ID: 1152262228

View in Genome Browser
Species Human (GRCh38)
Location 17:79273414-79273436
Sequence GTGTTTTAGGGTGGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 0, 3: 56, 4: 604}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152262221_1152262228 1 Left 1152262221 17:79273390-79273412 CCAGGGCTGTGAGAAGGGGAGAG 0: 1
1: 0
2: 2
3: 78
4: 534
Right 1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG 0: 1
1: 0
2: 0
3: 56
4: 604
1152262217_1152262228 16 Left 1152262217 17:79273375-79273397 CCAGGATACTTCAGTCCAGGGCT 0: 1
1: 0
2: 1
3: 13
4: 108
Right 1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG 0: 1
1: 0
2: 0
3: 56
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152262228 Original CRISPR GTGTTTTAGGGTGGGGTGGA TGG Intronic
900705267 1:4076446-4076468 GTGTTTTAGGGTGGGGACTTTGG - Intergenic
901236381 1:7669709-7669731 TGGTTTGGGGGTGGGGTGGATGG + Intronic
901263443 1:7890961-7890983 GTTTTGTGGGGGGGGGTGGAGGG - Intergenic
902208303 1:14886014-14886036 GTGTTGTGGGGTGGGGCGGGGGG - Intronic
903734920 1:25523910-25523932 GGGGGTTACGGTGGGGTGGAAGG - Intergenic
903974395 1:27139647-27139669 GTGTTTGGGGGTGAGGTGGAAGG + Intronic
904613098 1:31735933-31735955 GTGTTTGAGGGTGGGGAGGGAGG - Intronic
904618509 1:31762599-31762621 ATGGGTTGGGGTGGGGTGGAGGG - Intronic
905110176 1:35588929-35588951 GTGTTTTGGGGTGTGGAGCATGG + Intronic
905435571 1:37953038-37953060 GTGTTTGTTGGTGGGGGGGACGG - Intergenic
906106075 1:43293438-43293460 GAGTTTCAGGGTGGTGTGGTTGG - Intergenic
906234087 1:44193236-44193258 ATTTTTTTGGGGGGGGTGGATGG + Intergenic
906274739 1:44507449-44507471 GTGATTGGGGGTGGGGTGAAGGG + Intronic
906298134 1:44661738-44661760 GTAGTTTAGGGTGGGGAGCAGGG - Intronic
906993026 1:50759298-50759320 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
907589232 1:55650225-55650247 AAGTTGTAGGGTGGGATGGATGG - Intergenic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907998334 1:59655424-59655446 CTGTGGTGGGGTGGGGTGGAGGG - Intronic
908071679 1:60467193-60467215 GTGTTGTGGGGTGGGGGGAAGGG + Intergenic
908075781 1:60516437-60516459 TTCTTTGAGGGTGGGGTGGAGGG + Intergenic
908095959 1:60738870-60738892 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
908096397 1:60743310-60743332 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
908768487 1:67574805-67574827 GCCTTTTTTGGTGGGGTGGAGGG - Intergenic
909066125 1:70938096-70938118 GTGTTTTGGTGGGGGGTGGGAGG + Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909868322 1:80703723-80703745 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
910337226 1:86148496-86148518 GTGTTGTGGGGTGGGGGGAAGGG - Intronic
910628254 1:89331426-89331448 CTGTTGTAGGGTGGGGTGAGGGG + Intergenic
910817121 1:91302776-91302798 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
911237082 1:95423118-95423140 GTGGTGTAGGGTGGAGAGGAAGG + Intergenic
911331467 1:96530130-96530152 CTGTTGTAGGGTGGGGTGAGGGG + Intergenic
912799829 1:112713980-112714002 GTGGTTGAGGGTGGGATGTAGGG - Intronic
913592377 1:120341627-120341649 GTGGCTGGGGGTGGGGTGGAGGG - Intergenic
913650981 1:120913518-120913540 GTGGCTGGGGGTGGGGTGGAGGG + Intergenic
914170133 1:145215549-145215571 GTGGCTGGGGGTGGGGTGGAGGG - Intergenic
914401185 1:147321943-147321965 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
914525250 1:148459512-148459534 GTGGCTGGGGGTGGGGTGGAGGG - Intergenic
914598426 1:149176318-149176340 GTGGCTGGGGGTGGGGTGGAGGG + Intergenic
914641152 1:149607622-149607644 GTGGCTGGGGGTGGGGTGGAGGG + Intergenic
914744456 1:150491502-150491524 GTTGTTCAAGGTGGGGTGGAGGG + Exonic
914913384 1:151803728-151803750 GTGCTGTAGGATGGGGAGGAAGG + Intronic
914976967 1:152374869-152374891 GGCTTTTAGGGTGGGAGGGAGGG + Intergenic
915127772 1:153678246-153678268 GTGTTTGGGTGTGGGGTGGAAGG - Intergenic
915340389 1:155174030-155174052 GTGAGTTAAGGTGGGGTCGAGGG + Intronic
915476602 1:156156242-156156264 TTGTGTTGGGGTGGGGTGAAGGG + Intronic
916286802 1:163115137-163115159 CTGTTGGAGGGTGGGGTTGAGGG + Intronic
917548807 1:176002503-176002525 CTGTTGTGGGGTGGGGGGGAAGG - Intronic
918107807 1:181428448-181428470 GCCTTTCTGGGTGGGGTGGAGGG + Intronic
918429936 1:184449196-184449218 CTGTTGTAGGGTGGGGGGAAGGG - Intronic
918678199 1:187316984-187317006 GTGTTTTATGGTGGTGGGGGGGG - Intergenic
919019955 1:192092711-192092733 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
919020447 1:192098459-192098481 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
919373532 1:196763104-196763126 ATGTTGTGGGGTGGGGTGGGGGG + Intergenic
919379973 1:196847781-196847803 ATGTTGTGGGGTGGGGTGGGGGG + Intronic
919851445 1:201675757-201675779 AGGGTTTAGGGTGGAGTGGAGGG - Intronic
919974543 1:202602199-202602221 GAGTGTGAGGGTGGGGTGGGAGG + Intronic
920349188 1:205326509-205326531 ATTTTTTTGGGTGGGGGGGACGG - Intergenic
920505264 1:206511226-206511248 GTGTTTTGGGGTAGGGGTGATGG + Intronic
920859520 1:209694047-209694069 ATGTTTGAGGGTTGGGCGGAAGG - Intronic
921691505 1:218156589-218156611 ATGTTTTAAGGTGGGGGGGGTGG + Intergenic
922129459 1:222762567-222762589 TTGTTGTGGGGTGGGGGGGAGGG + Intergenic
922205106 1:223439318-223439340 ATGTGTTTGGGTGGGGTGGGAGG + Intergenic
922592027 1:226784617-226784639 GGGCTTGGGGGTGGGGTGGAGGG - Intergenic
922858783 1:228797722-228797744 GTGTTTTAGTGTGGAGTGAGAGG + Intergenic
923670777 1:236039403-236039425 GTATGTTGGGGTGGGGTGGGAGG - Intronic
924328199 1:242916820-242916842 GCATTTTAGGGTCTGGTGGAGGG - Intergenic
924414878 1:243849543-243849565 GTGTGTTTGGGTTGGGGGGAGGG - Intronic
1063278549 10:4598608-4598630 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1065230140 10:23589925-23589947 CTGTTGTGGGGTGGGGTGGGGGG - Intergenic
1065582925 10:27189616-27189638 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1065606583 10:27424235-27424257 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1066066410 10:31764448-31764470 CTGTTGTAGGGTGGGGGGCAAGG + Intergenic
1068893521 10:62173978-62174000 CTGTTTTGGGGTGGGGTGAGCGG + Intergenic
1069370766 10:67745503-67745525 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1071830822 10:89370519-89370541 ATGTTCTAGGGTGGGTTGGGTGG - Intronic
1072031903 10:91529489-91529511 GTGCTCTTGGGTGGGATGGAAGG - Intergenic
1072844626 10:98816021-98816043 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1073649863 10:105346890-105346912 TTATTTTAGGGAGTGGTGGAAGG - Intergenic
1074437900 10:113450000-113450022 GTGTTTAAAGTTTGGGTGGACGG + Intergenic
1074768277 10:116716442-116716464 GTGTTGGGGGGTGGGGTGGGGGG + Intronic
1076207018 10:128611668-128611690 CTGTTGGAGGGTGGGGTCGATGG - Intergenic
1076525339 10:131109062-131109084 GTGTTGTGGGGTGGGGGGGGTGG + Intronic
1076715208 10:132360518-132360540 TTGCTTTATGGTGGGGTGGGAGG + Intronic
1077348699 11:2078664-2078686 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1077392056 11:2304740-2304762 CTGCTATGGGGTGGGGTGGAGGG - Intronic
1077696816 11:4400967-4400989 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1077712202 11:4548809-4548831 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1078062751 11:8059065-8059087 GTGAGGTAGGGTGGGGTGGAGGG + Intronic
1078250424 11:9612552-9612574 CTTTTTTTGGGTGGGGGGGATGG + Intergenic
1078608797 11:12801301-12801323 GGGTGCTAGGTTGGGGTGGACGG + Intronic
1078615796 11:12864560-12864582 GGGTTTTGGGGTGGGGTTGGGGG - Intronic
1078927399 11:15886953-15886975 GTGTTTGGGGGTGATGTGGATGG - Intergenic
1078946473 11:16073608-16073630 CTGTTTTTTTGTGGGGTGGAGGG - Intronic
1079352550 11:19704013-19704035 GTTTTTTTTGGGGGGGTGGAAGG + Intronic
1079481092 11:20880929-20880951 TTATTTTTCGGTGGGGTGGAGGG + Intronic
1080860982 11:36150001-36150023 GTGTGGTAGGATGAGGTGGAAGG + Intronic
1081428007 11:42946171-42946193 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1082020397 11:47528101-47528123 TTGTTTTTGGGAGGGGTGGGGGG - Intronic
1082571190 11:54742536-54742558 CTGTTGTAGGGTGGTGTGAATGG - Intergenic
1083025058 11:59543680-59543702 CTGTTTTGGGGTGGGGGGAAGGG - Intergenic
1083161335 11:60856005-60856027 GTGTTTAGGGGTGGGGTTGGGGG + Intergenic
1083254812 11:61489578-61489600 GTGTTTCAGCGTCAGGTGGAGGG + Intronic
1083332426 11:61905130-61905152 GGATTTTAGAGTGGGGTGCAGGG + Intronic
1083734189 11:64670310-64670332 CAGCCTTAGGGTGGGGTGGAGGG - Intronic
1085390102 11:76177902-76177924 GTGTATTATGTTGGGGAGGAGGG - Intergenic
1085622783 11:78050035-78050057 GTGTTTGAGTGAGGGATGGATGG + Intronic
1085948750 11:81304255-81304277 CTGTTGGAGGGTGGGGTGGGGGG - Intergenic
1086976939 11:93142939-93142961 CTGTTTGGGGGTGGGGTGGGAGG + Intergenic
1087212135 11:95455307-95455329 GTCTCTGAGGGTGGGGTAGAGGG + Intergenic
1087927240 11:103933177-103933199 ATGCTTTGGGGTGGGGTGGGAGG + Intronic
1089089382 11:115856788-115856810 CTGTTGTAGGGTGGGGGGAAGGG - Intergenic
1089673876 11:120075962-120075984 GTGTGTTGGGGTGGGGAGGAGGG + Intergenic
1090612844 11:128487108-128487130 GCTGTTTGGGGTGGGGTGGAAGG - Intronic
1091034719 11:132222762-132222784 GTTTTTCAGGGTGGGGTGCGTGG - Intronic
1091041635 11:132286514-132286536 GTGTGTTTGGGTGGGGGGGGCGG - Intronic
1091144539 11:133266225-133266247 GTGTGCTAGGGTGGGGTTGAAGG - Intronic
1092133166 12:6126445-6126467 TTGTTTTGGGGTGGGGTGGCGGG + Intergenic
1092903021 12:13077418-13077440 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1092972640 12:13712223-13712245 CTGTTGTAGGGTGGGGGGAAGGG + Intronic
1094041373 12:26124259-26124281 ATGTTTTATGGTGGGGGGGCGGG - Intronic
1094182852 12:27610477-27610499 GTGTTTTACTGTGTGGAGGAAGG + Intronic
1094382343 12:29856319-29856341 GTCTTCCAGGGTGGGGTTGATGG + Intergenic
1095137462 12:38622924-38622946 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1095244425 12:39902186-39902208 CTGTTGTGGGGTGGGGTGGGGGG + Intronic
1096016436 12:48280369-48280391 GTGTTCTAGGGTGAGGAGAAAGG + Intergenic
1096796047 12:54078192-54078214 GTGTCTCAGGGTGAGGTGGTGGG + Intergenic
1096844980 12:54401491-54401513 GTGGTTTAGAGGAGGGTGGAAGG + Intronic
1097534866 12:60855927-60855949 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1097751178 12:63354574-63354596 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1097943942 12:65345728-65345750 GTGTTGTGGGGTGGGGTGAGTGG - Intronic
1099082584 12:78204198-78204220 CTGTTGTGGGGTGGGGCGGAGGG + Intronic
1099967079 12:89459253-89459275 CTGTTGTGGGGTGGGGTGGCAGG + Intronic
1100344181 12:93711028-93711050 GGGTGGGAGGGTGGGGTGGAGGG - Intronic
1100658857 12:96675932-96675954 CTGTTTTGGGGTGGGGGGCAGGG + Intronic
1101672188 12:106885823-106885845 GTGGATTTGGGTGGGGGGGAGGG + Intronic
1102430638 12:112880347-112880369 GTGTTATTGGCGGGGGTGGAGGG - Intronic
1102734359 12:115145235-115145257 GGGGTTTTGGGTGGGGTGGAGGG - Intergenic
1102980313 12:117236040-117236062 GTTTTTTGGGTTGGGGTGGGAGG - Intronic
1103446008 12:120995714-120995736 ATGGTATAGGGTGGAGTGGATGG - Intronic
1103510346 12:121469270-121469292 GTGATGTGGGGTGGGGTGGGGGG - Intronic
1104630715 12:130399800-130399822 GTGTTTTAGGGGGAGCTGAATGG - Exonic
1104784650 12:131441582-131441604 GTGTTTTGGGGTGATGTGTAAGG - Intergenic
1105254188 13:18729886-18729908 GTGCTTGAGGGTGGGGGGCAAGG - Intergenic
1105507943 13:21026275-21026297 GTTACTTAGGGTGGGGTGGAGGG - Intronic
1106168470 13:27269709-27269731 GGGGTCTAGGGTGGGGTGGGGGG - Intergenic
1106553004 13:30787771-30787793 GTCTTCAAGGGTGGGCTGGAGGG + Intergenic
1109696675 13:65969892-65969914 GTTTTTTGGGGAGGGGTAGAGGG + Intergenic
1109950357 13:69494018-69494040 GTTTTTTTGTGTGTGGTGGAGGG + Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110707844 13:78615313-78615335 GTGTTTTGGGGTTGGTTGGTTGG - Exonic
1110789743 13:79574670-79574692 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1110943319 13:81380686-81380708 GTGTGACAGGGTGGGGTGGGGGG + Intergenic
1111649314 13:91069202-91069224 GTGTGTCTGGGTGGGGTGGGGGG + Intergenic
1112060480 13:95734967-95734989 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1112075080 13:95904442-95904464 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1112699447 13:101988700-101988722 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1113586772 13:111471218-111471240 GTGATTTGGGGTGAGGGGGAGGG - Intergenic
1114963089 14:27919615-27919637 CTGTTTTAGGGTGGGGGGAGGGG - Intergenic
1115477688 14:33831758-33831780 CTGTTGTGGGGTGGGGGGGAAGG + Intergenic
1115767694 14:36640594-36640616 GTGTAAGAAGGTGGGGTGGAAGG - Intergenic
1116985376 14:51213769-51213791 CTGTTGTAGGGTGGAGGGGAGGG - Intergenic
1117561274 14:56941924-56941946 GTCTTTCAGGGTGAGGGGGAAGG - Intergenic
1118034428 14:61851057-61851079 CTGTTGGAGGGTGGGGTGGGAGG - Intergenic
1118179074 14:63472908-63472930 GTGTTTTAGCGGGGGCTGAAGGG + Intronic
1119330543 14:73790014-73790036 GCGATTTTGGTTGGGGTGGAGGG + Intronic
1120608406 14:86608623-86608645 CTGTTGTAGGGTGGGGGGAAGGG - Intergenic
1121332612 14:93058675-93058697 GGGTTATGAGGTGGGGTGGAGGG + Intronic
1122876518 14:104668700-104668722 GTGTCTTGGGGTGGGGCTGAGGG - Intergenic
1123676237 15:22712964-22712986 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1123893680 15:24807025-24807047 GTATTTTTGGTTGGGGTGCAAGG - Intergenic
1123949989 15:25262072-25262094 TTTTTTTTGGGGGGGGTGGAGGG - Intergenic
1124126369 15:26941304-26941326 GTTTTTTGGCGGGGGGTGGAGGG + Intronic
1125077309 15:35634201-35634223 GTGTTTTGGGGTTGGGTGGTAGG - Intergenic
1125181752 15:36887073-36887095 CTTTTTTGGGGTGGGGTGGGGGG + Intergenic
1125252212 15:37717958-37717980 CTGTTAGGGGGTGGGGTGGAAGG - Intergenic
1125528649 15:40396136-40396158 GTGTTTTGGGGTGGGGAGAAGGG - Intergenic
1126396197 15:48220408-48220430 GTTTTTTAGGGCTGGGTGAAGGG - Intronic
1126812529 15:52422396-52422418 GTGTTGTAGGGTGGGGAGTAGGG - Intronic
1127142378 15:55991288-55991310 GTGTTTGGGGGTGGGGAGGATGG + Intronic
1127209831 15:56761998-56762020 CTGTTGTAGGGTGGGGTGAGGGG + Intronic
1127371746 15:58347931-58347953 CTGTTGTGGGGTGGGGTGGGGGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128227088 15:66009498-66009520 GTGTCTTAGGGTGAGTTGTAGGG + Intronic
1130010483 15:80149529-80149551 ATGTTGTAGGGTGGGGAGAAGGG - Intergenic
1130264697 15:82389814-82389836 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1131197693 15:90369337-90369359 GTGTTTTGGGGTTGGTTGGTGGG - Intergenic
1131965331 15:97835923-97835945 GTGTTTTTGAGTGCGGAGGATGG - Intergenic
1131966901 15:97853892-97853914 GTGTTCTAGTGTGTTGTGGAAGG - Intergenic
1132260770 15:100422929-100422951 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1132627280 16:897485-897507 GTGTTTACAGGTGGGGAGGAAGG - Intronic
1133981100 16:10633861-10633883 ATGTGTTGGGGTGGGGTGGAGGG - Intronic
1134023625 16:10938694-10938716 GGATTTGAGGGTGGGGAGGAGGG + Intronic
1134092758 16:11400230-11400252 GTGCTTTGGGGAGGGCTGGAAGG - Intronic
1135924920 16:26685202-26685224 CTGTTGTAGGGTGGGGGGGGGGG - Intergenic
1136178927 16:28537917-28537939 GTGTGATTGGGTGGGGAGGAGGG - Intronic
1136676367 16:31911340-31911362 GTGCTTTAGTGTAGGGTGCATGG + Intronic
1137228805 16:46541342-46541364 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1137675646 16:50302556-50302578 GTGGGGTAGGGTGGGGTGGGGGG - Intronic
1137983753 16:53090969-53090991 GTGTTTTGTGGTGTGGAGGATGG + Intronic
1138251716 16:55506855-55506877 GTGGTTTTGGGGGTGGTGGAGGG - Intergenic
1138535033 16:57655331-57655353 GTGTGCTAGGGTGGGGGGCACGG + Intronic
1138616918 16:58175864-58175886 GTGTTGTGGGGTTGGGTGGCTGG + Intronic
1140269702 16:73454176-73454198 GTGTTTTGGGATGGTGTGCATGG + Intergenic
1142287626 16:89177856-89177878 GTGTTTCTGGGTGGGCTGCATGG - Intronic
1142787619 17:2236377-2236399 GTGTTCGGGGGTGGGGTGGGGGG + Intronic
1144744366 17:17603891-17603913 GTGTTTTGGGTTGGGGGTGAGGG - Intergenic
1145996202 17:29106342-29106364 GTCTTTAAGGCAGGGGTGGAGGG + Intronic
1146008732 17:29178401-29178423 GGGTTGTAGGTGGGGGTGGAGGG - Intronic
1146790492 17:35747962-35747984 GAGGTTAAGGGCGGGGTGGAGGG + Intronic
1146890891 17:36505875-36505897 GTGTTTGAGGCTGGGTAGGAAGG + Intronic
1147647700 17:42043614-42043636 GTGGTTTAGGGTGGAGTGGTAGG + Intronic
1147705466 17:42422436-42422458 GTGGGGTAGGATGGGGTGGAGGG - Intronic
1149515202 17:57275888-57275910 GTGTTTGAGTTTGGAGTGGAGGG + Intronic
1149540793 17:57466556-57466578 ATATTTTATGGTGGGGTGGGTGG - Intronic
1151337576 17:73449037-73449059 GTGTTTTGGGGTGTGGTGATGGG + Intronic
1151577351 17:74959397-74959419 GTATTTTGGGGAGGGGTAGAAGG - Intronic
1151952984 17:77365533-77365555 GTGTTCAAGTGTAGGGTGGATGG + Intronic
1152012470 17:77726956-77726978 GTGCTTGAGGCTGGGCTGGAGGG + Intergenic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153408456 18:4766760-4766782 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1153530669 18:6042465-6042487 GTGATTGAGGGTGGGGTAGGTGG - Intronic
1154092589 18:11379077-11379099 GTGTCCGAGGGTGGGGTGGAGGG - Intergenic
1154427217 18:14281220-14281242 GTGGTTTATGGTGGGGGTGAGGG + Intergenic
1154436833 18:14350716-14350738 GTGCTTGAGGGTGGGGGGCAAGG + Intergenic
1155079156 18:22390374-22390396 CTGTTAGGGGGTGGGGTGGAGGG + Intergenic
1156565594 18:38185490-38185512 GTGTGTTGGGGAGGGGGGGAAGG + Intergenic
1157314190 18:46574765-46574787 GTGTCTTATGGTGAGGTTGAGGG - Intronic
1157484597 18:48077968-48077990 GAGTCTTGGGGTGGGGGGGAGGG + Intronic
1157650878 18:49329278-49329300 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1158107876 18:53905683-53905705 CTGCTTTAGGATGGGTTGGAGGG + Intergenic
1158307879 18:56126543-56126565 GTGTTTCAGGGAGAGTTGGAAGG - Intergenic
1158541247 18:58356404-58356426 GTGTACTAGGGTGGAGTGGAGGG - Intronic
1158911534 18:62067968-62067990 GTGTTTTAGGATGAGCGGGAGGG + Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159104554 18:63990664-63990686 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1159432327 18:68369006-68369028 CTGTTTTGGGGTGGTGGGGAAGG + Intergenic
1160485156 18:79284767-79284789 CTGTTGTGGGGTGGGGTGGGGGG - Intronic
1160543117 18:79636142-79636164 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1160744970 19:707014-707036 CTTTTTTTGGCTGGGGTGGACGG - Intergenic
1160910497 19:1471698-1471720 GGGTTTGAGGGTTGGGTGGATGG + Exonic
1161724549 19:5921007-5921029 GTGTGTGAGGGTGGTGTTGAGGG + Intronic
1161917414 19:7239291-7239313 CTGTTTTGGGGTGGGGGGGCTGG - Intronic
1162039261 19:7959888-7959910 GAGGTGGAGGGTGGGGTGGAGGG + Exonic
1163088358 19:14999993-15000015 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163848617 19:19651183-19651205 GTGGTGCAGGATGGGGTGGAGGG + Intronic
1164700715 19:30282050-30282072 GTGATGCAGGGTGGGGAGGAAGG - Intronic
1164940497 19:32249337-32249359 GAGTATCTGGGTGGGGTGGAGGG + Intergenic
1165072836 19:33265457-33265479 GGGTTTCAGGGTGGTGTGGGTGG + Intergenic
1165660042 19:37570105-37570127 GTCTTTTAGGGGAGGGTGGGTGG - Intronic
1165804373 19:38571631-38571653 CTTTTTTTTGGTGGGGTGGACGG - Intronic
1166536987 19:43580626-43580648 GTGGGGTGGGGTGGGGTGGAAGG + Intronic
1167620081 19:50555766-50555788 ATTTTTTGGGGTGGGGTGGGGGG + Intronic
1167667973 19:50833637-50833659 GTGGTGTAGGGTGGGGTGGGAGG + Intronic
925228207 2:2205106-2205128 CTGTTGTGGGGTGGGGTGGGGGG + Intronic
925326551 2:3026526-3026548 GTGATTTAGTGTGTGATGGAGGG + Intergenic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926214424 2:10895392-10895414 GCTTTTTAGGGTGGAGTGGGAGG - Intergenic
926948178 2:18211857-18211879 GTGTTTTAGGGTGAGGAGTTGGG - Intronic
927951345 2:27171863-27171885 TTTTTTTTGGGTGGGGAGGATGG - Intergenic
928082800 2:28325707-28325729 GTGTTTGAGGATGTGGGGGAGGG - Intronic
928723891 2:34149064-34149086 GTCTTTTGGGGTGAGGGGGATGG - Intergenic
929317159 2:40493339-40493361 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
929953858 2:46440270-46440292 GGTTATTGGGGTGGGGTGGAAGG - Intronic
930094092 2:47553398-47553420 GTTTTTTTTGGTGGGGTGGGGGG + Intronic
930290432 2:49486314-49486336 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
931456269 2:62411853-62411875 ATGTTATGGGGTGGGGAGGATGG + Intergenic
931537690 2:63297439-63297461 GTATGTTAGGGTGGAGTGTATGG - Intronic
931846785 2:66212210-66212232 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
932164992 2:69498011-69498033 GTGGGGTGGGGTGGGGTGGAGGG - Intronic
932312463 2:70754709-70754731 GTGACTGAGGCTGGGGTGGAAGG - Intronic
933259517 2:80116313-80116335 GTGTTACAGGGTTGGGTGTAGGG + Intronic
934892849 2:98085979-98086001 TTGTTTTTTGGTGGTGTGGATGG + Intergenic
935493281 2:103746835-103746857 CTGTTTTGGGGTGGGGGGGAGGG - Intergenic
936606536 2:113962909-113962931 GTGTTTGAGGGTGTGTTTGAAGG - Intergenic
937082610 2:119151236-119151258 GTTTTTAAGGTTGGGGTGAAAGG - Intergenic
937959884 2:127449524-127449546 ATGTGTTAGTGAGGGGTGGAGGG + Intronic
938109645 2:128555249-128555271 GAGTTGCAGGGTTGGGTGGAGGG + Intergenic
938191767 2:129289558-129289580 CTGTTGTGGGGTGGGGAGGAGGG - Intergenic
938413393 2:131084192-131084214 CTGTCTTGGGGTGGGGTGGGGGG - Intronic
938882641 2:135606964-135606986 GTTTTTTTGGGTGGGGGGGCGGG + Intronic
939261812 2:139820432-139820454 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
939595367 2:144116289-144116311 GTGTGTTGGGGTGGGGGGGTGGG + Intronic
940033581 2:149289901-149289923 GTGGTGGAGGGAGGGGTGGAGGG + Intergenic
940789282 2:158014775-158014797 GTGTTTTGTTATGGGGTGGAGGG - Intronic
940893656 2:159059587-159059609 GTGTGTCAGGGTGCGGGGGATGG - Intronic
941937585 2:170997368-170997390 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
942891849 2:180999629-180999651 TTTTTTTTGGGAGGGGTGGAGGG - Intronic
943390713 2:187264436-187264458 CTGTTGTGGGGTGAGGTGGAGGG + Intergenic
944059042 2:195552869-195552891 ATGTTTAAGGGTGGTGAGGAAGG - Intergenic
944153891 2:196591630-196591652 GTGGGGTAGGGTGGGGTGGAGGG - Intronic
945102928 2:206279305-206279327 GTGTTTGATGGTGGGTTAGATGG + Intronic
946077863 2:217090481-217090503 GTTTTGTAGGGTGAAGTGGAAGG - Intergenic
946100190 2:217313932-217313954 GTGTGTTTGGGAGGGGAGGAGGG + Intronic
947095146 2:226558172-226558194 GAGTTTTAGGTTGAAGTGGAAGG + Intergenic
947323491 2:228948825-228948847 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
947728831 2:232417149-232417171 CTGGTTTAGGGTGGGGAGGATGG - Intergenic
948210535 2:236189943-236189965 CTATAGTAGGGTGGGGTGGAAGG + Intergenic
948580262 2:238982513-238982535 TTTTTTTTGGGAGGGGTGGAAGG - Intergenic
948617511 2:239210494-239210516 GTGTTTTGGGGAGTGGTGAATGG + Intronic
948765419 2:240216737-240216759 GTGGGGTGGGGTGGGGTGGAAGG + Intergenic
1169141374 20:3229063-3229085 GTGGGTGAGGGTGGGGTGGGCGG - Intronic
1169430494 20:5531913-5531935 GGGCTTGAGGGTGGGGTGGGTGG - Intergenic
1169814222 20:9640208-9640230 CTGTTGTGGGGTGGGGTGGGGGG - Intronic
1170119174 20:12893577-12893599 GTGTTTTTTTGGGGGGTGGAGGG + Intergenic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1170247354 20:14237690-14237712 CTGTTTTGGGGTGGGGGGGAGGG - Intronic
1170277901 20:14613363-14613385 GTATTTTACGGTGGGCTGGAAGG + Intronic
1170593345 20:17787561-17787583 GTGGGGTGGGGTGGGGTGGAGGG - Intergenic
1170605079 20:17869809-17869831 GTGGTCTGGGGTGGGGTGGAGGG - Intergenic
1171321840 20:24252582-24252604 GTGTTTTTGGGGGGGATGCAGGG - Intergenic
1171390135 20:24795926-24795948 GAGTTTTAGAGTGGGGAAGAAGG + Intergenic
1171756127 20:29111538-29111560 CTGTTTTAGGGTGGGGGGAGTGG + Intergenic
1171767504 20:29298079-29298101 GTGTCGTGGGGTGGGCTGGATGG - Intergenic
1171773241 20:29343231-29343253 CTGTTGTGGGGTGGGGTGGGGGG + Intergenic
1172398718 20:34630401-34630423 GGGTTTTTTTGTGGGGTGGAGGG - Intronic
1172601689 20:36188270-36188292 GTGTTTTCGGGGTGGGTGGTAGG + Intronic
1172749275 20:37238550-37238572 GTGGCTTAGGGAGGGGTGGGAGG - Intronic
1172924566 20:38520957-38520979 GTGTTTTGGAGTTGGGTGGGTGG + Intronic
1173617322 20:44411528-44411550 GTGTGGGCGGGTGGGGTGGACGG + Intronic
1173863468 20:46299006-46299028 GTGTTTTAGGATGGACTTGAAGG - Intronic
1174123134 20:48282398-48282420 CGATTTTAGGGTGGGCTGGATGG + Intergenic
1175311509 20:58014974-58014996 TTTTTTTAGGGTGGGGTTGGGGG - Intergenic
1175410852 20:58767728-58767750 GTTTTTTTTGGTGGGGTGGCTGG + Intergenic
1175874203 20:62221762-62221784 GTGAGTTGGGGTGGGGTGCAGGG - Intergenic
1176011457 20:62898694-62898716 GTGTTTTGGGGTGCGGTTGTGGG - Intronic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176840204 21:13834928-13834950 GTGCTTGAGGGTGGGGGGCAAGG - Intergenic
1176870276 21:14078445-14078467 GTTTTCTAGCCTGGGGTGGATGG + Intergenic
1177202197 21:17970188-17970210 GTGTTTGGGGGTTGGGTGGTGGG + Intronic
1177390512 21:20462653-20462675 GGGTTTATGAGTGGGGTGGATGG + Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1177520443 21:22214915-22214937 GTGTATTGGGGTTGGGTGAAGGG - Intergenic
1177708232 21:24736976-24736998 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1178469508 21:32879669-32879691 GTGTTTTTTGGTGGGGTGGGCGG + Intergenic
1179176238 21:39010159-39010181 GTGTTTTGGGGTGGGAGGTAGGG + Intergenic
1179558980 21:42200532-42200554 TGGTTTGGGGGTGGGGTGGAGGG + Intronic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1179902385 21:44400904-44400926 GTGTTTTACTGAGGGCTGGATGG + Intronic
1180413167 22:12635400-12635422 CTGTTTTAGGGTGGGGGAGTGGG + Intergenic
1181974455 22:26719032-26719054 ATATTTTAGGCTGGGGTGCATGG + Intergenic
1182300704 22:29335407-29335429 GGGGGTTAGGGTGGGGTGGGGGG - Intronic
1183109367 22:35637718-35637740 CTGCCTTAGGGTGGGGTGGGAGG - Intronic
1183307134 22:37088594-37088616 GTGGTTGGGGGTGGGGAGGAGGG - Intronic
1183339946 22:37274506-37274528 GTGTCATGGGGTGGGATGGATGG - Intergenic
1183452695 22:37905717-37905739 GTGCTTTAGGGTGGGGAGCCGGG + Intronic
1184555211 22:45229198-45229220 GTGTTTGGTGGTGGGGGGGATGG - Intronic
1184717573 22:46290637-46290659 GTGTGTTAGGGTGGCGTGGCTGG + Intronic
1185118783 22:48953144-48953166 GTTGTTTAATGTGGGGTGGAGGG + Intergenic
1185185857 22:49399646-49399668 GTGTTGTAGAGTGCGGTGCATGG - Intergenic
1185193178 22:49451741-49451763 GTGTTTTGGGCAGGGCTGGAGGG - Intronic
949492726 3:4604974-4604996 TTTTTTTTGGGTGGGGGGGATGG + Intronic
950454406 3:13084093-13084115 GGTTTCTAGGGTGGGGTGGAAGG + Intergenic
950572479 3:13810007-13810029 GGGGTTTGGGGTGGGGTGGGCGG + Intergenic
950667555 3:14506391-14506413 GTCTTGTAGGCTGGGGTGGGAGG + Intronic
950998239 3:17528048-17528070 GTTTTTTAGGGGGGGCTGGGAGG + Intronic
951175129 3:19590403-19590425 CTGTTGTGGGGTGGGGTGGGGGG - Intergenic
951363395 3:21751230-21751252 GTGGGGTGGGGTGGGGTGGAGGG - Exonic
951803318 3:26621590-26621612 TTGATTTAGGGTGTGGTGGAGGG - Intergenic
951830160 3:26917610-26917632 CTGTTGTCGGGTGGGGAGGAGGG - Intergenic
952236132 3:31482054-31482076 GTGTTTTTGGGCGGGGGGGGTGG - Intergenic
952261737 3:31746817-31746839 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
953935374 3:47037278-47037300 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
954384665 3:50237761-50237783 GGGTTTTAGAGTTGGGGGGAGGG + Intronic
954577366 3:51684031-51684053 GGGTCTTATGGTGGGGTGGAAGG + Intronic
956618077 3:71192993-71193015 GTGTTTTAAGTGGGGGAGGAGGG - Intronic
956640632 3:71412331-71412353 GGTTTATAGGGTGGGGTGAAGGG + Intronic
956861908 3:73332994-73333016 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
956976782 3:74589951-74589973 GTGTTGTGGGGTGGGGGGGAGGG + Intergenic
957150317 3:76478175-76478197 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
957367302 3:79242980-79243002 ATGTTGTGGGGTGGGGGGGAGGG - Intronic
957536097 3:81505707-81505729 GTCTGTTAGTGTGTGGTGGAGGG + Intronic
957629697 3:82703303-82703325 GAGTTTTAGGGTGGAGATGATGG + Intergenic
957688096 3:83530299-83530321 GTGTTTGGGGGTAGGGGGGAGGG - Intergenic
957952525 3:87144701-87144723 GTGTCTCAGGGTGGGGGGCAGGG - Intergenic
958027649 3:88067632-88067654 ATGTTTTAGGATGGGGTGAATGG + Intronic
958186379 3:90125261-90125283 CTGTTATGGGGTGGGGGGGAGGG + Intergenic
958635579 3:96739947-96739969 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
959069009 3:101685566-101685588 GCGTTATAGGGCAGGGTGGAAGG - Intronic
959119654 3:102217569-102217591 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
959194448 3:103161008-103161030 GTGTTTTAAGGTATGGTTGATGG + Intergenic
959258238 3:104042047-104042069 CTGTTGTGGGGTGGGGTGGGGGG + Intergenic
959496780 3:107061014-107061036 GTGTTTGAGGGTAGGGAGGAAGG + Intergenic
961095364 3:124150526-124150548 TTGTTGTGGGGTGGGGAGGAGGG - Intronic
961611818 3:128145548-128145570 GAGTGTTGGGGTGGGGTGGATGG + Intronic
961705199 3:128779578-128779600 GTGTGTTGGGGTGGGGTGGGGGG + Intronic
962160934 3:132999662-132999684 CTGTTGTGGGGTGGGGTGGCGGG - Intergenic
962413367 3:135161035-135161057 GTGGCGTTGGGTGGGGTGGATGG + Intronic
962456914 3:135573287-135573309 GTGTTTCAGGGTGGAAGGGATGG - Intergenic
962601701 3:136996040-136996062 GTGGGGTAGGGTGGGGTGAAGGG + Intronic
962833612 3:139166625-139166647 CTGTCATGGGGTGGGGTGGAGGG - Intronic
963266301 3:143243270-143243292 GAGGTATAGGGTGGGGTGGAGGG + Intergenic
964705254 3:159611523-159611545 GTGTTGGGGGGTGGGGGGGAAGG + Intronic
964747912 3:160028985-160029007 TGGTTTTGGGGTGGGGTGGGTGG + Intronic
964939464 3:162138092-162138114 GTGTGTTGGGGTGTGGTGGTGGG + Intergenic
965764110 3:172111613-172111635 CTTTTTTTGGGTGGGATGGAGGG + Intronic
966061624 3:175763815-175763837 GTGTGTTAGAATGGGGAGGAAGG - Intronic
966880116 3:184345316-184345338 CTGTGTGAGGGTGGGGTGGGAGG + Intronic
966937992 3:184726570-184726592 GTGTTGAAGGGTGGGGATGATGG - Intergenic
967088736 3:186117260-186117282 GTGTTACGGGCTGGGGTGGAGGG - Intronic
968373374 4:15945-15967 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
968740840 4:2331020-2331042 GTGTTCTGGGATGGGCTGGAAGG + Intronic
968762228 4:2448699-2448721 GTGTTTGAGGGTGGCCAGGAGGG + Intronic
968938795 4:3627296-3627318 GTGGTTTGGGTTGGGGTGGATGG + Intergenic
969502269 4:7560295-7560317 GTATTATGGGGTGGGATGGAGGG + Intronic
969590492 4:8119174-8119196 GTGTCTCAGGGTGGGGTGTGGGG + Intronic
969702152 4:8773626-8773648 GAGTGCTAGGGTGGGGTGAAGGG + Intergenic
970359013 4:15288599-15288621 GAGTTTTTGTGTGGGGTGTAAGG - Intergenic
971442272 4:26699857-26699879 CTGTTTTGGGGTGGGGGGAAGGG + Intronic
972032196 4:34475727-34475749 CTGTTGTGGGGTGGGGTGTAAGG + Intergenic
972222715 4:36974657-36974679 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
973543292 4:51955757-51955779 GTGTTCTAGTGTTGTGTGGAAGG - Intergenic
973773774 4:54228078-54228100 GTGTGTTGGGGTGGGGTTGAGGG + Intronic
974083705 4:57237756-57237778 GTGGTATAGGGAGGGGTAGAGGG + Intergenic
974335566 4:60540010-60540032 GAGTTTGTGTGTGGGGTGGAGGG - Intergenic
974531269 4:63110805-63110827 CTGTTGGAGGGTGGGGTGCAAGG + Intergenic
974689341 4:65275233-65275255 GTATTTTAGAGTTGGTTGGAAGG + Intergenic
975515304 4:75240831-75240853 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
975722253 4:77259575-77259597 CTGTTGTGGGGTGGGGGGGAAGG + Intronic
975767786 4:77687185-77687207 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
976083972 4:81388441-81388463 CTGTTGTGGGGTGGGGTGCAGGG + Intergenic
980046731 4:127997472-127997494 TTCTTTGAGGGTGGGGTAGAAGG + Intronic
980331055 4:131411831-131411853 GGGTTATAGGGTGGGGAGGGGGG - Intergenic
982109616 4:152041754-152041776 GGATTTTAGGGTGGGGGAGACGG - Intergenic
982510323 4:156274722-156274744 GTGGTTGGGGGTGGGATGGAGGG + Intergenic
983529301 4:168793478-168793500 GTGATTTGGGGTGAGGTGGGAGG - Intronic
984159684 4:176236509-176236531 GTGTATTGGGGTGGGGAGTAGGG + Intronic
985422557 4:189799108-189799130 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
985798413 5:1983512-1983534 GAGTCTTTGGGTGTGGTGGATGG + Intergenic
985929100 5:3042190-3042212 GTGTTGTGGGGTGTGGAGGAAGG + Intergenic
986323224 5:6650790-6650812 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
987948612 5:24648579-24648601 GTGTTTGAGGTAGGAGTGGAGGG + Intergenic
988086564 5:26481894-26481916 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
988667720 5:33348313-33348335 CTGTTGTAGGGTGGGGGGAAGGG - Intergenic
989254193 5:39349015-39349037 ATGTTGTGGGGTGGGGGGGAGGG + Intronic
989578724 5:43012400-43012422 GTTTTTTTGGGTGGGGGAGATGG + Intergenic
989983240 5:50667254-50667276 GTGGCTGGGGGTGGGGTGGAGGG + Intronic
990906654 5:60810789-60810811 TTCTTGTAGGGTAGGGTGGAAGG + Intronic
991232924 5:64358164-64358186 GTGTTTTAGGTTGGGTTCCAAGG - Intronic
993063306 5:83067503-83067525 GTTTTTTGGTGGGGGGTGGAGGG + Intronic
994369834 5:98955440-98955462 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
994526230 5:100908426-100908448 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
995431900 5:112088741-112088763 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
996024047 5:118623597-118623619 CTGTTTTAGGGTGGGGGAGTGGG + Intergenic
996157954 5:120127017-120127039 CTGTTTTCGGGTGGGGTGAGGGG - Intergenic
996952109 5:129139785-129139807 CTGTTTTTGGGTGGGGTGAGGGG - Intergenic
997507848 5:134432504-134432526 GTGGGTTGGGGTGGGGTGAAGGG + Intergenic
997529270 5:134572084-134572106 GTGCTTAAGGGTGTGGGGGAAGG + Intronic
997680834 5:135749583-135749605 TTTTTTTGGGGTGGGGTGGTGGG + Intergenic
997789985 5:136750316-136750338 GTGTTTTAGGGAGGTAGGGATGG - Intergenic
998247506 5:140520773-140520795 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
998541414 5:142985653-142985675 CTGTTGTAGGGTGGGGGGGAGGG - Intronic
998820953 5:146057346-146057368 GTGTTGTGGGGAGAGGTGGAGGG - Intronic
999548118 5:152654107-152654129 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
999764578 5:154729607-154729629 GTGTGTTTGGGTGGAGTGGCTGG - Intronic
1001167835 5:169386987-169387009 CTGTCGTAGGGTGGGGGGGATGG + Intergenic
1001198193 5:169692518-169692540 GTGTGTGGGGGTGGGGTGGCGGG + Intronic
1002117594 5:176975933-176975955 AAATTTTAGGGTGGGGTGTAGGG - Intronic
1002880267 6:1244643-1244665 GTGTTTTATGCTGGGGGAGAGGG + Intergenic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1003273163 6:4624763-4624785 GTGTTTTGGGGTGGGGGGCGGGG + Intergenic
1003738657 6:8908386-8908408 CTGTTTTGGGGTGGGGGGGCGGG - Intergenic
1004194465 6:13490681-13490703 GTGTGTTGGGGTGGGGGGAATGG - Intergenic
1004717709 6:18234181-18234203 CTGTTGTGGGGTGGGGGGGACGG + Intronic
1004858332 6:19774491-19774513 ATGTTGTGGGGTGGGGTGGGGGG + Intergenic
1005177639 6:23064810-23064832 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1005805936 6:29474518-29474540 CTGTTGTGGGGTGGGGTGAAGGG + Intergenic
1006075795 6:31531406-31531428 CTGTTGTGGGGTGGGGTGGGGGG + Intronic
1006296606 6:33172701-33172723 GTGTTTTAGGGTGGCCAGGGTGG - Intronic
1006718047 6:36132516-36132538 GTGTATTAGGAAAGGGTGGATGG + Intronic
1007077408 6:39076672-39076694 GTGTGTGAGGGTGTGGTGGGTGG - Intronic
1008503236 6:52204421-52204443 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1009498234 6:64376924-64376946 GTGTTTTAAGGTGAGGTAGTGGG - Intronic
1009900170 6:69800102-69800124 GTATTTGTGGGTGAGGTGGAGGG - Intergenic
1010877299 6:81123395-81123417 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1010920670 6:81676298-81676320 GATTTTTTGGGTGGGGGGGATGG - Intronic
1011087045 6:83552457-83552479 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1012807892 6:103918023-103918045 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1012974525 6:105765809-105765831 GTGGTTTTTGGTGGGATGGAGGG + Intergenic
1013857434 6:114591262-114591284 ATGCCTTAGCGTGGGGTGGATGG - Intergenic
1013905265 6:115209423-115209445 ATGTTTTAGTGTGGGGTGTATGG + Intergenic
1014775692 6:125507138-125507160 GTGTTCTAGTGTTGTGTGGAAGG + Intergenic
1014973448 6:127848066-127848088 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1015062420 6:128982758-128982780 CTGTTGTGGGGTGGGGTGGGGGG - Intronic
1015080518 6:129219821-129219843 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1015224038 6:130836095-130836117 GAATTTTAGGGTGGGGCTGAGGG - Exonic
1016146766 6:140687450-140687472 GTGTTGTGGGGTGGGGGGAAGGG - Intergenic
1017048898 6:150372311-150372333 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017048926 6:150372437-150372459 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017112114 6:150941750-150941772 GTGGTGTGGGGTGTGGTGGAGGG + Intronic
1017988920 6:159469567-159469589 GTGACTCAGGGTGGGGTGGATGG - Intergenic
1018029946 6:159834011-159834033 CTGTCTTAGGGTAGGGAGGAGGG - Intergenic
1018421306 6:163642958-163642980 GTGTTTTTGGCTGGAGTGAATGG + Intergenic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1018640301 6:165898675-165898697 GTGTTTAGGGGTGGGGAGGTTGG - Intronic
1018871903 6:167790186-167790208 GTGGCTGAGGATGGGGTGGATGG - Intronic
1018963128 6:168462841-168462863 GTGATTTAGTGAGAGGTGGAAGG + Intronic
1019045906 6:169145805-169145827 GTGTTTTCGGGGGGCGGGGAGGG + Intergenic
1019512210 7:1423283-1423305 GTGTCTTAGGGTTGGATGCAGGG - Intergenic
1019609996 7:1931638-1931660 GTGTTGCAGGGTGGGAGGGAGGG - Intronic
1021225338 7:18019980-18020002 GTGTTTTACTGTTGGGTGGAAGG - Intergenic
1021594503 7:22300849-22300871 GTGTGATGGGGTGGGGTGGATGG - Intronic
1022849369 7:34244406-34244428 GTGTTTTTGGGTGGAGAGGAAGG + Intergenic
1022925723 7:35054672-35054694 GTTTTTTTTGGTGGGGGGGATGG - Intergenic
1023618013 7:42040618-42040640 GTGTGTTGGGGTGGGGAGGGTGG - Intronic
1023796648 7:43798969-43798991 GAGTTTCACGGTGGGGTGGGGGG + Intronic
1024667960 7:51564774-51564796 GTTTTATAGGGTGAGGAGGAGGG - Intergenic
1025839847 7:65136188-65136210 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1025883219 7:65559777-65559799 CTGTCTTGGGGTGGGGTGGGGGG + Intergenic
1025886276 7:65597046-65597068 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1025890227 7:65642829-65642851 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1026257356 7:68724021-68724043 GTGTGTTCAGGTGGTGTGGATGG + Intergenic
1027353318 7:77333576-77333598 GTGTTTGAGGGTGGGGTGCCCGG - Intronic
1027967940 7:85038040-85038062 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1028063097 7:86346068-86346090 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1028216641 7:88140948-88140970 GGGTTTTATGGGGAGGTGGAGGG + Intronic
1028410499 7:90525529-90525551 CTGTTGTGGGGTGGGGTGGGGGG - Intronic
1028471795 7:91213883-91213905 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1028986503 7:97013283-97013305 GTGTGTTGGGGCGGGGGGGAGGG - Intergenic
1029045981 7:97629225-97629247 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1029645500 7:101853090-101853112 GATTCTTAGGGTTGGGTGGAGGG - Intronic
1029909371 7:104128672-104128694 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1030415663 7:109239441-109239463 GTGGTTGAGGGTGGGGGGAAAGG + Intergenic
1030525782 7:110653126-110653148 TTCTTTAAGGGTGGGGTGTAAGG + Intergenic
1030590154 7:111470718-111470740 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1030927540 7:115477066-115477088 GTGTGGGGGGGTGGGGTGGAGGG + Intergenic
1031794736 7:126157344-126157366 GTGATGTGGGGTGGGGTGGGTGG - Intergenic
1031811423 7:126374198-126374220 GTTTTTTGGGGTGGGGGGGTGGG - Intergenic
1032847020 7:135759688-135759710 GTGCCTTAGGGTCTGGTGGAGGG + Intergenic
1033342814 7:140505268-140505290 GTGATCTGGGGAGGGGTGGAAGG + Intergenic
1034244838 7:149636405-149636427 GAGGGTGAGGGTGGGGTGGATGG - Intergenic
1034360483 7:150492489-150492511 CTGTTGTAGGGTGGGGGGAAGGG + Intergenic
1034385904 7:150740988-150741010 GTGTTTTAGATGGGGGTAGATGG - Intronic
1034428051 7:151024902-151024924 ATGTTTTTGGGGGGGGTGGCAGG - Intergenic
1035115339 7:156518882-156518904 GTCCTCTAGGGTGGGGTGGCTGG - Intergenic
1035615420 8:996471-996493 TTGTGTTAGGGTGGAGTGGCCGG + Intergenic
1035636926 8:1154779-1154801 TTATTTTAGGGCGGGATGGACGG - Intergenic
1035969108 8:4227902-4227924 GGGATTTAATGTGGGGTGGAGGG - Intronic
1035969134 8:4228016-4228038 GGGATTTAATGTGGGGTGGAGGG - Intronic
1036191382 8:6673832-6673854 GTGTTGCAGGGTGGGGTTGGGGG + Intergenic
1036714233 8:11105752-11105774 GTGCTTGAGGTTGGGGTGGCTGG - Intronic
1037373972 8:18208889-18208911 TTGTTTTAGGGTCTGGCGGAAGG - Intronic
1037681577 8:21102046-21102068 GTGTGTTAGGGTGGGGTTTATGG + Intergenic
1037952820 8:23029776-23029798 GGGTCTTGGGGTGGGGAGGAAGG - Intronic
1038393161 8:27223951-27223973 TTGTTTTACAGTGGGGTGGGAGG - Intergenic
1038618103 8:29114586-29114608 GTGTATTAGGGTCATGTGGAAGG + Intronic
1038691091 8:29764330-29764352 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1039679202 8:39710665-39710687 CTGCTTCAGGGTGGGGTGGGAGG + Intronic
1040279471 8:46031542-46031564 GTTTTTTAGCCTGGGGTGGGTGG + Intergenic
1040280086 8:46036296-46036318 GTGTTCTAGGGTGGGGACGTTGG + Intergenic
1040299332 8:46179858-46179880 GGGCTGTAGGGTGGCGTGGACGG - Intergenic
1040433465 8:47366525-47366547 GTGTTTCAGAGTGGCGAGGAAGG + Intronic
1040506282 8:48051720-48051742 GCGTATTAGGTTGGGGTTGAGGG - Intronic
1040774817 8:51029273-51029295 CTGTTGTGGGGTGGGGGGGATGG - Intergenic
1040791665 8:51237681-51237703 GTGTGTTTGGGTGGGGTTGGGGG - Intergenic
1041103741 8:54421461-54421483 TTTTTTTTGGGTGGGGGGGATGG - Intergenic
1041773360 8:61496789-61496811 GATTTTTATGGTGAGGTGGAAGG + Intronic
1042203785 8:66307660-66307682 CTTTTTTAGGTTGGGATGGATGG - Intergenic
1043789644 8:84448183-84448205 GTGTGGAAGGGTGGGCTGGAGGG - Intronic
1043863004 8:85343147-85343169 GTGTTTTAGGCTGAGGTGGGAGG + Intronic
1043958151 8:86386478-86386500 GTGTGTTTGGGTGGGGGGGCGGG + Intronic
1044173724 8:89089715-89089737 GTGTTGTGGGGTGGGGGGAAGGG + Intergenic
1044321427 8:90806034-90806056 TTGTTTTTGTGTGGGGTGGGGGG + Intronic
1045459250 8:102412297-102412319 GGGTTTTGGGGAGGGGTAGAGGG - Exonic
1045974068 8:108111400-108111422 CTGTTGTGGGGTGGGGGGGATGG - Intergenic
1046386938 8:113518249-113518271 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1046468732 8:114640264-114640286 CTGTTTTGGGGTGGGGGGAAGGG - Intergenic
1046547748 8:115672983-115673005 GGCTTTTAGGGTGGGCTGCAAGG - Intronic
1047712110 8:127562839-127562861 CTGTTGTGGGGTGGGGTGGAGGG - Intergenic
1047727375 8:127695647-127695669 GTGTTTTAGGCTGGGCGTGATGG + Intergenic
1047761925 8:127960932-127960954 GTGTTTGGGGGTGGGGGGGGCGG + Intergenic
1048110220 8:131460069-131460091 CTGTTGTGGGGTGGGGTGGGGGG + Intergenic
1048662570 8:136622026-136622048 GTGTGGTAGGGAGAGGTGGAGGG - Intergenic
1048837786 8:138537625-138537647 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1049609965 8:143550338-143550360 GGGGTTAGGGGTGGGGTGGAGGG - Intergenic
1049689727 8:143953254-143953276 TTGTCTTGGGGTGGGGTGGGGGG - Intronic
1050818396 9:9845486-9845508 GTGTTTGAGGGTGAGGTGGGGGG + Intronic
1050922845 9:11228105-11228127 GTGTTATGGGGTGGGGGGAAGGG + Intergenic
1050941518 9:11465518-11465540 GTGTTTAAGTGTTGGGTTGATGG + Intergenic
1052151903 9:25127416-25127438 GTCTTTCAGAGTGGGGAGGATGG + Intergenic
1052791216 9:32877035-32877057 GGGTTTCGGGGTGGGGTGGGGGG + Intergenic
1052862012 9:33443105-33443127 GTGGCGTGGGGTGGGGTGGAGGG + Intronic
1053225542 9:36352603-36352625 ATGTTAAAGGGTGGGGTGGGAGG - Intronic
1053785659 9:41650868-41650890 GTGTCTCAGGGTGAGGTGGCAGG + Intergenic
1054174378 9:61864834-61864856 GTGTCTCAGGGTGAGGTGGCAGG + Intergenic
1054449233 9:65393879-65393901 GTGTCTCAGGGTGAGGTGGCAGG + Intergenic
1054451944 9:65408024-65408046 GTGGTTTGGGTTAGGGTGGATGG - Intergenic
1054663160 9:67715957-67715979 GTGTCTCAGGGTGAGGTGGCAGG - Intergenic
1055567998 9:77588250-77588272 GGGTGTCAGGGTGTGGTGGATGG - Intronic
1055947125 9:81701735-81701757 CTGTTGTAGGGTGGGGGGAAGGG - Intergenic
1056421254 9:86428762-86428784 ATGTAGTAGGGTGAGGTGGAAGG - Intergenic
1056719389 9:89059532-89059554 GTGGTGTAGGATGTGGTGGAGGG + Intronic
1057070630 9:92096290-92096312 GTGTTTTAGAGGGGTGAGGATGG - Intronic
1057614268 9:96574359-96574381 ATGTTTTTGGGTGTGGGGGAGGG + Intronic
1057922191 9:99105774-99105796 GGGTTTGAGGTTGGGGTGGAAGG + Intronic
1058299267 9:103349730-103349752 GTGTGGTGGGGTGGGGTTGAGGG - Intergenic
1059404596 9:114092115-114092137 GTGTATGGGGGTGGGGTGGGGGG - Intronic
1059487993 9:114642194-114642216 GGGGTTGAGGGTGGGGAGGAAGG - Intronic
1059555092 9:115272677-115272699 TTTTTTTTGGGGGGGGTGGATGG + Intronic
1059852746 9:118362698-118362720 GGATTTTAGGGTGGAGTGGTGGG - Intergenic
1060497371 9:124128410-124128432 GGCTTTGGGGGTGGGGTGGAGGG - Intergenic
1061178176 9:129009600-129009622 GTGTATGAGGGTGGAGTGGCTGG - Intronic
1061300835 9:129704040-129704062 GTGCTTTAGGGTGGGGTCTGTGG + Intronic
1203361940 Un_KI270442v1:223668-223690 GTGTCCCAGGGTGGGGTCGATGG + Intergenic
1203401013 Un_KI270519v1:97270-97292 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186491280 X:9975170-9975192 GTATTTCTGGGCGGGGTGGAGGG + Intergenic
1186892425 X:13972181-13972203 CTGTTGTAGGGTGGGGAGGGGGG - Intergenic
1187559718 X:20390733-20390755 GTTTTTTTGGGTGGGGGAGAGGG - Intergenic
1188760158 X:34017796-34017818 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1189252041 X:39608626-39608648 GTGTGTTGGGGTGGGGGGGTGGG - Intergenic
1189255560 X:39635974-39635996 CTGTTTTGGGGTGGGGTGAGGGG + Intergenic
1189497175 X:41519485-41519507 TTGTTGTAAGGTGGGGTGGGGGG - Intronic
1189693723 X:43642436-43642458 ATGTATTGTGGTGGGGTGGAAGG - Intergenic
1190630899 X:52384847-52384869 CTGTTGTTGGGTGGGGAGGAGGG + Intergenic
1191857134 X:65636155-65636177 ATATTTTCGGGTGGGGTGCAGGG + Intronic
1192011007 X:67272401-67272423 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1192608586 X:72545105-72545127 GTTGTTTTGGGTGGGGTAGAAGG + Intronic
1192909917 X:75592347-75592369 CTGTTTTGGGGTGGGGGGAAGGG + Intergenic
1193031371 X:76901664-76901686 CTGTTGTGGGGAGGGGTGGAGGG + Intergenic
1193400165 X:81032817-81032839 CTGTTTTGGGGTGGGGGGGATGG + Intergenic
1193705758 X:84819134-84819156 CTGTTCTGGGGTGGGGGGGAGGG + Intergenic
1193717988 X:84954093-84954115 CTGTTGTGGGGTGGGGTGGGAGG + Intergenic
1193846887 X:86482984-86483006 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1194385420 X:93246499-93246521 CTGTTCTGGGGTGGGGGGGAGGG - Intergenic
1194727525 X:97415697-97415719 GTGTTGTGGGGTGGGGGGCAGGG + Intronic
1195409201 X:104550614-104550636 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1195425908 X:104730369-104730391 CTGTTCTGGGGTGGGGGGGAGGG - Intronic
1195545257 X:106106292-106106314 CTCTGTTAGGGTGGTGTGGAAGG + Intergenic
1195617288 X:106922381-106922403 GTGTTTTGGGGTGAGGGAGAGGG - Intronic
1195655477 X:107327833-107327855 GTGTGTTAGGGATGGGAGGATGG + Intergenic
1195709551 X:107763204-107763226 AAGTTTAAGGGTGGGGTGGAAGG - Intronic
1196047215 X:111268908-111268930 TTGTTGTAAGGTGGGGAGGAGGG + Intronic
1196140978 X:112263047-112263069 CTGTTTTGGGGTTGGGGGGAGGG + Intergenic
1196337832 X:114559278-114559300 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1196359003 X:114830844-114830866 CTGTTGTGGGGTGGGGGGGAGGG - Intronic
1196621294 X:117827595-117827617 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1196633805 X:117976141-117976163 GTGTTTTAGAGTGCTGAGGATGG - Intronic
1196760187 X:119193956-119193978 CGGTTTTTGGGTGGGGTGGGGGG - Intergenic
1196763933 X:119225863-119225885 GTCTCTGAGGGTGGGGAGGAGGG - Intergenic
1196866800 X:120077834-120077856 GTGTAGTAGGGTGTGGGGGAGGG + Intergenic
1196876299 X:120158447-120158469 GTGTAGTAGGGTGTGGGGGAGGG - Intergenic
1197266523 X:124379925-124379947 GTGTTTTGGCGTGTGGTGGCTGG - Exonic
1197276933 X:124490226-124490248 ATGTCTTTGGGTGAGGTGGAGGG + Intronic
1197920242 X:131584562-131584584 CTGTTGTGGGGTGGGGTGGGGGG + Intergenic
1198646509 X:138812845-138812867 CTGTTACAGGGTGGGGTTGAGGG - Intronic
1198652097 X:138873997-138874019 CTGTTGTGGGGTGGGGGGGAGGG + Intronic
1198689560 X:139265509-139265531 CTGTTGTGGAGTGGGGTGGAGGG + Intergenic
1198818387 X:140617832-140617854 CTGTTGTGGGGTGGGGTGAAGGG - Intergenic
1198980086 X:142385739-142385761 CTGTTGTGGGGTGGGGGGGAGGG - Intergenic
1199895996 X:152128241-152128263 GTGTTCTAGGATGGTGGGGAGGG + Intergenic
1200222758 X:154399643-154399665 GTGTATGTGGGTGGGGTTGAGGG - Intronic
1201225590 Y:11815748-11815770 GCCTTTTAGGGTCTGGTGGAGGG - Intergenic
1201249799 Y:12045354-12045376 CTGTTGTGGGGTGGGGGGGAGGG + Intergenic
1201509468 Y:14742962-14742984 TTTTTTTGGGGTGGGGTTGAGGG - Intronic
1201774675 Y:17649705-17649727 GTGTTCCAGGGTGGGGTCGATGG - Intergenic
1201826881 Y:18256284-18256306 GTGTTCCAGGGTGGGGTCGATGG + Intergenic