
1011616251 6:89200903-89200925 AGGATGGCTCACGATGAGGGAGG - Intronic
1012851216 6:104447862-104447884 GTGGTGGCCCACGATCAGTTTGG + Intergenic
1013101660 6:106992277-106992299 GGGGTGGTACAGGAAGAGCTGGG - Intergenic
1014798260 6:125749479-125749501 GGCGTGGCTCGCGATTGGCTGGG - Intronic
1017803505 6:157921877-157921899 GGGTTGGCTCAAGATGGGCAGGG + Intronic
1018116457 6:160590598-160590620 GGAAAGGCTCATGATGAGCTTGG + Intronic
1024632795 7:51263129-51263151 CGGGTGGCTTCCGGTGAGCTGGG - Intronic
1026971953 7:74473838-74473860 GCAGTGGCTCACGCCGAGCTGGG + Intronic
1028019039 7:85748431-85748453 GGGGTGGTTCAATATGTGCTAGG + Intergenic
1029642435 7:101829614-101829636 GGGGCCGCCCAAGATGAGCTTGG + Intronic
1032080747 7:128857295-128857317 GGGGCTGCCCACGATGTGCTGGG - Exonic
1032091507 7:128913865-128913887 GGGGCTGCCCACGATGTGCTGGG + Intergenic
1032194790 7:129782360-129782382 GAGGTGGCTCAGGACGACCTGGG + Intergenic
1035301928 7:157902903-157902925 GGAGAGGCTCACAATCAGCTTGG - Intronic
1037211861 8:16398644-16398666 GGGGTTGCCCAGGGTGAGCTGGG - Intronic
1038157136 8:25001045-25001067 GGGGTTGCTCCCGAGGAGCAAGG - Intergenic
1039872619 8:41559594-41559616 GGAGTGGGTCATGATGACCTGGG + Intergenic
1040413446 8:47177883-47177905 TGGGTGTCTCAGCATGAGCTAGG - Intergenic
1048138553 8:131770527-131770549 TGGGGGCCTCACGATGGGCTTGG - Intergenic
1049222576 8:141434707-141434729 GGGGTGGATGAGGAGGAGCTTGG - Intergenic
1049253960 8:141604183-141604205 GGGCTGGGTCTCGATGAGCGAGG + Intergenic
1049720312 8:144112543-144112565 GGAGTGGCTCTCCAGGAGCTGGG - Intronic
1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG + Intronic
1050011458 9:1189363-1189385 GGGGTGGTTCAGGTTGAGTTCGG - Intergenic
1053342956 9:37354117-37354139 GGGGTGTCTCACAATTACCTAGG + Intronic
1057146480 9:92762800-92762822 GGAGCGGCTCACGATGCACTTGG + Intronic
1059308367 9:113372100-113372122 GGGGTGGCTTTAGATGAGCAGGG - Intergenic
1059430989 9:114250280-114250302 GGGGTGGCTTAAGCTGAGCTGGG - Intronic
1060515456 9:124262936-124262958 GGGGTGGGTCATGTTGACCTGGG + Intronic
1060737646 9:126076640-126076662 GGGATGGCTCAGGGAGAGCTAGG + Intergenic
1061397530 9:130351567-130351589 GTGGGGGCTCACCATGAACTCGG - Intronic
1061646448 9:132006219-132006241 AGGCTGGCTCACCCTGAGCTTGG - Intronic
1062264059 9:135678783-135678805 AGGGTGGCCCACCAGGAGCTGGG - Intergenic
1185450603 X:279030-279052 GGGGTGGCTCAATAGGAGTTGGG + Intronic
1185982902 X:4799054-4799076 GGGGTGGTTGAAGATGAGTTCGG - Intergenic
1189214133 X:39308871-39308893 GGGGTGGCCCACTATGATGTGGG - Intergenic
1190650274 X:52562839-52562861 GGGGTCCCTCACGGTGAGCCTGG + Intergenic