ID: 1152262917

View in Genome Browser
Species Human (GRCh38)
Location 17:79276901-79276923
Sequence GACTCAGGGCTGGTACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152262905_1152262917 29 Left 1152262905 17:79276849-79276871 CCCCTCTTGTACAGAAGGGGAAT 0: 1
1: 0
2: 0
3: 8
4: 180
Right 1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 226
1152262907_1152262917 27 Left 1152262907 17:79276851-79276873 CCTCTTGTACAGAAGGGGAATCT 0: 1
1: 0
2: 5
3: 72
4: 796
Right 1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 226
1152262906_1152262917 28 Left 1152262906 17:79276850-79276872 CCCTCTTGTACAGAAGGGGAATC 0: 1
1: 0
2: 2
3: 36
4: 315
Right 1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152262917 Original CRISPR GACTCAGGGCTGGTACAGGC TGG Intronic
900090596 1:918706-918728 GCCTCATGGCTGGGGCAGGCGGG - Intergenic
900502756 1:3014575-3014597 AACTCAGGGCTGGTCCATCCAGG - Intergenic
900659197 1:3774413-3774435 GAGTCCGGGCTGGCTCAGGCCGG + Intronic
901663791 1:10815154-10815176 GCCTCAGAGCTGATGCAGGCTGG - Intergenic
901866374 1:12109616-12109638 TTCTCTGGGCTGGCACAGGCAGG - Exonic
902160079 1:14523005-14523027 GACTCATAGCTCGTACATGCTGG - Intergenic
903348718 1:22704672-22704694 GACTCAGAGCTGGAGGAGGCTGG - Intergenic
903772980 1:25775707-25775729 GAGTCAGGGCTGGAGCATGCAGG + Intronic
904468111 1:30719693-30719715 GCCTCAGGGCGGGTGCAGACAGG - Intronic
905933208 1:41804247-41804269 GAATCCAGGCAGGTACAGGCAGG - Intronic
906467225 1:46093095-46093117 TACTTAGGGCTGGTTCAGGGAGG - Intronic
907349112 1:53811413-53811435 GACTCAGGGCTGTTGCAGGGCGG + Intronic
908801294 1:67883416-67883438 GAGTAAGGGCTGGAACAGGAGGG + Intergenic
909157885 1:72103636-72103658 GACTCAGACCTGTTTCAGGCTGG + Intronic
911210878 1:95136987-95137009 CATTCAGGGCTGGTACATGGCGG + Intronic
913478250 1:119259825-119259847 TCCTCAGGGCTGCTAGAGGCTGG - Intergenic
915906466 1:159881727-159881749 GGCTCAGGTCTGGGAAAGGCAGG - Intronic
916203945 1:162297476-162297498 GTCTCAGGCCTGGCACAGGGAGG - Intronic
916731739 1:167572782-167572804 TACTTAGAGCTGGTACATGCTGG - Intergenic
917121082 1:171645328-171645350 GAGTCAGGGCAGGCACAGGCAGG - Intronic
918761767 1:188419518-188419540 GACTCAGGGAAGGTACCAGCAGG + Intergenic
920680784 1:208070986-208071008 GACTCAGGGCAGGGGCAGGCAGG + Intronic
921762822 1:218936920-218936942 GGCTCTGGGCTGGTACTGGGGGG + Intergenic
922287676 1:224183727-224183749 TACTCAAGGCTGGCACAGCCGGG - Intronic
922673433 1:227532560-227532582 GACTCAGGGCTGTTGGTGGCAGG - Intergenic
922801237 1:228365650-228365672 GGGGCAGGGCTGGGACAGGCTGG - Intronic
924023858 1:239812729-239812751 GGCACAGGGCTGGCACAGGTAGG - Intronic
1063457943 10:6197758-6197780 GTCTCAGGGGTGGCAGAGGCAGG + Intronic
1067030696 10:42877534-42877556 GACACAGGGCTGGTGCAGGGGGG - Intergenic
1067103487 10:43350018-43350040 GCCCCAGGGCTGGTCCAGGCAGG - Intergenic
1067851415 10:49756993-49757015 GAGTCAGGGGTGGCCCAGGCTGG + Intronic
1069897688 10:71689164-71689186 GAGTCAGGGGTGGTAGAGTCAGG + Intronic
1070109333 10:73467800-73467822 GAATCAGGGCTGGTAGAGGGAGG + Intronic
1070874030 10:79784474-79784496 CACTAAGGACTGGCACAGGCTGG - Intergenic
1073650762 10:105355310-105355332 GACTCAGGCTTCGCACAGGCTGG - Intergenic
1075634193 10:124019266-124019288 GTCTCAGGGCTGGGGCTGGCAGG - Intronic
1075730292 10:124631747-124631769 GACCCAGGGCTGGTGCAGAGGGG - Intronic
1076294688 10:129375406-129375428 GACTCAGGCCTGCTCCATGCTGG - Intergenic
1076706430 10:132304465-132304487 GCCTCAGGTCTGGAAGAGGCTGG + Intronic
1077206105 11:1345300-1345322 GTCTCAGGGGTGGCAGAGGCGGG - Intergenic
1081597341 11:44467981-44468003 GCCTCAGAGGAGGTACAGGCAGG + Intergenic
1081693461 11:45093951-45093973 GAGTCAGGGCTGGCACTGGGAGG + Intergenic
1081705788 11:45181251-45181273 AGCTCAGAGCAGGTACAGGCAGG - Intronic
1083714002 11:64565363-64565385 AAGGCAGGGCTGGGACAGGCAGG + Intronic
1083714007 11:64565385-64565407 GAGGCAGAGCTGGGACAGGCAGG + Intronic
1084448333 11:69217559-69217581 GACACATGGCTGGTGCAGGGTGG - Intergenic
1084459001 11:69285911-69285933 GCCTCAGGGCAGGGACAGGTGGG - Intergenic
1084666802 11:70580728-70580750 GAGCCAGGGCTGGGGCAGGCGGG + Intronic
1084760553 11:71268061-71268083 GACTCAAGGCTGGGAGATGCTGG - Intergenic
1086035463 11:82409463-82409485 GGCTCAGAGCTGATACTGGCAGG - Intergenic
1089270272 11:117297082-117297104 GATGCAGGACTGGTCCAGGCTGG + Intronic
1089366778 11:117925556-117925578 CACTCAGGGCTGGTACATAATGG + Intronic
1089638893 11:119833968-119833990 AACTCAGACCTGGGACAGGCTGG + Intergenic
1092069666 12:5622467-5622489 GACTCAGAGCTGCTCCAAGCTGG - Intronic
1095891902 12:47242634-47242656 GCCTTAGGGCTGGTGCAGGTAGG - Intergenic
1102131840 12:110537606-110537628 GTCTCAGGGCTGGGACATGTTGG - Intronic
1102823048 12:115924267-115924289 GACTCACGGCTTCTCCAGGCAGG + Intergenic
1103218558 12:119223757-119223779 GACTCAGGGCAGGGAGAGGAGGG - Intergenic
1106649640 13:31676415-31676437 GACTCAGGTCTGGTGGAAGCAGG - Intergenic
1107891495 13:44918465-44918487 CCCTCAGCGCTGGTCCAGGCTGG + Intergenic
1108131955 13:47310929-47310951 GGCTCTGGGCTGGTACTGGGGGG - Intergenic
1108901357 13:55412250-55412272 AACTAAGGGCTGCCACAGGCTGG + Intergenic
1109111069 13:58318953-58318975 GTCTCTGGGCTGGCACAGGCCGG - Intergenic
1109213613 13:59563230-59563252 GACTCAGGGCTGTTGGGGGCAGG - Intergenic
1112215269 13:97424007-97424029 AGCTGAGGGCTGGTATAGGCAGG - Intergenic
1113534902 13:111058383-111058405 GACTCTGGGCTGGTACTGTGGGG + Intergenic
1116629367 14:47310385-47310407 GACTTAGGGCGGGAACAGCCAGG - Intronic
1118326722 14:64786372-64786394 CATTCAGGGCTGGGACAGGCGGG - Intronic
1121517418 14:94561748-94561770 GACACACAGCTGGTACAGGGCGG + Intronic
1121573627 14:94965836-94965858 GAATCAGGGCTGGAAGATGCAGG - Intergenic
1122787796 14:104171924-104171946 GACTCCGAGCAGGTACGGGCAGG + Exonic
1123096843 14:105770903-105770925 GGCTCCGGGCAGGCACAGGCTGG - Intergenic
1123155217 14:106218353-106218375 GCCTCAGGGCAGGTGCAGACGGG - Intergenic
1124895413 15:33771936-33771958 GGCTCAGAGCTGGTGAAGGCTGG + Exonic
1124910614 15:33916366-33916388 GGCTCTGGGCTGGTACTGGGGGG - Intronic
1125003436 15:34794744-34794766 GGCTCTGGGCTGGTGAAGGCCGG - Exonic
1125885599 15:43226966-43226988 TTCTCTGGGCTGGTCCAGGCCGG - Intergenic
1128066441 15:64767651-64767673 CACTCAAGGCTGGGACATGCTGG - Intronic
1129183275 15:73890282-73890304 GACTCAGAGCTGGTCCTGGATGG - Intergenic
1129747502 15:78034647-78034669 GACTCAGGCTTGCAACAGGCTGG - Intronic
1131074146 15:89484333-89484355 GGCTCAGGGATGGCACAGGAGGG - Intronic
1132829074 16:1918688-1918710 GACGCAGGGCAGGGACAGGGCGG + Intergenic
1135422968 16:22316948-22316970 GGCTCAGGGCTGATCCAGGCTGG - Intronic
1135955948 16:26956290-26956312 GTCCCAGGATTGGTACAGGCTGG - Intergenic
1136083899 16:27870907-27870929 CAGGCAGGGCCGGTACAGGCTGG - Intronic
1137568474 16:49549257-49549279 GACTGAGGGTGGGAACAGGCAGG + Intronic
1137716587 16:50601927-50601949 GACCCAGGGATGGGAGAGGCTGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1139038830 16:62979726-62979748 TACTCAGGGCTGCTTCAAGCGGG + Intergenic
1139430870 16:66910428-66910450 GAGTCAGGGCTGGGGCAGGAGGG + Exonic
1141196072 16:81862226-81862248 GGCTCAGGGCTGGCCCAGCCCGG + Intronic
1141659934 16:85436363-85436385 GACTCAGGGCTAGGATGGGCTGG - Intergenic
1141831019 16:86510111-86510133 GACTCAGGGCTGCTCCCGGCTGG + Intergenic
1142259239 16:89034883-89034905 GCCACAGGGCTTGTAGAGGCAGG + Intergenic
1143283911 17:5774854-5774876 GGGTCTGGGATGGTACAGGCTGG + Intronic
1145742264 17:27285303-27285325 AACTCAGGGCAGTTACATGCAGG - Intergenic
1146613053 17:34325455-34325477 GGCTCTGGGCTGGTACTGGAGGG + Intergenic
1146719483 17:35113704-35113726 GAATCAGGAGTGGTAGAGGCTGG - Intronic
1146972964 17:37087284-37087306 GAGACAGGGCAGGGACAGGCAGG + Exonic
1150224925 17:63519257-63519279 GCATCAGGCCTGGTACAGACAGG - Intronic
1150876478 17:68976491-68976513 GAATGAGGGCTGGTACAGAGGGG - Intronic
1151752395 17:76047138-76047160 GAGTCAGGGCTGTCTCAGGCTGG + Intronic
1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG + Intronic
1152531579 17:80922304-80922326 GACTCAAGGCTGGGACAGTGTGG + Intronic
1152716743 17:81903941-81903963 GCCTCTGGGCTGCTCCAGGCGGG + Intronic
1157409345 18:47450663-47450685 GACCCAGGGTTGGAACAGGAGGG - Intergenic
1157540925 18:48505883-48505905 GGCTCTGGGCTGGTACTGGGAGG - Intergenic
1159964256 18:74580312-74580334 GACTCAGGGGTGGTACCCGTGGG + Intronic
1160682508 19:418213-418235 GACGGTGGGCTGGGACAGGCAGG - Intronic
1160886432 19:1351234-1351256 GATTCAGTTCTGGTTCAGGCTGG + Intergenic
1161421802 19:4179967-4179989 GATTCAGGGCTGGGGCAGGAAGG + Intronic
1162824872 19:13245130-13245152 GACTCTGGGCTGGACGAGGCAGG - Intronic
1163559195 19:18009027-18009049 GACCCAGGGCCGGTGCAGGGTGG - Exonic
1163735945 19:18980819-18980841 GAGCCAGGCCTGGTGCAGGCTGG - Intergenic
1165072151 19:33261719-33261741 TGCTCAGGGCTGGGACAGGAGGG - Intergenic
1165383593 19:35497447-35497469 GGGCCAGGGCTGGCACAGGCTGG + Exonic
1165729012 19:38132359-38132381 GACTCCAGCCTGGTTCAGGCTGG - Intronic
1167698171 19:51026842-51026864 GACTCAGGGCAGGGAAAGGAAGG - Intronic
1167808338 19:51806186-51806208 GACTCATGGCTCGTACCGGAGGG + Intronic
1167826605 19:51979064-51979086 GACTCATAGCTCGTACAGGAGGG - Intronic
1168001140 19:53446955-53446977 GACCCAGGGCTGGGTCAGGAAGG + Intronic
1168279958 19:55300247-55300269 CAGTCAGGACTGTTACAGGCTGG - Intronic
925497879 2:4472516-4472538 GACTCAGGGCAGATACTAGCAGG - Intergenic
925635415 2:5937393-5937415 GACTGAGGCCAGGGACAGGCAGG + Intergenic
925751847 2:7096294-7096316 GGCACAGGGCTGGAAAAGGCCGG + Intergenic
926216270 2:10907396-10907418 GACTCAGTGCTAGAACAGGTGGG - Intergenic
926826452 2:16910318-16910340 GTCTCAGGGGTTGTAGAGGCAGG + Intergenic
927880968 2:26689921-26689943 GACACTGGGCAGGCACAGGCAGG + Intergenic
928928097 2:36598250-36598272 GACCCAGGGTTGGGACAGCCTGG - Intronic
929877258 2:45807053-45807075 GATTCAGGGCTGGCACGGGCTGG + Intronic
931463484 2:62467714-62467736 GATTCAGGGCTGGGAAAGTCAGG + Intergenic
932805955 2:74783637-74783659 GAAACAGGGATGGTACAGGAGGG + Intergenic
934859911 2:97755799-97755821 GACTGAAGGCTGGTAAAGGTTGG + Intergenic
936045464 2:109184469-109184491 GACCCACGGCTGGGACAGACAGG - Intronic
937767655 2:125680343-125680365 GACTCAGGGCTGTTGGGGGCGGG - Intergenic
938124518 2:128662385-128662407 GCCATAGGGCTGGTACATGCTGG - Intergenic
938573608 2:132584548-132584570 GACTCAGGGTGGGTACAGAAAGG - Intronic
940426284 2:153535057-153535079 TTCTCAGGGCTGCTTCAGGCGGG + Intergenic
941512004 2:166423276-166423298 CTCTAATGGCTGGTACAGGCTGG - Exonic
942251012 2:174047851-174047873 GCACCAGGGCTGGCACAGGCTGG - Intergenic
1171543571 20:25984648-25984670 GACTCAGGGCTTTTAGAAGCGGG + Intergenic
1172113463 20:32560829-32560851 GCCTCAGGCCTGGTGCAGGTGGG - Intronic
1175096659 20:56546579-56546601 GACTGAGGACTGTTCCAGGCTGG - Intergenic
1175285256 20:57833461-57833483 AGCTCAGGGCTGGTACCTGCAGG - Intergenic
1175366202 20:58457948-58457970 GACTCTGGGCTGATAAAGGAAGG - Intergenic
1176098743 20:63355645-63355667 GCCTCAGGACTGGTCCAGGCAGG + Intronic
1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG + Intergenic
1178600607 21:33991278-33991300 GACTGAGGTCTGGTAGAAGCAGG + Intergenic
1180706131 22:17811018-17811040 CACTGAGGGCTGCTGCAGGCTGG - Intronic
1181519166 22:23435461-23435483 GAGTCAGGGCTGGGGCATGCAGG + Intergenic
1182340864 22:29619741-29619763 TACTCAGGTCTAGGACAGGCAGG + Intronic
1183364362 22:37399413-37399435 CACTCAGGGGTGGCACAGGAGGG - Intronic
1184357751 22:43993993-43994015 GACACAGGGCTGAATCAGGCAGG + Intronic
1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG + Intergenic
1185103815 22:48856037-48856059 GACTGAGGCCTGGTCCAGGGTGG - Intergenic
1185284855 22:49995620-49995642 GACGTAGGGGTGGTACTGGCTGG + Exonic
1185379693 22:50502737-50502759 GCCTCAGGCCTGGCACAGCCCGG - Intergenic
1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG + Intronic
951062496 3:18225680-18225702 GCTTCAGGGCAGGAACAGGCTGG + Intronic
953060670 3:39426476-39426498 GACACAGGACTGGGACTGGCAGG + Intergenic
953588983 3:44233334-44233356 GTCACAGGGCTGGTAAATGCTGG + Intergenic
955285370 3:57635842-57635864 AACTCAGGGGTGGCAGAGGCAGG - Intronic
955860039 3:63319059-63319081 GGCTCTGGGCTGGTACTGGGAGG + Intronic
956936955 3:74113505-74113527 GACTCATGGCTGATATTGGCAGG - Intergenic
960756530 3:121019613-121019635 GGCTCTGGGCTGGTACTGGGTGG - Intronic
961330617 3:126135889-126135911 CACTCAGGGCAGGAACAGGGTGG - Intronic
965335897 3:167430652-167430674 GTCTCAGGGCTGCTTCAAGCGGG - Intergenic
965540315 3:169865330-169865352 GAGTCAGGGCTGCTACAGCTAGG + Intronic
965625706 3:170682359-170682381 TTCTCAGGGCTGCTTCAGGCAGG + Intronic
973808826 4:54550561-54550583 GATTCAGGGCTGATAAAAGCTGG - Intergenic
976321194 4:83717930-83717952 GTCTCAGGGGTGGTAGAAGCAGG - Intergenic
977010698 4:91629121-91629143 TACTCAGGGCTGCTTCAAGCGGG - Intergenic
979944939 4:126816878-126816900 GTCTGAGGGCTGGTATAGGATGG + Intergenic
981809050 4:148752555-148752577 GACTCATGGCTGTTACACGTTGG - Intergenic
990770718 5:59241344-59241366 CAGCCATGGCTGGTACAGGCGGG - Intronic
995767658 5:115636422-115636444 GACTCAGGTCTGGAACTGGATGG + Intergenic
998847724 5:146326954-146326976 GACACAGGGTGGGTATAGGCAGG - Intronic
999701229 5:154230403-154230425 CACTTAGGGCTTCTACAGGCAGG - Intronic
999760613 5:154697748-154697770 GACTTGGGGCTGGTGCAGGGGGG + Intergenic
999879659 5:155847738-155847760 GACTGAGGGCTGGAACAGGTGGG - Intergenic
1000109749 5:158096731-158096753 GACCCAGGGCTGGAAAGGGCTGG + Intergenic
1001003560 5:168030066-168030088 GACACAGGGCAGGTACTGGATGG + Intronic
1001879877 5:175234120-175234142 GACACAGGGCTGGGAAAAGCAGG + Intergenic
1002299059 5:178247409-178247431 GACTCAGGGATGGGCCAGGGCGG + Intronic
1004454852 6:15782918-15782940 GTCTCAGGGGTGGCAGAGGCAGG + Intergenic
1005785919 6:29246022-29246044 TTCTCAGGGCTGCTTCAGGCAGG + Intergenic
1006498244 6:34439814-34439836 GAAGCAGGGCTGGCAGAGGCTGG - Intergenic
1007501651 6:42302978-42303000 GACTCAGGGCTTCTAAAGACAGG + Intronic
1008761485 6:54857296-54857318 GACTCAGAGGTGGGACAGGAGGG + Intronic
1008778180 6:55066660-55066682 GACTCATGGGTTGTACAGGCTGG + Intergenic
1009901241 6:69810221-69810243 GTCTCAGGGTTGGTAGAGGCAGG - Intergenic
1010092605 6:72002701-72002723 AACTCAGGGCAGGATCAGGCAGG + Intronic
1011570779 6:88732078-88732100 GTCTCAGGGGTGGCAGAGGCAGG + Intronic
1013450769 6:110278466-110278488 GTCTCAGGCCTAGTACAGCCAGG - Intronic
1015190069 6:130462871-130462893 GACTCAGCACTGGGACAGCCAGG - Intergenic
1017648730 6:156562413-156562435 GAGTCAGGGCTGCAACAGCCAGG + Intergenic
1019592115 7:1840865-1840887 GAGTCAGGGCTGGGGCATGCAGG - Intronic
1019940139 7:4283035-4283057 GACTCAGGGGTGGGACAGGCAGG - Intergenic
1022408842 7:30120287-30120309 GAATCAGGGCTGCTACATGGTGG + Intronic
1023166457 7:37348072-37348094 GACTCAGGGCCGCGGCAGGCAGG + Intronic
1023489759 7:40726462-40726484 GTCTCAGGGGTGGCAGAGGCGGG + Intronic
1025296896 7:57782608-57782630 GACTCTGGGCTGCAAGAGGCTGG + Intergenic
1025946301 7:66107475-66107497 GGCTGAGGGCTGGGACAGACAGG + Intronic
1027402447 7:77822653-77822675 GACTCTGGGCTGATCCAGTCTGG + Intronic
1029278015 7:99419004-99419026 GCCTCTGGGCTGGTACACTCTGG - Exonic
1029351092 7:100013461-100013483 GTCTCAGGGGTGGCAGAGGCAGG - Intergenic
1029745752 7:102514900-102514922 GAGGCAGGGCAGGAACAGGCAGG + Intronic
1029763690 7:102613879-102613901 GAGGCAGGGCAGGAACAGGCAGG + Intronic
1031526226 7:122823868-122823890 GACTCAGGGGTTGTGCAGGAGGG + Intronic
1032084612 7:128877396-128877418 GGCTCAGGGCAGGACCAGGCCGG - Intronic
1034081843 7:148286151-148286173 GTCTCAGGGTTGGCAGAGGCAGG + Intronic
1035860770 8:3025988-3026010 GACTCAGGGGTGGGACACGTAGG - Intronic
1035931312 8:3783392-3783414 GACCCACGGCTGGCACAGTCAGG + Intronic
1037492347 8:19408275-19408297 GACTCAGGGCTGGACCAAGAGGG - Intronic
1038186078 8:25276169-25276191 GGCTCAGAGCTGGTAAATGCAGG - Intronic
1038361079 8:26878190-26878212 TGCTCAGGGTTGGTACAAGCTGG - Intergenic
1039410735 8:37353045-37353067 GGCTCAGGGCTGGAAGAGGGAGG + Intergenic
1041174301 8:55177933-55177955 GAGTCAAGGCTGGTCCTGGCAGG - Intronic
1042260727 8:66856618-66856640 GGCTCATGGCTGGTACTGACAGG - Intronic
1044635842 8:94323093-94323115 GACTCAGAGTAGGTAGAGGCTGG - Intergenic
1045645269 8:104291553-104291575 TTCTCAGGGCTGCTTCAGGCGGG - Intergenic
1045790010 8:105972536-105972558 GACTCAGGGCTGCCACACACGGG - Intergenic
1049403911 8:142443207-142443229 GGGTGAGGGCTGGAACAGGCTGG + Intergenic
1049411793 8:142476900-142476922 GGCCCAGGGATGGCACAGGCCGG + Intronic
1049623913 8:143611676-143611698 GACTCAGTGCCGGGACAGGGAGG + Intergenic
1053437995 9:38089997-38090019 GGCCCAGAGCTGCTACAGGCTGG - Intergenic
1054346318 9:63968766-63968788 GACTCCAGGCTGGTACTGGGGGG + Intergenic
1054444094 9:65295416-65295438 GACTCCAGGCTGGTACTGGGGGG + Intergenic
1054486177 9:65726089-65726111 GACTCCAGGCTGGTACTGGGGGG - Intronic
1055891600 9:81129963-81129985 GTCTCAGGGATGGCAGAGGCAGG - Intergenic
1057189333 9:93077755-93077777 GTCTCAGGGGTGGTACGGGTAGG - Intronic
1057206015 9:93173168-93173190 GACTCAGGCCTGGGGCTGGCAGG - Intergenic
1057834578 9:98434025-98434047 GACTGAGGGCTGGGAAAGGTGGG + Intronic
1060212171 9:121717287-121717309 ATCTCAGGGCAGGTACAGACAGG + Intronic
1060547524 9:124470025-124470047 GAGGCAGGGCTGGGAAAGGCCGG - Intronic
1062190759 9:135246763-135246785 GACTATGGGATGGTAAAGGCAGG + Intergenic
1062376479 9:136264050-136264072 CACGCAGGGCTGGCACAGGCTGG + Intergenic
1062676914 9:137752129-137752151 GACCGAGTGCTGGTCCAGGCAGG - Intronic
1189567265 X:42255487-42255509 GACTCTGGGCTGGTACTGGGGGG - Intergenic
1192452400 X:71252544-71252566 GAATCAGGGCTGGGAGAGGGTGG - Intronic
1192770191 X:74180974-74180996 GACTCATGGCTCGTACCGGAGGG - Intergenic
1192820280 X:74637491-74637513 GACTCCAGGCTGGTACTGGGGGG - Intergenic
1196047877 X:111275045-111275067 GACTCAGGGCTGGAAAAGGTTGG + Intergenic
1196073492 X:111549095-111549117 TTCTCAGGGCTGCTTCAGGCAGG - Intergenic
1200165363 X:154031669-154031691 GAGTCAGGCCTGGTACAGAAGGG + Intronic
1200738513 Y:6827849-6827871 AACTCAGTACTGCTACAGGCGGG - Intergenic