ID: 1152261813

View in Genome Browser
Species Human (GRCh38)
Location 17:79271467-79271489
Sequence GCGGCTAATGAGCTTGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152261813_1152261817 6 Left 1152261813 17:79271467-79271489 CCGGACTCAAGCTCATTAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1152261817 17:79271496-79271518 CGCTGTCCTTCTCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
1152261813_1152261822 19 Left 1152261813 17:79271467-79271489 CCGGACTCAAGCTCATTAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1152261822 17:79271509-79271531 CCCGGGCAGGGCTTTCTCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 256
1152261813_1152261815 1 Left 1152261813 17:79271467-79271489 CCGGACTCAAGCTCATTAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1152261815 17:79271491-79271513 CTTTGCGCTGTCCTTCTCCCCGG 0: 1
1: 0
2: 2
3: 16
4: 215
1152261813_1152261816 2 Left 1152261813 17:79271467-79271489 CCGGACTCAAGCTCATTAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1152261816 17:79271492-79271514 TTTGCGCTGTCCTTCTCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
1152261813_1152261818 7 Left 1152261813 17:79271467-79271489 CCGGACTCAAGCTCATTAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1152261818 17:79271497-79271519 GCTGTCCTTCTCCCCGGGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 188
1152261813_1152261824 25 Left 1152261813 17:79271467-79271489 CCGGACTCAAGCTCATTAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1152261824 17:79271515-79271537 CAGGGCTTTCTCCCAGGATCAGG 0: 1
1: 0
2: 4
3: 26
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152261813 Original CRISPR GCGGCTAATGAGCTTGAGTC CGG (reversed) Intronic
901706734 1:11079215-11079237 GCGACTCAGGAGGTTGAGTCAGG + Intronic
909238692 1:73183861-73183883 GCAGGTAATGAGAATGAGTCAGG - Intergenic
912475532 1:109932258-109932280 GGGCCTCAGGAGCTTGAGTCAGG - Intergenic
1064833236 10:19495086-19495108 GCTGCTAATGAGGCTGAGGCGGG - Intronic
1067941385 10:50659855-50659877 GTGGCGAATGAGCTTGATGCAGG - Intergenic
1069592721 10:69652064-69652086 GCTGCTAATCAGCTTGACCCAGG - Intergenic
1070862623 10:79684817-79684839 GTGGCGAATGAGCTTGATGCAGG - Intergenic
1071812384 10:89197863-89197885 CTGGCTAATGAGCTTGAACCTGG + Intergenic
1073441257 10:103553994-103554016 GAGGCTAAGGAGCTTGCGTGAGG - Intronic
1082885022 11:58072579-58072601 GTTGCTAATGAGCTTCAGACGGG + Intronic
1093684132 12:22037011-22037033 GCTGCTCAGGAGCTTGAGGCAGG + Intergenic
1104196806 12:126548186-126548208 AGAGATAATGAGCTTGAGTCTGG - Intergenic
1106122477 13:26872126-26872148 CCGGCTAATGACCTTGAGTGAGG - Intergenic
1108346812 13:49554510-49554532 GCGGCTCATGAGCTGGGGACTGG - Intronic
1118680913 14:68240694-68240716 TGGGCTAATGTCCTTGAGTCTGG - Intronic
1120809926 14:88792818-88792840 GCGGCTGAGGAGCTGGAGGCGGG - Intergenic
1126390899 15:48150658-48150680 GCATCTCCTGAGCTTGAGTCAGG - Intronic
1131184604 15:90264038-90264060 ACGGCTAGTGAGCCTGATTCTGG - Exonic
1141819870 16:86437901-86437923 TTGGCCAATGAGCTTGAGTTGGG - Intergenic
1145759986 17:27420438-27420460 GCAGCTAATGACCCTGGGTCTGG + Intergenic
1146159947 17:30554362-30554384 GCAGCTAATGACCCTGGGTCTGG + Intergenic
1152261813 17:79271467-79271489 GCGGCTAATGAGCTTGAGTCCGG - Intronic
1160953085 19:1676785-1676807 CGGGCCCATGAGCTTGAGTCGGG + Intergenic
1165757772 19:38304322-38304344 GCAGCTTCTGGGCTTGAGTCCGG - Intronic
1167292815 19:48633870-48633892 GCGGCGAATCACCTTTAGTCAGG + Intronic
929283399 2:40108035-40108057 TGGGATACTGAGCTTGAGTCTGG - Intronic
938295621 2:130177308-130177330 GCGGATAGTTCGCTTGAGTCTGG - Intronic
946744993 2:222836696-222836718 GTGGCTCATGAGGCTGAGTCAGG + Intergenic
948358526 2:237399952-237399974 GCTGATAATGAGATTGAGTCTGG - Intronic
1168837686 20:888590-888612 GCAGGTAATAAGCTTAAGTCAGG - Intronic
1177175019 21:17693876-17693898 GCTGCTGATGATGTTGAGTCAGG + Intergenic
1184035999 22:41918459-41918481 GGGGCAAATGAGCCTGGGTCAGG - Intergenic
951506942 3:23457616-23457638 GAGGCTGAGGAGCTTGAGCCTGG - Intronic
968090595 3:195896084-195896106 GCGGCTTTTGAGCAGGAGTCCGG - Intronic
969721236 4:8893977-8893999 GCGGCTTTTGACCTTGGGTCGGG + Intergenic
986443614 5:7802018-7802040 GCTTCTAATGAGCTGGATTCAGG - Intronic
986939917 5:12937282-12937304 GTGGCTAATGAGCTGAACTCAGG + Intergenic
1000230466 5:159310862-159310884 GCGGTTTATGAGCTTGAGACAGG + Intergenic
1003612064 6:7622646-7622668 GCGACTGATTACCTTGAGTCAGG - Intergenic
1015675043 6:135736519-135736541 GCTGCTCATGAGGCTGAGTCAGG + Intergenic
1020387090 7:7618666-7618688 GCGGCTAAGGAGGCTGAGACAGG - Intergenic
1023061888 7:36335503-36335525 GCTGCCAATGAGCTGGATTCTGG - Intronic
1032291842 7:130596097-130596119 GAGGCTAATGAGGGTGAGTAGGG + Intronic
1035678272 8:1470048-1470070 GCTGCTCATGAGGTTGAGGCAGG + Intergenic
1036971584 8:13361364-13361386 GCTGCTCAGGAGGTTGAGTCAGG - Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1185726159 X:2423478-2423500 GCGACTCATGAGGCTGAGTCAGG + Intronic
1193673352 X:84417040-84417062 GCTACTAAGGAGCTTGAGGCAGG + Intronic