ID: 1152261352

View in Genome Browser
Species Human (GRCh38)
Location 17:79268966-79268988
Sequence TAGGTAGACATGAATTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 4, 2: 30, 3: 111, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152261352_1152261360 10 Left 1152261352 17:79268966-79268988 CCCCCCAAATTCATGTCTACCTA 0: 1
1: 4
2: 30
3: 111
4: 414
Right 1152261360 17:79268999-79269021 ATGTGACCTCATTTGGAAATAGG 0: 27
1: 518
2: 1309
3: 1883
4: 2769
1152261352_1152261359 3 Left 1152261352 17:79268966-79268988 CCCCCCAAATTCATGTCTACCTA 0: 1
1: 4
2: 30
3: 111
4: 414
Right 1152261359 17:79268992-79269014 CCTCAGAATGTGACCTCATTTGG 0: 22
1: 427
2: 1018
3: 2073
4: 3027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152261352 Original CRISPR TAGGTAGACATGAATTTGGG GGG (reversed) Intronic
900281986 1:1875843-1875865 CAGGTAGACATGAATTTTGGGGG - Intronic
900913703 1:5619924-5619946 TCGGTGGACATGAATTTGAGAGG + Intergenic
900987524 1:6081849-6081871 TAAGTAGACATGAATTCTGTGGG + Intronic
900999347 1:6140652-6140674 TGGGTGGACATGAATGTTGGGGG - Intronic
901442485 1:9286995-9287017 CAGGTGGACATGAATTTTGGGGG + Intergenic
901855554 1:12042122-12042144 TAGGTGGACATATCTTTGGGGGG - Intergenic
902174359 1:14638212-14638234 CCTGTAGACATGAATTTGGGGGG + Intronic
902643500 1:17781671-17781693 GGGGTAGACATGAATTTTGGGGG + Intronic
905054963 1:35085423-35085445 TAGGCAGAAATGACTTTGGCAGG + Intronic
905510817 1:38518280-38518302 GAGGTGGACATGAATTTTGGAGG + Intergenic
906955733 1:50372157-50372179 CAGGGAGACATAAATTTCGGAGG + Intergenic
907585605 1:55615270-55615292 CAGGTGGACATGAATTTTGTGGG - Intergenic
907830173 1:58057311-58057333 TGGGTAGACATGAATTTTAAGGG - Intronic
907901395 1:58744527-58744549 TAGTTGGACAGGAATTAGGGTGG + Intergenic
907963078 1:59301037-59301059 AATGTATACATTAATTTGGGGGG + Intronic
910469867 1:87540293-87540315 GAGAAAGACATGAATTTTGGGGG + Intergenic
911202600 1:95060841-95060863 CAGGTGGACATGAATTTTAGGGG - Intronic
912141938 1:106740741-106740763 TAGATAGAAATGAATTTGACTGG - Intergenic
912763999 1:112392526-112392548 TGGGTGCACATGAATTTTGGGGG - Intergenic
913210733 1:116580252-116580274 CAGGTGGACATGCATTTTGGAGG - Intronic
913461702 1:119093385-119093407 TAGGTAGACATGAATTTTGGAGG - Intronic
914920273 1:151842126-151842148 TAGGTGGACATGGATTTGAATGG - Intergenic
915010521 1:152681689-152681711 TAGGTAGACCTGAATTGGCTAGG + Intergenic
916921577 1:169473808-169473830 TAGATAGTCATGTATTTGTGAGG - Intronic
918162698 1:181915977-181915999 TAGGTAGACATATATTTTAGGGG + Intergenic
919088987 1:192955832-192955854 TGGGTGGACATGAATTTTGGGGG - Intergenic
919095506 1:193029988-193030010 TAGGTAGAAATGAGTCTAGGAGG - Intronic
920961961 1:210671449-210671471 CAGGTACACATGAATTTGCAGGG - Intronic
921000180 1:211036169-211036191 TGGGTAAACAGGAATTAGGGAGG + Intronic
921314947 1:213881680-213881702 GAGAAGGACATGAATTTGGGTGG + Intergenic
922343032 1:224672732-224672754 CAGGTAGATATGAATTTTGGAGG + Intronic
924334303 1:242971828-242971850 TAGGTGAACAGGAATTAGGGAGG - Intergenic
924744892 1:246822586-246822608 TAGATGGACGTGAATTTTGGGGG + Intergenic
1063305223 10:4892436-4892458 TGGGTAAACATGAATTTTAGAGG - Intergenic
1063652457 10:7951589-7951611 GAGGTGGACATGATTTTGGGTGG - Intronic
1063985709 10:11499459-11499481 TTGGTGGACATGAGTTTTGGAGG - Intronic
1064785745 10:18892522-18892544 TAGGCTGACATAAATTTTGGGGG - Intergenic
1065372562 10:25003724-25003746 TAGGTAAACATGCATTACGGGGG + Intronic
1066315737 10:34244827-34244849 AATGTACACATGAATTTGGAGGG + Intronic
1066386788 10:34948069-34948091 TAGATGGACATGAATTTTGGGGG - Intergenic
1067396655 10:45926058-45926080 CAGGTGAACATTAATTTGGGGGG + Intergenic
1067864970 10:49895161-49895183 CAGGTGAACATTAATTTGGGGGG + Intronic
1068096201 10:52494430-52494452 TAGGTAGACATATCTTTTGGGGG + Intergenic
1068097659 10:52512005-52512027 TGGGAAGACAGGAATTAGGGAGG + Intergenic
1069404273 10:68081577-68081599 CAGATGGACATGAATTTTGGGGG + Intergenic
1069555436 10:69394719-69394741 CAGGTAGACATGAATGCTGGTGG + Intronic
1069730645 10:70609782-70609804 CAGAAGGACATGAATTTGGGGGG + Intergenic
1069840444 10:71336312-71336334 TGGGTAGACATGAATTTTGGGGG + Intronic
1069951470 10:72021462-72021484 TAGGAAAACAGGAATTAGGGAGG + Intergenic
1070370768 10:75779832-75779854 CAGGTAGACATAAATTTGTAGGG - Intronic
1072058135 10:91781375-91781397 CAGGTGGATATGAATTTGGGAGG + Intergenic
1072242953 10:93514271-93514293 CAAGTGGACATGAATTTTGGGGG + Intronic
1072836657 10:98722125-98722147 CTGGTAGACATAAATTTTGGGGG - Intronic
1074290282 10:112133159-112133181 TGGGAAGACATGAATTTGTGGGG + Intergenic
1074670478 10:115784878-115784900 TGGGTGGACATGAATTTTGGAGG + Intronic
1074689315 10:115990121-115990143 TAGGTAGAAACAAATTTTGGGGG + Intergenic
1074713504 10:116197659-116197681 CAGGTGGACATGAATTTTGTGGG + Intronic
1074876566 10:117618172-117618194 TGCGTGGACATGAATTTGGGGGG - Intergenic
1075160962 10:120024234-120024256 TACTTCGACATGAATTTTGGAGG + Intergenic
1075483564 10:122801846-122801868 TGGAGAGACATGAATCTGGGTGG - Intergenic
1075621957 10:123934594-123934616 CAAGTGGACATGAATTTGGTGGG + Intronic
1075830604 10:125407752-125407774 TAGTGAGACATGAACTGGGGTGG - Intergenic
1076382566 10:130035427-130035449 TATCGATACATGAATTTGGGGGG + Intergenic
1076484243 10:130805600-130805622 TAGATAGACATGAATTTTGGGGG - Intergenic
1077336552 11:2007530-2007552 TGGGTGGACATGAATTTCCGGGG + Intergenic
1077336561 11:2007567-2007589 TGGGTGGACATGAATTTCCGGGG + Intergenic
1078437240 11:11335546-11335568 TGGGTAGACATGAATTTTAGAGG - Intronic
1078520792 11:12061421-12061443 TGGGTGGACTTGAATTTTGGGGG - Intergenic
1079602239 11:22323926-22323948 TGGGTGAACATGAATTTTGGGGG - Intergenic
1079958219 11:26890016-26890038 TATGAGGACATGCATTTGGGAGG + Intergenic
1080087345 11:28300113-28300135 TACGTAGACATGAATTGTGGGGG + Intronic
1080188154 11:29516832-29516854 TAGGTACACAGGAATATAGGTGG - Intergenic
1080208857 11:29761868-29761890 CAGGTGGATATGAATTTTGGAGG - Intergenic
1081109051 11:39109123-39109145 CAGATAGACACGAATTTGGAGGG + Intergenic
1082762210 11:57138328-57138350 TGGGTAGACATGAACTTCTGCGG + Intergenic
1083471560 11:62887722-62887744 TAGCCAGACATGAGTTGGGGAGG + Intronic
1083700698 11:64475918-64475940 TGGGTGGACACGAATTTGTGGGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084447668 11:69213093-69213115 CAGGGGGACATGAATTTTGGCGG - Intergenic
1084715322 11:70869967-70869989 TGGGTGGACATGGATTTGGGGGG - Intronic
1084727590 11:70952025-70952047 TAGATAGACATGAATTTACGGGG + Intronic
1086018168 11:82192527-82192549 TAGGCAGACAAGAATTTGAAGGG + Intergenic
1087019076 11:93584466-93584488 TAGTAACATATGAATTTGGGGGG - Intergenic
1087901067 11:103641743-103641765 CAGGTGGACATGAATTTTGGGGG - Intergenic
1088426088 11:109705024-109705046 TAGGCAGAAATGCATTTTGGAGG + Intergenic
1088598256 11:111455650-111455672 TAGGGAGACATGAAATGGGGAGG + Intronic
1088722212 11:112604038-112604060 TATGTAGACAGGGATGTGGGAGG + Intergenic
1089172009 11:116518641-116518663 CAAGCAAACATGAATTTGGGTGG + Intergenic
1089590272 11:119535715-119535737 TGGGTAGTCATGAACTTGGCTGG - Intergenic
1089766449 11:120770686-120770708 TAAGTATACATGAGTTTGGCAGG - Intronic
1090616383 11:128519336-128519358 TTGGCACTCATGAATTTGGGAGG + Intronic
1202819536 11_KI270721v1_random:62712-62734 TGGGTGGACATGAATTTCCGGGG + Intergenic
1202819545 11_KI270721v1_random:62749-62771 TGGGTGGACATGAATTTCCGGGG + Intergenic
1091690348 12:2592080-2592102 TAGGTAGGCATGAGTTTGCGGGG + Intronic
1092874210 12:12834020-12834042 TGGGTAGACATGACTTTTCGTGG + Intergenic
1093503544 12:19838427-19838449 TGGGTAGACGTTAATTTTGGAGG + Intergenic
1095290368 12:40472711-40472733 AAGGAAGACATGAATTTGGGTGG + Intronic
1095409100 12:41902829-41902851 TGGGTAGACATGAATCTTGAGGG + Intergenic
1097350026 12:58538625-58538647 CAGGTAGGCATGAATTTTGGGGG - Intergenic
1098204333 12:68092074-68092096 TAGCAAGACATGAAGTTGGCTGG - Intergenic
1098400227 12:70066979-70067001 GAGAAGGACATGAATTTGGGGGG + Intergenic
1098818118 12:75194135-75194157 GGGGTAGACATGAATTTTGAGGG - Intronic
1099467999 12:83010466-83010488 CAGGTAAACAGGAATGTGGGAGG - Intronic
1100616801 12:96237164-96237186 TTGGTGGACATGAATTTGGCAGG + Intronic
1100795735 12:98179908-98179930 CAGGTGGACATGAATTTTAGTGG + Intergenic
1100825760 12:98472870-98472892 CAGGTAGACATGAATTATTGGGG - Intergenic
1101405630 12:104426233-104426255 CAGGTTGATGTGAATTTGGGGGG - Intergenic
1101448086 12:104752409-104752431 TGGGTGGACATGAATTTGGGAGG + Intronic
1101479327 12:105082324-105082346 TAGGCATAAAGGAATTTGGGCGG - Intronic
1102217040 12:111169013-111169035 TAGGTGGACATGAATTTTGGCGG - Intronic
1102231566 12:111266042-111266064 TACGTAGACATAAATTTTGGAGG - Intronic
1102417809 12:112779731-112779753 TGGGTAGACATGGATTTTAGGGG - Intronic
1102875299 12:116444284-116444306 TGCGTGGACATGAATTTGGGGGG - Intergenic
1102878915 12:116469182-116469204 TGGGTGGACATGAATTTTAGGGG - Intergenic
1103998221 12:124843588-124843610 TAGGTGGGCATGAATTTGGCAGG - Intronic
1104471946 12:129036463-129036485 TGGGTGGACATGACTTTCGGGGG - Intergenic
1104723186 12:131057760-131057782 TGGGGAGACATGAATTTTGTGGG + Intronic
1105263434 13:18796604-18796626 GAGAAAGACATGAATTTTGGGGG - Intergenic
1105418793 13:20234928-20234950 GAGAAAGGCATGAATTTGGGGGG - Intergenic
1105443280 13:20432656-20432678 TGGGAAGACATGATTCTGGGGGG - Intronic
1107908898 13:45086820-45086842 TGGGTAAATATGAATTTTGGAGG + Intergenic
1109415520 13:62034413-62034435 TACGTAGACAATATTTTGGGGGG + Intergenic
1109428846 13:62205320-62205342 TAGGAAAACAGGAATTAGGGAGG + Intergenic
1109437703 13:62327844-62327866 TAGGTAGACTTGAATCGTGGGGG - Intergenic
1111162877 13:84418857-84418879 TAGTTAGACATCAAGTAGGGTGG + Intergenic
1111428275 13:88118667-88118689 TAGGTGGGCATGCATTTGTGTGG + Intergenic
1111456655 13:88493177-88493199 CAGGTAAACAGGAATTAGGGAGG - Intergenic
1111676122 13:91390985-91391007 TGGGTGGACATGAATTTTGAGGG + Intergenic
1111775347 13:92654783-92654805 CAGGTAGAAATGAAATTTGGGGG - Intronic
1112838805 13:103549985-103550007 CAGGTGGATATGAATTTTGGGGG + Intergenic
1113507907 13:110829968-110829990 TGGGTAGAGATGGATTTGGCAGG - Intergenic
1115392520 14:32869144-32869166 TAATTTGACAAGAATTTGGGGGG + Intergenic
1117757123 14:58986936-58986958 GGGGTAGACATGAATTTTGTGGG + Intergenic
1117965906 14:61206523-61206545 CAGGTAGATATGAATTTTAGGGG + Intronic
1118700483 14:68427801-68427823 GAGAAGGACATGAATTTGGGGGG + Intronic
1119128433 14:72150034-72150056 CAGGTAGACGTGAATTTGGGAGG - Intronic
1119486682 14:74993741-74993763 AAGAAAGAAATGAATTTGGGTGG + Intergenic
1120144292 14:80962594-80962616 CAGGTAGATATGAATTTTGGGGG + Intronic
1120876977 14:89384002-89384024 CAGGTGGACATGAATTTGGTGGG + Intronic
1120885719 14:89450366-89450388 CAAGCAGACATGAATTTTGGGGG + Intronic
1121375576 14:93407224-93407246 TTGGTAGACATACATTTTGGGGG + Intronic
1121814116 14:96915960-96915982 TGGGTGGACATGAATTTTGGGGG + Intronic
1121833461 14:97071686-97071708 TGGGTGGACATGAATTAGGGTGG - Intergenic
1122016283 14:98799505-98799527 GAGAAGGACATGAATTTGGGGGG + Intergenic
1122121784 14:99558269-99558291 TGGGCGGACATGAATTTGGAAGG - Intronic
1122595016 14:102884391-102884413 CAGATAGACATGAATTTTGGAGG + Intronic
1124010193 15:25831912-25831934 CAGATGGACATGAATTTTGGGGG - Intronic
1124201249 15:27680145-27680167 TTGGAAGACATGCTTTTGGGAGG - Intergenic
1124969108 15:34467488-34467510 CAAGTAGAAATGAATTTTGGGGG - Intergenic
1126188116 15:45850450-45850472 CAGGTAAACAGGAATTAGGGAGG - Intergenic
1126487674 15:49200375-49200397 CAAGTAGATATGAATTTGGGGGG - Intronic
1126757328 15:51937285-51937307 TGGGTAGACATGGATTCGGCGGG - Intronic
1127043513 15:55002414-55002436 TAAGAGGACATGAGTTTGGGAGG - Intergenic
1127862636 15:63007111-63007133 AGGGTGGACATGAGTTTGGGGGG - Intergenic
1128230905 15:66034359-66034381 TCAGAAGACATGAATTTTGGGGG + Intronic
1129063359 15:72880105-72880127 CAGATAAACATGAATTTCGGAGG - Intergenic
1129505704 15:76079808-76079830 TAGGTAGATATGATTTAGGGCGG + Intronic
1129690127 15:77708474-77708496 CAGATGGACATGAATTTGGGGGG - Intronic
1129775919 15:78236428-78236450 TGGGTAGACATGAATTTGCTGGG + Intronic
1130073672 15:80670654-80670676 TGGGTGGACATGAATTTTGTTGG - Intergenic
1130697492 15:86145207-86145229 TGGGTGGACATGAATTTTTGGGG + Intronic
1130717430 15:86348860-86348882 TGAATGGACATGAATTTGGGTGG - Intronic
1130964689 15:88688267-88688289 TCAGTAGACGTGAATTTTGGGGG + Intergenic
1131453478 15:92565167-92565189 GAGAAGGACATGAATTTGGGGGG - Intergenic
1131537684 15:93251480-93251502 CGAGTAGACATGAATTGGGGTGG - Intergenic
1131552499 15:93369626-93369648 TGGGTAGACATGAATTTTGGGGG + Intergenic
1131702767 15:94957293-94957315 TGGGTATACATGAGTTTGGTGGG - Intergenic
1132017951 15:98335725-98335747 TAGGAAAACAGGAATTAGGGAGG - Intergenic
1132661843 16:1065156-1065178 TGGGCGGACATGAATTTTGGGGG + Intergenic
1133336455 16:5009684-5009706 TGGCTGGACATGAATTTTGGGGG + Intronic
1133623017 16:7544355-7544377 CAAGTGGACATAAATTTGGGGGG - Intronic
1133689846 16:8202748-8202770 CAGGTGGACATGAATTTTGAGGG + Intergenic
1133758314 16:8778909-8778931 CAGGTAAACATGAATTTAGGGGG + Intronic
1134251578 16:12577968-12577990 TAGGCAGGCATGAGTTTTGGGGG - Intergenic
1134362181 16:13541906-13541928 TGGCTGGACATGAATTTGAGGGG - Intergenic
1134772442 16:16821385-16821407 TAGGAAAATATGAATTAGGGAGG + Intergenic
1134888007 16:17811484-17811506 TAGGAAAACAAGAATTGGGGAGG + Intergenic
1135377250 16:21958072-21958094 TGGCTGGACATAAATTTGGGGGG + Intronic
1135738401 16:24952625-24952647 CAGGTAGAAAGGAATTTGGTGGG + Intronic
1135754287 16:25083596-25083618 TGAGAGGACATGAATTTGGGGGG + Intergenic
1137309353 16:47238898-47238920 TTCCAAGACATGAATTTGGGGGG - Intronic
1138613804 16:58148361-58148383 TGGGTGGACATGAATTTTGGGGG + Intergenic
1138752255 16:59438137-59438159 CAGGTAGGCATGAATTTGGGGGG - Intergenic
1140144384 16:72291449-72291471 TGGGTGGACAAGAATTTTGGGGG + Intergenic
1140522850 16:75597121-75597143 CAGGTAGACATGAAGTTTTGGGG - Intronic
1140636356 16:76919320-76919342 TGGGTAGACATGCATTTTTGGGG + Intergenic
1140662823 16:77204298-77204320 CTGGTGGACATGAATTTTGGAGG - Intronic
1140715846 16:77724672-77724694 GGGGTAGACATGAATTTCAGGGG + Intronic
1140821918 16:78670602-78670624 CAGATAGACACGAATTTGGGGGG - Intronic
1141055639 16:80811203-80811225 TGGGTGGACATGAATTTTGCGGG - Intergenic
1141227110 16:82128369-82128391 TATGTTGTCATTAATTTGGGGGG + Intergenic
1141437965 16:84011581-84011603 CAGGTAGACATGAATTTTGGGGG - Intronic
1141598972 16:85113939-85113961 CAGGGAGACATACATTTGGGGGG - Intergenic
1141666591 16:85468852-85468874 CTGGTAGACGTGAATTTTGGGGG - Intergenic
1141671558 16:85494730-85494752 TGGGTGGATATAAATTTGGGGGG + Intergenic
1143632816 17:8148566-8148588 TGGCCAGACATGAATTTGGGAGG - Intronic
1144195351 17:12889614-12889636 TGTGAAGACATGAATTTTGGGGG - Intronic
1146083818 17:29808606-29808628 TAGTTAGACATCAACTTGGGTGG - Intronic
1146319994 17:31839602-31839624 GAAGTAGACATAATTTTGGGAGG - Intergenic
1146358858 17:32158349-32158371 AGGGTAGACATGAGTCTGGGTGG + Intronic
1147347801 17:39814474-39814496 CAGGAGGACATGAATTTAGGAGG - Intronic
1149531009 17:57395294-57395316 TAGATGGACACGAATTTTGGAGG + Intronic
1150476990 17:65483180-65483202 TAGATGGACATGAACTTTGGTGG + Intergenic
1151222784 17:72625597-72625619 CAGGTGGACATGGATTTTGGTGG + Intergenic
1151243601 17:72777360-72777382 TGAGTAGACATGGATTTTGGGGG - Intronic
1151263928 17:72939131-72939153 TGGCTAGACATGAATTTTGGCGG - Intronic
1151363296 17:73601383-73601405 TGGGTGGACATGAATTTGGGGGG - Intronic
1151944261 17:77310964-77310986 TTGGTGGACATGAGTTTGTGGGG - Intronic
1152108702 17:78345131-78345153 CATGCAGACATGAATTTGGTGGG - Intergenic
1152261352 17:79268966-79268988 TAGGTAGACATGAATTTGGGGGG - Intronic
1153076615 18:1168879-1168901 TAGGAAGACGTGAACTTTGGAGG - Intergenic
1153590207 18:6665763-6665785 TTGGAAGATATGTATTTGGGGGG + Intergenic
1153769777 18:8406001-8406023 TGGGAAGACATCAATCTGGGAGG - Intronic
1155072212 18:22326584-22326606 TAGGTGGACATGAATTTTGGAGG - Intergenic
1155327926 18:24684234-24684256 GAAGTAGAAATGAATTTTGGTGG + Intergenic
1155544481 18:26901416-26901438 CAGGTAGTCATGAATTTGCCAGG - Intergenic
1155738456 18:29254851-29254873 TAAGTTGACATGAATTTTGGAGG - Intergenic
1156254920 18:35385771-35385793 TAGGTGGACACAAATTTTGGGGG + Intergenic
1156722396 18:40085957-40085979 TAGGTGGACATGAATTTTCCAGG - Intergenic
1156921245 18:42524766-42524788 TGCATAGACATGAATTTTGGGGG + Intergenic
1157085552 18:44577022-44577044 CAGGTAAACATGAATTTTGGAGG + Intergenic
1157634362 18:49135601-49135623 TAGGTACAGATGTATTTAGGAGG + Intronic
1158599225 18:58842792-58842814 CAAGAAGATATGAATTTGGGAGG + Intergenic
1158799573 18:60890438-60890460 TGAGTAGACATGAATTTGGTGGG + Intergenic
1158802559 18:60929903-60929925 TGGGTGGACATGAATTTTGGAGG - Intergenic
1159004634 18:63001497-63001519 TAGGTAGACATGAACTTTTTGGG + Intergenic
1159812531 18:73033348-73033370 TAGTTAGTCTTGAATTTTGGTGG - Intergenic
1159881053 18:73858965-73858987 TGGGTGGACATGAATTTTGGGGG - Intergenic
1160345507 18:78128857-78128879 TGGGTGGGCATGAATTTTGGGGG - Intergenic
1160411608 18:78678786-78678808 CAGGTGGACCTGAATTTGGAGGG + Intergenic
1160904083 19:1444345-1444367 TAGGTCCACAAGAATTTGGGGGG + Intergenic
1161228694 19:3161323-3161345 CAGGTGGACATGAATTTTGGGGG + Intronic
1161341567 19:3745941-3745963 CAGGTAGGCATGAATTTGAGGGG + Intronic
1161692016 19:5741241-5741263 CAGGTTGACATAAATTTTGGGGG - Intronic
1161757296 19:6143542-6143564 TGGGTGGACATGAATTTTGGAGG + Intronic
1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG + Intronic
1163538899 19:17894790-17894812 TGGGTAGACATAAATTTTGGGGG - Exonic
1166702270 19:44888959-44888981 TTGGTAGGCAGGAATTGGGGTGG - Exonic
1168503802 19:56916010-56916032 TGAGTGGACATGAATTTCGGGGG + Intergenic
925665984 2:6256874-6256896 CTGGTGGACATGAATTTTGGGGG - Intergenic
925936273 2:8764744-8764766 GAGGAAGGCATGAATTGGGGAGG - Intronic
928088549 2:28360373-28360395 TAGGGTGGCATGAGTTTGGGGGG + Intergenic
928205328 2:29279610-29279632 TAGGGAAACCTGAATCTGGGTGG - Intronic
928697306 2:33862181-33862203 CAGGTGGACATAAATTTTGGAGG + Intergenic
929343266 2:40849123-40849145 TAGTTATACATGAATATGGGAGG - Intergenic
931496625 2:62814050-62814072 GAGAAAGACATGAATTTTGGGGG + Intronic
932326193 2:70863471-70863493 TGGGTGGACATGAATTTGGAGGG + Intergenic
932916385 2:75863590-75863612 TAAATATACATGAATGTGGGTGG + Intergenic
933456070 2:82521003-82521025 TAGGTAGACAGTCATCTGGGAGG - Intergenic
933496162 2:83052965-83052987 GAGGAAGACACGAATTTTGGTGG - Intergenic
933575759 2:84065424-84065446 TAGGAAGACAAGATTTTGTGGGG + Intergenic
934135377 2:88991489-88991511 TGGGAAAACAGGAATTTGGGAGG - Intergenic
934234926 2:90222265-90222287 TGGGAAAACAGGAATTTGGGGGG + Intergenic
936707837 2:115097223-115097245 TAAGTGGAAATAAATTTGGGGGG - Intronic
936968225 2:118148140-118148162 TGGGTGGACATGAATTTTGGAGG + Intergenic
937690940 2:124754367-124754389 TAGGCAGACAGGAATTAGGAAGG + Intronic
938624361 2:133092104-133092126 TAGGTAGACATGAATTTTACAGG - Intronic
939792346 2:146593585-146593607 TAGGTAGTCATACATTTTGGTGG + Intergenic
941018460 2:160383438-160383460 TGGTTAGACATGAATTGGGGGGG + Intronic
941149598 2:161897331-161897353 TAAGTACACAACAATTTGGGAGG - Intronic
942842416 2:180378874-180378896 TAGGTAGGCATAAAGTTTGGGGG + Intergenic
942861964 2:180624894-180624916 TAGGCAGACAAGAAATTGGAAGG + Intergenic
943085589 2:183307049-183307071 TAGGTAGATATGAATAAGGCAGG + Intergenic
943325609 2:186493944-186493966 CAGGTGGACTTGAATTTTGGGGG + Intronic
943390470 2:187260909-187260931 TAGGTAAACATGAACTATGGTGG - Intergenic
943848946 2:192691006-192691028 TGGATAGACATGAATTTGTAGGG - Intergenic
944304984 2:198169102-198169124 CAGGTGGCCATGAATTTGGGTGG + Intronic
944472826 2:200073143-200073165 CAGGTGGACATGAATTTTTGAGG + Intergenic
944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG + Intergenic
944677727 2:202048227-202048249 TAGAAGGACATGAATTTTGGGGG - Intergenic
948320830 2:237067687-237067709 CAGGTGAGCATGAATTTGGGGGG + Intergenic
1169793018 20:9431399-9431421 TAGGTAGACAGGAGTTTTGGTGG + Intronic
1170142273 20:13136749-13136771 TAGGGAGAGAGGAATTTGGCAGG + Intronic
1170388338 20:15845102-15845124 TCAGTAGACATGAATTTAGGGGG - Intronic
1172976427 20:38909429-38909451 CAGGTAGACATGAATTTTTGAGG + Intronic
1173064958 20:39701875-39701897 AAGGATGACATGAATTTGGAAGG + Intergenic
1173292711 20:41728537-41728559 GAGGACGACATGAATTTTGGAGG + Intergenic
1173572184 20:44084544-44084566 TGGGCAGATATGAATTTTGGGGG - Intergenic
1174459835 20:50674516-50674538 TGGGTGGACATGAATTTTGGGGG - Intronic
1175119623 20:56708062-56708084 CTGGTGGACATGAATTTTGGAGG + Intergenic
1175323956 20:58109828-58109850 GAGAAGGACATGAATTTGGGGGG + Intergenic
1175761399 20:61564232-61564254 CTGGTGGACGTGAATTTGGGAGG + Intronic
1176069452 20:63218504-63218526 CAGGTGGACATGAGTTTTGGGGG + Intergenic
1176114464 20:63425317-63425339 AAGATGGACATGAATTTTGGGGG - Intronic
1177289400 21:19091377-19091399 TGGGTAGACATAAACTTTGGAGG - Intergenic
1177488992 21:21796967-21796989 ACAGTAGACATGAATTTTGGGGG - Intergenic
1177571892 21:22897903-22897925 TGGGTAGACATGAATTTTTGAGG + Intergenic
1177800006 21:25819470-25819492 TGGCTAGACATGAATTTTGGGGG - Intergenic
1177967512 21:27746473-27746495 TAGGAAAACAGGAATTAGGGAGG + Intergenic
1178358917 21:31932148-31932170 TAAGTACACATGAGTTTGTGTGG - Intronic
1178687977 21:34726336-34726358 TGGGTAGACACGAATTTTGAGGG - Intergenic
1178839168 21:36124966-36124988 CAGGTGGACATGAATTTTGAGGG - Intergenic
1179038923 21:37784452-37784474 TAGGTGGACATGAACTTTGTGGG - Intronic
1179175587 21:39005599-39005621 TGGTTAGACATGAATTTGCGGGG + Intergenic
1179472783 21:41622651-41622673 CAGGTGGACACGAATTTTGGGGG + Intergenic
1179925424 21:44531560-44531582 TGGGTGGACATGAATTCGGGGGG + Intronic
1181136861 22:20773460-20773482 TAAGTGGCCCTGAATTTGGGAGG + Intronic
1182940473 22:34271747-34271769 GATGAAGACATGAATTTGAGGGG + Intergenic
1183013902 22:34970329-34970351 TGGGTAGACATGAATTTTGGGGG - Intergenic
1183082588 22:35466041-35466063 TAGCCAGGCATGACTTTGGGAGG - Intergenic
1183397011 22:37577312-37577334 CAGGTGGACATGAATTTTCGGGG - Intronic
1184652965 22:45927455-45927477 TGAGCAGACATGAATTTGGGGGG - Intronic
1184775595 22:46621300-46621322 GAGGTGGACATGAATTTTGGGGG - Intronic
950340047 3:12235133-12235155 TAGGTACACATGGATTATGGAGG + Intergenic
951834532 3:26967444-26967466 TATGTAGGCATGAAATTGGTGGG + Intergenic
952180838 3:30914830-30914852 CAGGAAGACATGGATATGGGAGG - Intergenic
952337150 3:32413900-32413922 TTGGTGGACATCAATTTGTGGGG - Intronic
952392554 3:32892830-32892852 GACGTGGACATGAATGTGGGTGG + Exonic
952610504 3:35203253-35203275 TGGGTGGACAAGAATTTGGGTGG - Intergenic
954990635 3:54837937-54837959 TGGGTGGACATGAACTTGGGGGG + Intronic
955573598 3:60333936-60333958 TAGGAAAACAGGAATTAGGGAGG - Intronic
955619642 3:60848871-60848893 TATGTAGACATGGAATTGGGTGG - Intronic
958169170 3:89916970-89916992 TGGGTAAACAGGAATTAGGGAGG + Intergenic
959168333 3:102810898-102810920 TATGAAGACATGAATTTGATTGG - Intergenic
959712784 3:109401569-109401591 ATGATGGACATGAATTTGGGGGG + Intergenic
959892200 3:111570033-111570055 TCGGTAGGCAGGAATTGGGGTGG + Intronic
961480813 3:127178886-127178908 TTGGTAGACTTGAAACTGGGAGG + Intergenic
961880358 3:130057266-130057288 TTGATAAACATGAATTTGAGAGG - Intergenic
962131543 3:132683322-132683344 TAGGTAAACATGAATTAGATAGG - Intronic
963946507 3:151151570-151151592 TAGGGAGGCCTGAAGTTGGGTGG + Intronic
964713412 3:159696052-159696074 TAGGGAGAGATGAATTTGATGGG - Intronic
964951685 3:162302955-162302977 TAGGTAGACATGAACAGGGCAGG + Intergenic
965015982 3:163157021-163157043 TAGGAAAACAGGAATTAGGGAGG - Intergenic
965087322 3:164115197-164115219 TACGTAGCAAAGAATTTGGGTGG + Intergenic
965135633 3:164763723-164763745 TAGGAAAACAGGAATTTGGGAGG - Intergenic
965877477 3:173344590-173344612 TAAGTAGACATGAAATTAGTAGG - Intergenic
966534056 3:181011276-181011298 AAGAAGGACATGAATTTGGGGGG + Intergenic
967625696 3:191681344-191681366 TACACAGATATGAATTTGGGTGG - Intergenic
969051605 4:4377200-4377222 CAGATGGACATGAATTTTGGGGG + Intronic
969175602 4:5396477-5396499 TGGGTGGACATGAATTTTGAAGG + Intronic
970211332 4:13713199-13713221 CAGGTAGACATGAATTTTAGGGG - Intergenic
970464941 4:16312943-16312965 AAGGTAGACATGAATTCTGGGGG + Intergenic
970535741 4:17028197-17028219 CAGGTGGACATGGATTTGGTGGG - Intergenic
970720332 4:18980835-18980857 TAGGAACACAGGAATTAGGGAGG - Intergenic
971108654 4:23557000-23557022 TGGGTAGACATACATTTTGGGGG - Intergenic
971175236 4:24276345-24276367 TAGGCACACATGCATTTGCGTGG - Intergenic
972264929 4:37451081-37451103 TAGGAAAACAGGAATTAGGGAGG + Intergenic
972649530 4:41003432-41003454 TGGGTGGACATGAATTTTCGTGG - Intronic
972697998 4:41466508-41466530 TTGGTAGTCATAAATTTGGAAGG - Intronic
973231271 4:47841720-47841742 TGGGTGGACATTAATTTGGCAGG - Intergenic
974124356 4:57677352-57677374 TAGGTAAACAGGAATTAGGGTGG - Intergenic
974205681 4:58700286-58700308 TGGGTAGACATTAATTCTGGGGG + Intergenic
974343180 4:60640399-60640421 TAGGTGCATATGAATTTTGGAGG + Intergenic
974535448 4:63168143-63168165 TAGGTGGACATGAAATTTGGAGG - Intergenic
975488971 4:74967707-74967729 CAGGTAGGCATGTATTTGGTTGG - Intronic
975885348 4:78958429-78958451 TAGGTGGACATCAATTTGTCAGG - Intergenic
976121172 4:81784074-81784096 TTGGTAGACAAGAATTATGGTGG - Intronic
976273497 4:83252831-83252853 GATGTCAACATGAATTTGGGGGG + Intergenic
976663120 4:87561213-87561235 GAGGTGGACATGAATTTTGGGGG - Intergenic
976764416 4:88584289-88584311 CAGGTAGACATGAATTTGAAGGG + Intronic
976827851 4:89280600-89280622 TAGGTGGACCTGAATTTTAGGGG - Intronic
976956612 4:90909320-90909342 CAAGTAGACATGAATTTTGGAGG + Intronic
977531029 4:98200634-98200656 CAGGTAGACATGAATTTTGGGGG - Intergenic
977924301 4:102682564-102682586 TGGGTGGACATGAATTTTGGGGG - Intronic
978107226 4:104917687-104917709 TAGGTAGACAAGGAGTTGGGAGG - Intergenic
978937532 4:114396216-114396238 TAGATGGACATGAATTTGGGGGG + Intergenic
979242806 4:118463458-118463480 TAGGTGAACAGGAATTAGGGAGG + Intergenic
979715186 4:123829364-123829386 CAGGTAGACATAAATTTGCAGGG - Intergenic
979856894 4:125644619-125644641 TAGGTTGAGATGAAGTTGTGCGG - Intergenic
980128960 4:128800864-128800886 TGTGTAGACATGTGTTTGGGGGG + Intergenic
980142863 4:128942229-128942251 TATGTTGACATGAATTAGGTTGG + Intronic
980517474 4:133881962-133881984 TAGGTAGACATGAAATTGCTGGG + Intergenic
980796544 4:137691559-137691581 TAGGAAGACAAAAATTTGGTGGG + Intergenic
981147248 4:141339585-141339607 TGGGAAGACAGGAATTCGGGAGG - Intergenic
981587149 4:146316357-146316379 TTGGGAGACAGGACTTTGGGAGG + Intronic
981630508 4:146813725-146813747 TAGGTAGCCAGCACTTTGGGAGG + Intronic
981888375 4:149706368-149706390 GAGGCAGACATGGATTTGGGGGG + Intergenic
982179814 4:152739460-152739482 TGGGTGGCCATAAATTTGGGTGG + Intronic
982341130 4:154300207-154300229 AGGAAAGACATGAATTTGGGAGG + Intronic
982419422 4:155177081-155177103 GAGAAGGACATGAATTTGGGGGG - Intergenic
982493849 4:156065349-156065371 TAGGTAGAAAAGAGTTGGGGAGG + Intergenic
983758612 4:171375735-171375757 TAGGTGGGCATGGATGTGGGAGG + Intergenic
984702448 4:182826895-182826917 CAGGGAGACACGAATCTGGGGGG + Intergenic
984806016 4:183752545-183752567 CAGGTGGACATGAATTTGGTGGG + Intergenic
985768004 5:1791089-1791111 CAGGTAGACAGGAATTTTGCGGG - Intergenic
986459074 5:7951585-7951607 TAGATGGACATAAATTTGGTGGG - Intergenic
986790514 5:11155050-11155072 TGGGTAGACAAGAATTTTGGGGG + Intronic
986897943 5:12393674-12393696 CATGTGGACATGAATTTCGGAGG - Intergenic
987070194 5:14329303-14329325 TATTTCAACATGAATTTGGGGGG - Intronic
987108443 5:14663456-14663478 TAGGTGGACGTGAATTTTGGGGG + Intergenic
987220718 5:15788254-15788276 TGGGTGGACATGAATTTTGGGGG + Intronic
987247002 5:16059299-16059321 CAAGAAGACATGAATTTTGGAGG + Intergenic
987275977 5:16363113-16363135 TAGGAAGACAGGAATTAGAGGGG - Intergenic
987849518 5:23332584-23332606 TTGGTAGATATAAATTTGGGGGG - Intergenic
988389683 5:30611767-30611789 CAGGTGGACATTAATTTGGGTGG - Intergenic
989169105 5:38457661-38457683 TGGGTAGACATGAATTTGGCGGG + Intronic
989262259 5:39431198-39431220 TAGGTAGACATGAATTTTGGAGG - Intronic
991290508 5:65030041-65030063 AAGGTAGACTTGGATTTGGCAGG - Intergenic
991688033 5:69199518-69199540 TGGGAAGACAGGAATTAGGGAGG + Intronic
992415600 5:76549942-76549964 GAGGAGGACATGAATTTTGGGGG - Intronic
993068193 5:83127171-83127193 TATAAGGACATGAATTTGGGGGG + Intronic
993572947 5:89565568-89565590 AATGTTAACATGAATTTGGGGGG + Intergenic
993742050 5:91553645-91553667 CAGGTGGACATGAATTTTGGAGG - Intergenic
994280171 5:97892615-97892637 CAGGTAGACATGAATTTTGCAGG - Intergenic
994381055 5:99071782-99071804 TAAGTAGACATGAAATTTGTTGG - Intergenic
995168203 5:109073123-109073145 CAGGTAGACATAAATTTTGGGGG + Intronic
995673777 5:114638960-114638982 TAGGTGGACATGAATTTTCAAGG - Intergenic
996448740 5:123592311-123592333 TAGGTAGAGATGGATTAGAGAGG + Intronic
1000047169 5:157531298-157531320 GAGGTGGACATGAATTTTAGGGG - Intronic
1000568394 5:162880696-162880718 TAGGAAAACATGAATTCGGTAGG + Intergenic
1000705225 5:164502755-164502777 TAACTGGACATGAATTTTGGGGG - Intergenic
1000784921 5:165531080-165531102 CTGGAAGACATGAATTTGGGAGG + Intergenic
1001633348 5:173192718-173192740 TGAGTAGTTATGAATTTGGGTGG + Intergenic
1002558333 5:180061800-180061822 TAGGGGGACATGAATTTTTGTGG + Intronic
1005122964 6:22411154-22411176 TAGGTTGACATGACTTTCAGTGG - Intergenic
1005595759 6:27377566-27377588 CAGGAAGACATGAAGCTGGGAGG - Intronic
1005810129 6:29509068-29509090 TATGTAGACATGAATTTGAGGGG + Intergenic
1006295559 6:33168574-33168596 TAGGGAGAGAGGAATTGGGGTGG + Intronic
1006339237 6:33437514-33437536 AGGGTAGACATGAGTTTTGGTGG + Intronic
1007076152 6:39067669-39067691 GAGGAGGACAGGAATTTGGGGGG - Intronic
1007364859 6:41384234-41384256 TGGGTGGACATGAATTTTTGGGG + Intergenic
1007539454 6:42627585-42627607 GAGGTTGGCTTGAATTTGGGTGG - Intronic
1008282209 6:49610163-49610185 TAGGTATACATGTATCTTGGTGG - Intronic
1009562715 6:65269934-65269956 GAGAATGACATGAATTTGGGGGG - Intronic
1010666430 6:78635802-78635824 TAAGTAGACAAGCATTTGTGTGG - Intergenic
1012368782 6:98477454-98477476 TAGGAAAACAGGAATTAGGGAGG - Intergenic
1012663289 6:101932341-101932363 TAGGAATACATCAATTTGGATGG - Intronic
1012759372 6:103279138-103279160 TAGGGAAACAGGAACTTGGGAGG + Intergenic
1013274506 6:108571400-108571422 CAGGAAGACATGAATTTTAGAGG - Intronic
1013343648 6:109238743-109238765 CAGGTAGACATGAATTTTGGGGG + Intergenic
1013356177 6:109347746-109347768 CAGGTAGACATGAAATTTGGGGG + Intergenic
1013710966 6:112897928-112897950 GAGTTTGACATGAATTTTGGGGG + Intergenic
1013883880 6:114938239-114938261 TATGTAGAGAAGCATTTGGGAGG + Intergenic
1015492381 6:133840117-133840139 TGGGTAGACATAGATTTTGGAGG + Intergenic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1016525999 6:145002327-145002349 TTGCTATACATGAATATGGGTGG + Intergenic
1018034218 6:159867568-159867590 TGGGTAAACGTGAATTTTGGAGG - Intergenic
1018040864 6:159921031-159921053 CAGGTGGACAGGAATTTTGGGGG - Intergenic
1018187295 6:161277143-161277165 TGGGTGAACATGAATTTGTGGGG - Intergenic
1018568660 6:165184301-165184323 CAGGTGGACATGAATTTTGGAGG + Intergenic
1018797933 6:167201745-167201767 TGGGAAGACATGAATTTTGGGGG - Intergenic
1018814782 6:167322424-167322446 TGGGAAGACATGAATTTTGGGGG + Intergenic
1019065975 6:169298134-169298156 TAGGTGGACATGAATTTTGGGGG - Intergenic
1020771287 7:12398474-12398496 TAGGAATACAGGAATTAGGGAGG - Intronic
1020805385 7:12784446-12784468 TGGGTACACATAAATTTTGGAGG - Intergenic
1020950063 7:14664183-14664205 TATGCAGCCATGAATCTGGGTGG - Intronic
1021495216 7:21266934-21266956 TTCTTAGAAATGAATTTGGGGGG + Intergenic
1022316677 7:29252088-29252110 TGGATGGACATAAATTTGGGGGG - Intronic
1022621158 7:31986008-31986030 CAGGTAGATGTGAATTTTGGTGG - Intronic
1022621206 7:31986441-31986463 TGGGTTGATATGAATTTTGGTGG + Intronic
1023839780 7:44090176-44090198 TGGGTGGAAATGAATTTGGGGGG + Intergenic
1023901796 7:44487348-44487370 TAGGCAGAGAAGAATTTGGATGG - Intronic
1024246213 7:47472252-47472274 CAGGTGGACATGAATTTCGGGGG + Intronic
1024585326 7:50836900-50836922 TAGATAGACATGAACAAGGGTGG - Intergenic
1024756031 7:52532482-52532504 CAGGTAAAGAGGAATTTGGGAGG - Intergenic
1025828108 7:65026881-65026903 GAGAAGGACATGAATTTGGGTGG + Intergenic
1026656823 7:72263878-72263900 CAGGAGGACATTAATTTGGGGGG - Intronic
1027888465 7:83939026-83939048 TGGGTAGACATGGATTATGGAGG + Intergenic
1028972337 7:96872713-96872735 CAGGTGGACATGAATTTTGGGGG + Intergenic
1030749328 7:113211190-113211212 GAGAAGGACATGAATTTGGGGGG - Intergenic
1030996872 7:116370384-116370406 TAGGTGGATGTGAATTTTGGGGG - Intronic
1031914980 7:127554482-127554504 TTGGTAGACACGAATGTTGGGGG + Intergenic
1033057338 7:138070246-138070268 CAGATAGACCTGACTTTGGGGGG + Intronic
1034070207 7:148177162-148177184 TAGGTGGACATGAATTTTGGGGG - Intronic
1034229118 7:149506626-149506648 TGGATGGACATGAATTTTGGGGG + Intergenic
1034408584 7:150923685-150923707 CAGGTGGACATGGATTTTGGGGG - Intergenic
1036801029 8:11792197-11792219 TAGGTTTATATGAATTTAGGGGG + Intergenic
1037464691 8:19148737-19148759 CAGGTAGACATGAATTTTGGAGG - Intergenic
1037484820 8:19337376-19337398 TAGGTGGACATAAATTTCGGGGG - Intronic
1037627347 8:20619633-20619655 CAGGTGAACATGAATTTTGGTGG - Intergenic
1037660996 8:20926759-20926781 CAGGTGGACATGAATTTTGAGGG + Intergenic
1039726588 8:40223998-40224020 CAGGTAAACATGAATTATGGGGG + Intergenic
1039771532 8:40692982-40693004 TAGGGGGACATAAATTTGAGGGG - Intronic
1039778673 8:40762204-40762226 TAGGTTGATATGAATTTGGAGGG - Intronic
1039827798 8:41189669-41189691 TAGGCAGATATGAATTCTGGGGG + Intergenic
1039877320 8:41598104-41598126 GTGGCAGACATGAATGTGGGAGG - Intronic
1040011193 8:42662434-42662456 TGGGTAGATATGAATTTGGGAGG + Intergenic
1040027128 8:42792136-42792158 TGGGAAGACAGGAACTTGGGAGG - Intronic
1040564001 8:48549702-48549724 TAGGTAGACATGGAATAGGTTGG + Intergenic
1040741442 8:50580431-50580453 TGGGAAGACATGATTTTGGGAGG + Intronic
1040896510 8:52374118-52374140 TTGGTAGACGTGGATTTTGGTGG - Intronic
1041067181 8:54093242-54093264 CAGGTGGATGTGAATTTGGGGGG - Intronic
1041136333 8:54763043-54763065 TAGGTGGCCATGAATTTTGGGGG + Intergenic
1041257671 8:55993084-55993106 TAGGTAGGTATGAACTTTGGAGG - Intronic
1041628679 8:60060484-60060506 TAGTTAGAAATGAATACGGGTGG + Intergenic
1041821065 8:62033380-62033402 CAGGTGGACATGAGTTTGAGGGG + Intergenic
1041918078 8:63155829-63155851 TAGGTTGAACTAAATTTGGGGGG - Intergenic
1042317666 8:67441021-67441043 TCAGTGGATATGAATTTGGGGGG + Intronic
1042388594 8:68205971-68205993 TAGGTAGACATCAATTCAGGCGG - Intronic
1043036798 8:75208959-75208981 CAATTAGACATGAGTTTGGGTGG + Intergenic
1043108477 8:76147136-76147158 AAGGAAGAAATGTATTTGGGTGG + Intergenic
1043586783 8:81779260-81779282 TAGGAAGAGATGAAGCTGGGAGG + Intergenic
1044688985 8:94857845-94857867 CAGATACACATGAATTTTGGGGG + Intronic
1044773302 8:95660644-95660666 CATGTAGACATGAATTTTGGGGG - Intergenic
1044995028 8:97830491-97830513 TAGGTAGACATTAAGTAGTGGGG + Intronic
1045176886 8:99735272-99735294 CAGGTAGAAATGAATTTGGGAGG - Intronic
1045468421 8:102489834-102489856 TGGGTGGACGTGAATTTTGGGGG - Intergenic
1045486110 8:102633023-102633045 CTGGTGGACATGAATTTTGGAGG - Intergenic
1047105522 8:121726847-121726869 AAGAAGGACATGAATTTGGGGGG - Intergenic
1048743121 8:137584457-137584479 CGGATAGACATGAATTTTGGAGG - Intergenic
1048767533 8:137861135-137861157 TAGATAGACATGACTTTTGGGGG - Intergenic
1049048727 8:140174040-140174062 TCAGAAGACATGAGTTTGGGGGG + Intronic
1049187380 8:141264383-141264405 TAGGTAGACAGGCACATGGGTGG - Intronic
1049320952 8:141996049-141996071 TAGGTGGACATGAATTTTGGGGG + Intergenic
1049483618 8:142839866-142839888 AAGGAAGACTTGATTTTGGGAGG + Intronic
1049502768 8:142976411-142976433 GAGGAAGACATGAATTTTGCAGG + Intergenic
1050291744 9:4162344-4162366 CAGGTGGGCATTAATTTGGGGGG + Intronic
1050308706 9:4331421-4331443 TGGGTACACATGAATTTCGGGGG + Intronic
1050425594 9:5509581-5509603 TCAGTAGACATGAATTTGGGGGG - Intergenic
1050692444 9:8243043-8243065 CAGGTGGAGATGAATTTGGATGG + Intergenic
1051054663 9:12970769-12970791 TGGGTGGATATGAATTTTGGTGG + Intergenic
1051518479 9:17957620-17957642 TAAGTGGACATGAATTTGGGGGG - Intergenic
1051888131 9:21916179-21916201 CAGGTATACATGAATTTTGGAGG - Intronic
1051889965 9:21931337-21931359 TAGGCAGACATGAGTAAGGGAGG + Intronic
1051961967 9:22777196-22777218 TAGTAAGCCATGAAGTTGGGTGG - Intergenic
1051965051 9:22817218-22817240 GAGAAAGACATGAATTTGAGGGG + Intergenic
1052177022 9:25474361-25474383 TGGGTAAACAGGAATTAGGGAGG - Intergenic
1053118916 9:35530603-35530625 TAGGTAGAAAGGAATTTTGGGGG + Intronic
1055299779 9:74870847-74870869 TCGGGAGGCTTGAATTTGGGAGG + Intronic
1055830112 9:80368258-80368280 CAGGTGAATATGAATTTGGGGGG - Intergenic
1056083639 9:83123292-83123314 TAGATAGGCATGACCTTGGGAGG - Intergenic
1056255460 9:84795011-84795033 AAGGTAGACATTAATTTGGGGGG - Intronic
1057137806 9:92706273-92706295 GACATAGACATGAATTTGAGGGG - Intergenic
1057331802 9:94121761-94121783 AAGAAAGACATAAATTTGGGGGG + Intergenic
1057633970 9:96745914-96745936 TAGGTAGACATGAACTTTGTAGG - Intergenic
1057717804 9:97508745-97508767 TAGGTGGGCATGACTTTTGGGGG - Intronic
1057792665 9:98134396-98134418 CAGGTGGACATGAGTTTTGGGGG - Intronic
1058165235 9:101611483-101611505 TAGGTAGACATTAATTTTGGGGG + Intronic
1058782907 9:108356487-108356509 CTGGTAGACATGAATTTTGAGGG + Intergenic
1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG + Intronic
1061779325 9:132986525-132986547 TGGGTGGACATGAACTTTGGGGG + Intronic
1062112354 9:134789001-134789023 TAGGTAGACAGGTAGGTGGGTGG + Intronic
1062635898 9:137491586-137491608 TGGGTAGACATGAATTTGGGGGG - Intronic
1062663029 9:137649496-137649518 TGGGTGGATCTGAATTTGGGAGG - Intronic
1203545768 Un_KI270743v1:127002-127024 GAGAAAGACATGAATTTTGGGGG - Intergenic
1185923900 X:4125221-4125243 TAGGTGGATGTGAATTTTGGGGG - Intergenic
1186193311 X:7087094-7087116 TAGGTGAACATGAATTTTGTGGG - Intronic
1186328782 X:8510019-8510041 TAGGTAGAAATAAATATGAGTGG - Intergenic
1186399460 X:9243225-9243247 CAGGTGGACATCAATTTTGGGGG + Intergenic
1186769153 X:12800475-12800497 TGGGTGGACATGAGTTTTGGGGG + Intronic
1187549644 X:20289069-20289091 TGGGTAGACATGAATTTTGGGGG + Intergenic
1188182908 X:27077244-27077266 TGGGTAAACAGGAATTAGGGAGG - Intergenic
1188185043 X:27103322-27103344 TAGGAAAACAAGAATTAGGGAGG - Intergenic
1188589320 X:31814790-31814812 TAGGTAGACAGGACTTTGCATGG - Intronic
1189249396 X:39588254-39588276 TAGGTAGACATGGAACTTGGGGG - Intergenic
1189744061 X:44151709-44151731 AGGGTAGACATGAGTTTTGGAGG + Intronic
1190084048 X:47379938-47379960 TAGTAAGTCATGAAGTTGGGTGG + Intronic
1190334286 X:49253045-49253067 GAGGGAGACAGGAGTTTGGGAGG + Intronic
1190434398 X:50408938-50408960 TGGAAGGACATGAATTTGGGGGG + Intronic
1190461789 X:50684093-50684115 TGGGTAAACATGAATTTTGCAGG - Intronic
1190870700 X:54422446-54422468 TGGGTAGACATACATTTGGAGGG + Intergenic
1192231241 X:69266564-69266586 TTGAAACACATGAATTTGGGGGG - Intergenic
1192387526 X:70686960-70686982 TAGGTAGACATCCATTTGCAAGG + Intronic
1193173461 X:78363832-78363854 CAGGTAGAAGAGAATTTGGGAGG + Intergenic
1194647171 X:96471980-96472002 CAGGTGGATATGAATTTTGGGGG - Intergenic
1194843173 X:98770279-98770301 TGGGTAGACATGAAGTTTTGGGG + Intergenic
1194957561 X:100198545-100198567 GAGACAGATATGAATTTGGGGGG + Intergenic
1195634927 X:107103198-107103220 GAGGTGGACATGAATTTTAGAGG - Intronic
1196194987 X:112830047-112830069 TAAGTAGATATGAAAATGGGTGG - Intronic
1196355315 X:114785043-114785065 TAGATGGACATGAATTTGAAGGG + Intronic
1197210668 X:123825780-123825802 TGGGTTGACATGAGTTTTGGGGG - Intergenic
1197443161 X:126514648-126514670 GAGAAAGACATGAATTTGGAGGG - Intergenic
1197599418 X:128510192-128510214 GAGAAAGACATGAATATGGGGGG + Intergenic
1197865890 X:131016749-131016771 GAGAAAGACATGAATTTTGGGGG - Intergenic
1198443469 X:136687755-136687777 TAGGTAAGCATGATTTTTGGAGG + Intronic
1198677662 X:139147966-139147988 TGGGTAGACATGAATTTTGGTGG + Intronic
1198724057 X:139658093-139658115 TATATACTCATGAATTTGGGAGG + Intronic
1201751402 Y:17435845-17435867 GAGGAAGACATGAACCTGGGAGG + Intergenic
1202390538 Y:24365559-24365581 TAGGTGAACAGGAATTAGGGAGG + Intergenic
1202480246 Y:25304557-25304579 TAGGTGAACAGGAATTAGGGAGG - Intergenic