ID: 1152263065

View in Genome Browser
Species Human (GRCh38)
Location 17:79277680-79277702
Sequence AAGGGTCAAGTCACTGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152263060_1152263065 -2 Left 1152263060 17:79277659-79277681 CCTTGAAAACTCCACTGGGTCAA 0: 1
1: 0
2: 2
3: 15
4: 122
Right 1152263065 17:79277680-79277702 AAGGGTCAAGTCACTGTTGCGGG 0: 1
1: 0
2: 1
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152263065 Original CRISPR AAGGGTCAAGTCACTGTTGC GGG Intronic
905507984 1:38495239-38495261 AAGCCTCAAGTCAGTGTGGCAGG - Intergenic
905961464 1:42045886-42045908 AAGGGTTGAGTAACTGGTGCTGG + Intergenic
906818907 1:48908243-48908265 AAGGGTCAACTCACTCTCACAGG + Intronic
909662315 1:78097742-78097764 AAGGCTCAATTGACTGTTTCTGG - Intronic
910707157 1:90141969-90141991 AAGAGTCAAGTCTTTTTTGCAGG - Intergenic
911112181 1:94201170-94201192 AAGGGTCAAATCAATGATGTCGG + Intronic
911129910 1:94377240-94377262 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
915160701 1:153918088-153918110 AAGGAGCAAGTCAGTGTGGCTGG + Intronic
916579885 1:166097496-166097518 AAGGGTCTGGGGACTGTTGCGGG + Intronic
916939384 1:169663589-169663611 CAGGGTCCAGGGACTGTTGCGGG + Intronic
916939396 1:169663669-169663691 CAGGGTCCAGGGACTGTTGCAGG + Intronic
917036579 1:170753799-170753821 AAGGATCAAATCACTGATGCAGG + Intergenic
922868065 1:228877300-228877322 CAGAGTGCAGTCACTGTTGCAGG - Intergenic
923465517 1:234244905-234244927 AATGATCAAGTCACTATTGGGGG + Intronic
1062806467 10:423756-423778 AAGGATCAAGACACTGATGATGG + Intronic
1064603690 10:17017186-17017208 CAGGGTCCAGGGACTGTTGCGGG - Intronic
1065082287 10:22140457-22140479 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1065295814 10:24273865-24273887 AAAGTCCAAGTTACTGTTGCAGG + Intronic
1069137461 10:64783234-64783256 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1072371767 10:94771715-94771737 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1073189670 10:101642480-101642502 AAGGGGCAGCTCACTGTGGCAGG - Intronic
1073726945 10:106243801-106243823 AAGACTCCACTCACTGTTGCTGG + Intergenic
1075328292 10:121552801-121552823 AATGTTCAAGTCCCTGTTGGTGG - Intronic
1076242188 10:128916907-128916929 AAGTGGCAAGTCACTGAAGCAGG + Intergenic
1077864989 11:6214732-6214754 CAGTGTCAAGTCCCTGCTGCAGG - Exonic
1079731358 11:23940010-23940032 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1081466736 11:43326225-43326247 CAAGGTCAAGACACTTTTGCAGG - Intronic
1081789533 11:45773271-45773293 TAGGGTGAAGTCACTGTTTATGG - Intergenic
1083662731 11:64259261-64259283 TAGGGTCAAGTCAGGGTGGCGGG - Intronic
1084210877 11:67621680-67621702 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1084945883 11:72638193-72638215 AAGGGTCAGGTGACTGGTGCAGG - Intronic
1087074891 11:94119835-94119857 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1087459116 11:98423426-98423448 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1088831739 11:113542514-113542536 AAGTGTCAAGGCCCTGTGGCAGG - Intergenic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1089776436 11:120840104-120840126 AAGGGCCAGGTCTCTGGTGCAGG + Intronic
1090311617 11:125746304-125746326 AATGGACAAGTCCCTCTTGCTGG + Exonic
1093323229 12:17739910-17739932 GAGGTTCAACTCACTGTTGCTGG - Intergenic
1094338230 12:29384186-29384208 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1095231168 12:39741912-39741934 AAGGGTTAAGTCACATCTGCAGG - Intronic
1097336814 12:58393011-58393033 AAGGGTAATGTTGCTGTTGCTGG + Intergenic
1101704767 12:107211498-107211520 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1102586531 12:113926907-113926929 AAGGGTCAAGTAGGTGGTGCTGG + Intronic
1103285286 12:119796002-119796024 CAGGGGCAAGGCACTGTTTCAGG + Intronic
1103609910 12:122116957-122116979 CAGGGTGAAGTCACCATTGCAGG + Intronic
1105202011 13:18189302-18189324 AAGGGTCAGGTCACTTTCGAAGG - Intergenic
1107741818 13:43458663-43458685 AGGGGTCAAGAAACTGATGCTGG - Intronic
1109500928 13:63235523-63235545 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1111372427 13:87335169-87335191 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112519004 13:100079923-100079945 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1112526076 13:100148484-100148506 AAGAGTCATGTCAGTGTAGCTGG - Intronic
1114541968 14:23467604-23467626 CAGGTTCAAGTCACCGTTCCTGG + Intergenic
1117635231 14:57735990-57736012 CAGGCACAAGTCACTGTTCCTGG + Intronic
1121894313 14:97631440-97631462 AAGTGTCTACTCACTATTGCTGG + Intergenic
1121995885 14:98602584-98602606 AACAGTCAAGTCACAGGTGCAGG - Intergenic
1126681231 15:51204102-51204124 AAGTCTCAAGTCACTGTTCTTGG + Intergenic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1130232630 15:82108589-82108611 TAGGGCCAAGTGGCTGTTGCTGG + Intergenic
1134663384 16:16001038-16001060 AATGTTCTAGACACTGTTGCAGG - Intronic
1135199912 16:20428410-20428432 AAGGGACAAGGCACTGATGATGG + Intronic
1135218791 16:20595200-20595222 AAGGGACAAGGCACTGATGATGG - Intergenic
1136688086 16:32007797-32007819 AAGGGGCAAGGCACGGCTGCTGG - Intergenic
1139603733 16:68002939-68002961 TAGGGTGAAGTCAATATTGCAGG + Intronic
1144145034 17:12389210-12389232 AAGAGTGAGGTCAATGTTGCTGG + Intergenic
1144965293 17:19073494-19073516 AAGGAGCAGGTCACTGCTGCAGG - Intergenic
1144982674 17:19178689-19178711 AAGGAGCAGGTCACTGCTGCAGG + Intergenic
1144985549 17:19199550-19199572 AAGGAGCAGGTCACTGCTGCAGG - Intergenic
1146612439 17:34319667-34319689 AAGGCTCAGGTCACTGAGGCTGG + Intronic
1148368456 17:47074332-47074354 AAGGGTCAAGCCAGTGCTTCTGG + Intergenic
1149086922 17:52729073-52729095 AAGGATCCAGTCACTGTTTTGGG + Intergenic
1150965605 17:69964544-69964566 AGGACTCAACTCACTGTTGCTGG - Intergenic
1151689807 17:75675635-75675657 CAGGCACAAGTCACTGTGGCCGG - Intronic
1152263065 17:79277680-79277702 AAGGGTCAAGTCACTGTTGCGGG + Intronic
1156862375 18:41852887-41852909 AAGAGTCAAGTGACTTTTTCAGG - Intergenic
1156974011 18:43194375-43194397 AAGGGTTAAGTCACGCCTGCTGG - Intergenic
1157469865 18:47980772-47980794 AAGGCTGAAGTCACTCTTGCTGG - Intergenic
1157556637 18:48617240-48617262 AAGACTCAATGCACTGTTGCTGG - Intronic
1158066337 18:53413865-53413887 AAGGATCAGGTCATTCTTGCTGG + Intronic
1159278448 18:66251222-66251244 AAGGGACAAGTCAGAGTTGCAGG - Intergenic
1161598348 19:5164287-5164309 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1162004334 19:7767674-7767696 AAAGCTCAAGTCAGAGTTGCAGG - Intronic
1162844910 19:13384839-13384861 CAGGGTCACGTCAGTCTTGCGGG + Intronic
1164993092 19:32698616-32698638 CAGGGTCCAGGGACTGTTGCGGG - Intronic
925811128 2:7701940-7701962 AAGGATTAAGTCACGCTTGCAGG + Intergenic
925950011 2:8901067-8901089 CAGGGTCCAGGGACTGTTGCAGG - Intronic
925950036 2:8901226-8901248 CAGGGTCCAGGGACTGTTGCAGG - Intronic
928898927 2:36297080-36297102 ATGTGTCAGGTCCCTGTTGCAGG + Intergenic
929330237 2:40673640-40673662 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
932542108 2:72665451-72665473 AAGGGTCAAGTCACTTATAAAGG + Intronic
941243284 2:163068320-163068342 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
941374730 2:164713500-164713522 AAGGTACAAGTTACTGTTGGTGG - Intronic
942255951 2:174098010-174098032 AAAGGGAAAGTCACTGTTTCTGG + Intronic
942625372 2:177894711-177894733 AAGGGTTAAGTCATTCCTGCAGG + Intronic
943103193 2:183511300-183511322 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
946207491 2:218120377-218120399 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1168803739 20:661059-661081 TAGGGGCAAGTCACTGTTTTTGG + Intronic
1169901568 20:10557962-10557984 AAGGGGCAGGTCGCTGTAGCAGG + Intronic
1170876293 20:20253405-20253427 AAGGCTCATCTCACTGTGGCAGG + Intronic
1172156551 20:32829758-32829780 AAGGCTCAGCTCACTGTTGGGGG - Intronic
1172757246 20:37294568-37294590 AAGGGCCAAGTCCCTGAGGCAGG - Intronic
1172875164 20:38159748-38159770 AAAGGTCAAGTCACTGGCTCAGG - Intronic
1173085332 20:39910664-39910686 AAGACTGAAGGCACTGTTGCTGG + Intergenic
1173370748 20:42432636-42432658 AAGGGTTAAGTCACAGCTGCAGG + Intronic
1174665532 20:52254360-52254382 AAGGAGGAAGTCACTGTGGCTGG - Intergenic
1176360653 21:5994598-5994620 AAAGGTGTAGTGACTGTTGCTGG + Intergenic
1176715940 21:10348704-10348726 AAGGGTCAGGTCACTTTCGAAGG + Intergenic
1179762865 21:43543952-43543974 AAAGGTGTAGTGACTGTTGCTGG - Intronic
1180718807 22:17891520-17891542 AAGGGCCAAGCCACTTTTCCAGG + Exonic
1184204780 22:42994963-42994985 AACGGGCAAGGCACAGTTGCGGG - Intronic
1184976804 22:48068025-48068047 AAGGGCCAAGCCAGTGTTCCTGG - Intergenic
952452886 3:33448199-33448221 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
952555182 3:34522742-34522764 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
953623075 3:44549280-44549302 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
954598793 3:51851805-51851827 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
961057888 3:123804372-123804394 AAGGGTCACCTCTCTGTGGCAGG + Intronic
961093703 3:124137284-124137306 AAGTGTTAAGTGATTGTTGCAGG + Intronic
962457126 3:135574881-135574903 AAGGGTGAAGACACTGTGGAAGG - Intergenic
964064368 3:152561459-152561481 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
968484881 4:854708-854730 ATGGGAGAAGTCACTGTTCCTGG - Intronic
970580655 4:17471412-17471434 AAGTGTTAGGTCACTGGTGCAGG + Intronic
972767469 4:42165076-42165098 GTGTCTCAAGTCACTGTTGCAGG - Intergenic
975047864 4:69826490-69826512 CAGGGTCCAGGGACTGTTGCGGG + Intronic
975595995 4:76048615-76048637 CAGGGTCCAGAGACTGTTGCGGG - Intronic
976574031 4:86648162-86648184 AATGGTCAAGTCAGGGTAGCTGG + Intronic
978260600 4:106752833-106752855 AAGGGTGAATTCACTATTGAGGG + Intergenic
981546408 4:145898679-145898701 AAGTGTCACGTCTCTCTTGCAGG + Intronic
984670429 4:182478574-182478596 AAGAGTCAAGTCACTGTATAAGG - Intronic
984782120 4:183535296-183535318 AAGTTTCAAGTCGCTGTGGCAGG + Intergenic
984874520 4:184355374-184355396 CTGGGTAAAGTCATTGTTGCTGG + Intergenic
984906886 4:184636749-184636771 AAAGGTCAAGTCACGCTTTCAGG - Intronic
985636710 5:1039244-1039266 AAGGGTCAGGAGACGGTTGCAGG + Intergenic
987261624 5:16210176-16210198 AAGGCCAAAGTCACTGTGGCAGG + Intergenic
988605646 5:32676414-32676436 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
988850396 5:35174737-35174759 AAGGGTAAAGTCAAGGTGGCTGG - Intronic
988941986 5:36156190-36156212 AAGGGTGAAATCAGTGATGCAGG + Intronic
990987813 5:61657041-61657063 AAGGGCCAACTCACTGTTTAAGG + Intronic
992290571 5:75275223-75275245 AAGGGTGAAGTGACAGTTGGGGG - Intergenic
993650559 5:90515958-90515980 AAGGATCTAGTCAGTGTTACAGG - Exonic
994152595 5:96465599-96465621 AAGGATCAAGTCAGTGTAACTGG + Intergenic
994471333 5:100211786-100211808 AAGGGTCAGGTCACTTCTGTAGG - Intergenic
996680237 5:126222950-126222972 GAGGGTCCAGGGACTGTTGCAGG + Intergenic
998383274 5:141741213-141741235 AAGGCTCAAGCCACTCTTCCTGG + Intergenic
999182501 5:149680060-149680082 AAGGGCCAAGTCATTGTTGTGGG - Intergenic
1000419454 5:161021660-161021682 ATGGTTGAAGTCACTGTAGCAGG + Intergenic
1000920032 5:167127450-167127472 ATGCATCAAGTCACTCTTGCAGG - Intergenic
1004262808 6:14123022-14123044 AAAGGTCAAGTCATTGTTGCTGG - Intronic
1012603161 6:101123032-101123054 AGGGGTTAAGTCACTTTTGCAGG + Intergenic
1015896357 6:138020697-138020719 AAAGCTCAACTCACTATTGCTGG - Intergenic
1016984889 6:149887700-149887722 AGGGTTCAAGTCACAGTTCCTGG - Intronic
1017350213 6:153432255-153432277 CAGGATCAAGTCACTGTGTCTGG + Intergenic
1019269427 7:138768-138790 AAGGGTAAAGTCACACCTGCAGG - Intergenic
1019786199 7:2979102-2979124 CAGGGTCTTCTCACTGTTGCTGG - Intronic
1023121633 7:36915206-36915228 CAGGCTCAAGTCACTGTGCCTGG + Intronic
1026786674 7:73305993-73306015 CAGGGACCAGCCACTGTTGCTGG + Intronic
1026847355 7:73705552-73705574 AAGCATCAAGTCACTGTTCCCGG - Intronic
1026865102 7:73818831-73818853 CAGGCTCAAGCCACTGTTCCCGG + Intronic
1028149138 7:87351935-87351957 AAGGGTTAAGTCTCTATTGCAGG - Intronic
1031731616 7:125309399-125309421 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1031731627 7:125309479-125309501 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1031838058 7:126702982-126703004 AAGAATAAAGTCACTGTTGCTGG + Intronic
1031950871 7:127890904-127890926 CAGGGTCATTGCACTGTTGCAGG + Intronic
1039693328 8:39883838-39883860 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1040278530 8:46026014-46026036 AAGGCCCAAGTCACTGCTGGGGG + Intergenic
1041769865 8:61461204-61461226 AAGGGACAAGACAATGTTGATGG - Intronic
1045680555 8:104655133-104655155 AAAGGTTAAGTCACACTTGCAGG + Intronic
1045989300 8:108286986-108287008 AAGGTTAAAGTCACTGTGGATGG - Intronic
1046051936 8:109033784-109033806 ATGGGTCATGTTAGTGTTGCTGG + Intergenic
1046857986 8:119056549-119056571 AAGGGAGAAGTCATGGTTGCTGG + Intronic
1053185178 9:36010058-36010080 AAGGATCAAGTCAGTGTAGTTGG + Intergenic
1055432080 9:76254276-76254298 ATGGGTCATGGGACTGTTGCTGG + Intronic
1056770114 9:89472200-89472222 AAGGGTGAAGTCACTGGTGGAGG + Intronic
1056966429 9:91166350-91166372 CAGGGTGGAGTCTCTGTTGCTGG - Intergenic
1056968758 9:91185621-91185643 AAGGTTCAGGTCACAGATGCCGG + Intergenic
1058372447 9:104285448-104285470 AAGGCTGATGTCACTGTTACTGG - Intergenic
1058463611 9:105206829-105206851 AAGAGCCAAGACAATGTTGCTGG + Intergenic
1061027990 9:128062999-128063021 TAGGGTAATGTCACTGATGCTGG - Exonic
1061452484 9:130675889-130675911 AAGGGTCAGGACAATGTTGGAGG + Intronic
1062446015 9:136595277-136595299 GAGGCTGAAGTCACTTTTGCAGG - Intergenic
1186224133 X:7379079-7379101 AAGACTCAATGCACTGTTGCTGG - Intergenic
1188136364 X:26499122-26499144 AAGGGTCCAGGGACTGTTGCAGG + Intergenic
1188937071 X:36189534-36189556 AAGGATCAAGTCACTAAGGCTGG + Intergenic
1190541297 X:51481279-51481301 TAGGGTCCAGGGACTGTTGCGGG + Intergenic
1192846878 X:74915452-74915474 AAAAGTCAAGTCACTGTGGTAGG + Intronic
1195439416 X:104884405-104884427 CAGGGTCCAGGGACTGTTGCAGG + Intronic
1195687638 X:107600938-107600960 AAGAGTCTAGTCACTGCTGGTGG + Exonic
1196488830 X:116245152-116245174 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1199246458 X:145610899-145610921 AGTGGTCAAGTCCCTGTTTCTGG - Intergenic
1201516111 Y:14820051-14820073 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1201631106 Y:16072828-16072850 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1202146842 Y:21807284-21807306 CAGGGTCCAGTGACTGTTGTGGG - Intergenic