ID: 1152264676

View in Genome Browser
Species Human (GRCh38)
Location 17:79287412-79287434
Sequence CATTGAGTGGGGGGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 11, 3: 15, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152264669_1152264676 -6 Left 1152264669 17:79287395-79287417 CCTCTTGAGTAGGTTTGCATTGA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1152264676 17:79287412-79287434 CATTGAGTGGGGGGTAGAGTGGG 0: 1
1: 1
2: 11
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152264676 Original CRISPR CATTGAGTGGGGGGTAGAGT GGG Intronic
900034324 1:394303-394325 CATTGGGTGGGGGGTGGAGTGGG + Intergenic
900055158 1:624195-624217 CATTGGGTGGGGGGTGGAGTGGG + Intergenic
903054391 1:20625403-20625425 CATTGACTGGGGGGTCCAGGTGG + Intergenic
907383069 1:54107479-54107501 CTTTGAGTGAGGGTTAGATTTGG - Intronic
908963042 1:69725242-69725264 CATTGAGTAGGGGGAGGAGGAGG + Intronic
910130630 1:83901145-83901167 AATTGGGTGGGGGATAGAGGAGG - Intronic
913190259 1:116407354-116407376 AATTGGGTGGGGGGCAGAGCAGG - Intronic
913670726 1:121095266-121095288 CATGGAGTGGAGGGAAGAGTGGG - Intronic
914022489 1:143882691-143882713 CATGGAGTGGAGGGAAGAGTGGG - Intergenic
914660973 1:149790633-149790655 CATGGAGTGGAGGGAAGAGTGGG - Intronic
915557156 1:156667233-156667255 CCCTGTGTGGGGGGTAGGGTGGG + Intergenic
915714207 1:157929320-157929342 CATTGAGTGGGGGGCATTGGTGG + Intergenic
916495581 1:165343991-165344013 CTTTGAGTGCAGGCTAGAGTTGG - Intronic
917463221 1:175250456-175250478 CAGTGAGGGAGAGGTAGAGTTGG + Intergenic
917734961 1:177911900-177911922 GATTGAATGGAGGGAAGAGTTGG - Intergenic
918098315 1:181352308-181352330 AAGTGAGTGGGGGTGAGAGTGGG + Intergenic
922256677 1:223898500-223898522 CATTGGGTGGGGGGTAGAGTGGG + Intergenic
923373846 1:233340301-233340323 GATTGAGTGGGAGGTCCAGTAGG + Intronic
924337885 1:243001353-243001375 CATTGGGTGGGGGGTGGAGTGGG + Intergenic
1064795199 10:19004300-19004322 CTTTGAGTGGGGGGTGGAAGGGG - Intergenic
1066295396 10:34049660-34049682 CATTGACAGTGGGGCAGAGTGGG + Intergenic
1068745837 10:60529903-60529925 TATTGAGTGGGAGGAAGTGTGGG + Intronic
1070607191 10:77907167-77907189 CCCTGAGTTGGGGGTAGAGTAGG + Intronic
1071132008 10:82405356-82405378 AAGTGAGTGAAGGGTAGAGTAGG + Intronic
1071268916 10:83989281-83989303 AATTGGGTGGGTGGTAGAGGGGG - Intergenic
1071563807 10:86661523-86661545 CACTGAGTGGGGTCTGGAGTTGG + Intronic
1071601829 10:86962277-86962299 GGTGGAGTGGGGGTTAGAGTGGG - Intronic
1073073996 10:100812047-100812069 TATTGTGTGGAGGGGAGAGTGGG + Intronic
1074102613 10:110365395-110365417 CATTGCGTGGGGGGTAGGCGGGG - Intergenic
1074115748 10:110456565-110456587 AATTGAGGGGGTGGCAGAGTTGG - Intergenic
1074218229 10:111409230-111409252 TAGTGAGTGGGGGGCAGAGGTGG - Intergenic
1074438514 10:113454811-113454833 CAGTGAGTGGGTGGTATAGGCGG - Intergenic
1075096553 10:119475186-119475208 CAGTGAGGGTTGGGTAGAGTGGG - Intergenic
1075239690 10:120766650-120766672 CATAGAGTGGGGTGGAGAGGAGG - Intergenic
1075244717 10:120810848-120810870 CATAGAGTGGGGGAAAGAGCAGG - Intergenic
1078075905 11:8160236-8160258 CAGTGAATGGGGGGAAAAGTGGG + Intronic
1078308782 11:10218317-10218339 CATTGGGTGGGGGGGGGGGTGGG - Intronic
1079248518 11:18770921-18770943 CTCTGCCTGGGGGGTAGAGTGGG + Intronic
1080079877 11:28204148-28204170 CATTAAGTTGGAGGTAAAGTTGG + Intronic
1081222169 11:40475449-40475471 CAGTGAGTGGGGGCTAGGGGAGG + Intronic
1087048593 11:93864944-93864966 CATTGAGTGGCAGATAGAGCAGG + Intergenic
1087499679 11:98933902-98933924 CATTGACTTCGGGGTAGAGAGGG - Intergenic
1087630810 11:100648150-100648172 CATGGGGTGGGGGGCAGGGTTGG - Intergenic
1088199284 11:107313507-107313529 CATTGAATGGGGGGCTGAGCTGG + Intergenic
1088748756 11:112826100-112826122 CATGGAATTGGGGGTAAAGTGGG + Intergenic
1089109345 11:116042947-116042969 CATAGAGCTGAGGGTAGAGTGGG - Intergenic
1090239939 11:125174854-125174876 CGGTGGGTGGGGGGCAGAGTGGG - Intronic
1090951517 11:131477475-131477497 CACTGAGTGGGAGGGAGAGGAGG + Intronic
1095554085 12:43480312-43480334 CAGTGTGTGGGGGGTAAAGAAGG + Intronic
1096258321 12:50075921-50075943 CATGGAGTGGGGAGAAGACTGGG + Intronic
1099801315 12:87460360-87460382 CATGGAGTGGGTGGTGGAATGGG - Intergenic
1100823445 12:98453350-98453372 CATTGAGTGCGGTGCAGAGAAGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103363602 12:120368132-120368154 CAGTGAGTGGCGGGTGGAGGGGG + Intronic
1104580732 12:130009089-130009111 GACTGAGTCGGGGGTAGAGGGGG - Intergenic
1105464622 13:20626676-20626698 GCTTGGGTGGGGGGTAGAGTGGG + Intronic
1107074284 13:36305121-36305143 CAGTGAGTGTGCAGTAGAGTGGG - Intronic
1109691134 13:65891112-65891134 TATTGAGTGGGGGGAAAAGCAGG - Intergenic
1110105582 13:71671572-71671594 CATTGAGAGGGAGGTAGGTTGGG - Intronic
1112037137 13:95507222-95507244 TTTTGAGTTGGGGGAAGAGTAGG + Intronic
1118730937 14:68665861-68665883 CCCTGAGTTGGGGGTAAAGTTGG - Intronic
1119258076 14:73217027-73217049 CATTCATTGTGGGGTTGAGTAGG + Intronic
1119471309 14:74901522-74901544 TATGGAGTGGGGGATATAGTTGG + Intronic
1119812610 14:77535299-77535321 CAGCGAGTGAGGGGAAGAGTGGG + Intronic
1121373470 14:93382713-93382735 TATTTAGTGAGTGGTAGAGTCGG + Intronic
1121952743 14:98185813-98185835 CAGTGAGAGGGTGGCAGAGTTGG + Intergenic
1122716027 14:103697676-103697698 CACTGAGTGGGGGGTGGAGGGGG + Exonic
1122968696 14:105143790-105143812 CAGTGAGTGGGGAGTAGCGGGGG + Intronic
1127964924 15:63916305-63916327 CGTTGTGTGGGGGGTGGAGTTGG - Intronic
1130113805 15:80989153-80989175 CGGTGAGTGGGTGGGAGAGTGGG - Intronic
1131398225 15:92103846-92103868 CAGTGAGTGGGGCATTGAGTGGG + Intronic
1134681767 16:16131455-16131477 CATTGAGTGGATGGTGCAGTGGG + Intronic
1135044654 16:19145292-19145314 CATTAATTGGGAGGTGGAGTGGG + Intronic
1137365123 16:47853519-47853541 CATTTAGTGGGGTGGTGAGTGGG + Intergenic
1138596810 16:58033436-58033458 CATTCAGTGGGGGCTGGAATGGG + Intronic
1138669624 16:58602902-58602924 CATTAAGTGGGGGGAAGACAAGG - Intronic
1141802736 16:86322266-86322288 CATTTTTTGGGGGGTGGAGTGGG + Intergenic
1143002190 17:3801383-3801405 CAAAGTGTGGGTGGTAGAGTGGG - Intergenic
1143107366 17:4536425-4536447 CAGTGAGTGGGGGGGAGGGGAGG + Exonic
1144301113 17:13923657-13923679 CATGGGGTGGGGGGTTCAGTCGG - Intergenic
1144307389 17:13981423-13981445 CATGGGGTGGGGAGTGGAGTGGG + Intergenic
1146649787 17:34599497-34599519 CAGTGGGTGGAGGGGAGAGTAGG + Intronic
1147726952 17:42571832-42571854 CATGGAGTGGGGGGAAGGCTGGG - Exonic
1149552775 17:57552383-57552405 CAGTGAGTGGGGGGCTGGGTTGG - Intronic
1151129914 17:71886097-71886119 CCCTGGGTTGGGGGTAGAGTGGG + Intergenic
1152264676 17:79287412-79287434 CATTGAGTGGGGGGTAGAGTGGG + Intronic
1153065458 18:1039883-1039905 CATTGGGTGGGGGCAGGAGTAGG - Intergenic
1155285306 18:24282080-24282102 CATGGACTCGGGGGTAGGGTTGG - Intronic
1156509946 18:37627905-37627927 CACAGAGTGGGGAGTAGAGTGGG + Intergenic
1156873933 18:41982690-41982712 CTTTGAGTGGTAGGTAGACTGGG - Intronic
1157527547 18:48396100-48396122 CTTTGAGAGGGGGGTAGGGATGG - Intronic
1157909686 18:51604149-51604171 CATTGAGTAAGGGGTGGAGAAGG + Intergenic
1158547170 18:58406165-58406187 CAGTGAATGGGCAGTAGAGTTGG - Intergenic
1158839809 18:61373234-61373256 CATTGAGATGGGGGTGGGGTAGG - Intronic
1160449130 18:78950003-78950025 CATTGTGTGGCGTGTAGTGTAGG - Intergenic
1163423443 19:17227777-17227799 CACTGACTGGGGGAAAGAGTGGG + Intronic
926478077 2:13352975-13352997 CATTGAATTGTGGGCAGAGTAGG + Intergenic
927135594 2:20094091-20094113 CAGTGAGTGGGGGGCAGCCTGGG + Intergenic
927753568 2:25690828-25690850 CAATGAGTGGAGGGGAGAATTGG + Intergenic
929755224 2:44758648-44758670 AAGTGAGTGGGGGGTTGAGGGGG - Intronic
929988635 2:46764673-46764695 CATTGAGTGTGGAGAATAGTAGG + Intergenic
931485085 2:62682842-62682864 CAGTGAGTGGAGGGTGCAGTGGG - Intronic
932335662 2:70929884-70929906 CGTGGAGTGGGCGGTGGAGTTGG - Intronic
932893968 2:75621053-75621075 TATTTAGAGGTGGGTAGAGTTGG - Intergenic
933899269 2:86837569-86837591 CTTTGACTGGGTGGTAGATTCGG + Intronic
934159530 2:89235050-89235072 CATTGGGTGGGGGGTGAAGGGGG + Intergenic
934207748 2:89947381-89947403 CATTGGGTGGGGGGTGAAGGGGG - Intergenic
935781287 2:106511659-106511681 CTTTGACTGGGTGGTAGATTCGG - Intergenic
935788738 2:106571597-106571619 CAGTGAGGGGCTGGTAGAGTTGG + Intergenic
939453154 2:142399221-142399243 TTTTGAGTTGGGGGTAGAGGAGG + Intergenic
940344657 2:152616751-152616773 CATGGAGTGGGGGATGGAGGTGG + Intronic
941451012 2:165660147-165660169 CTTTGGGTAGAGGGTAGAGTTGG - Intronic
941608538 2:167631937-167631959 CAGTGGGTGGGGGGTAGGGGAGG - Intergenic
946961852 2:224993717-224993739 CATTGGGTAGGGGACAGAGTGGG - Intronic
947561609 2:231158841-231158863 CAGTGAATGGGGGTTAGCGTAGG + Intronic
947885850 2:233570327-233570349 CATTGAGTGGGCTGTTGAGGAGG - Intergenic
947891515 2:233625993-233626015 CATTGAGTGGGCTGTGGAGGAGG + Intronic
947896465 2:233678370-233678392 CATTGAGTGGGCTGTGGAGGAGG + Intronic
948369106 2:237475986-237476008 CAGTGAGTCAGGGGTGGAGTAGG - Intergenic
1172463028 20:35134550-35134572 CTTGGAGTGGGGAGGAGAGTGGG - Intronic
1174862468 20:54103976-54103998 CAGGGAATGGTGGGTAGAGTAGG - Intergenic
1175360629 20:58408900-58408922 CATGGAGTGGGGGGCGGGGTGGG - Intronic
1175772495 20:61632584-61632606 GAGTGGGTGGAGGGTAGAGTGGG - Intronic
1176245065 20:64093550-64093572 CAGTGTGTGGGGGGCAGTGTGGG + Intronic
1176245345 20:64094404-64094426 CAGTGTGTGGGGGGCAGTGTGGG + Intronic
1176245395 20:64094545-64094567 CAGTGTGTGGGGGGCAGTGTGGG + Intronic
1177488127 21:21785483-21785505 CATTGATCTGGTGGTAGAGTGGG - Intergenic
1179117214 21:38504699-38504721 ATCTGAGTCGGGGGTAGAGTGGG - Intronic
1179667031 21:42919972-42919994 CATTGAGTGGCAGATAGAGCAGG + Intergenic
1181850931 22:25749470-25749492 CAGAGAGAGGTGGGTAGAGTGGG + Intronic
1182817962 22:33184010-33184032 CACTGTGTGGGGGTTAGGGTTGG - Intronic
1183487755 22:38098374-38098396 CAGTGAGTTGGGGGCCGAGTGGG + Intronic
1184535657 22:45085014-45085036 CATGGATTGGGGGGAATAGTGGG + Intergenic
1184860387 22:47170259-47170281 AATTGAGTGTGCAGTAGAGTCGG + Intronic
949969006 3:9386387-9386409 CCCTTAGTGGGGGGTGGAGTGGG - Exonic
953286415 3:41614660-41614682 CATTGCATGGGGAGTAGAGATGG - Intronic
954459218 3:50617070-50617092 CAGGGAGCGGGGGGTGGAGTGGG + Intronic
954863764 3:53711882-53711904 CAGTGAGTTAGGGGCAGAGTTGG + Intronic
954872320 3:53777173-53777195 CATTGGGTGGATGGTAGAGAAGG + Intronic
955971453 3:64442388-64442410 CAGTGAGAGGGGTGTAAAGTGGG + Intronic
956100133 3:65759578-65759600 CAGTGGGTGGGGGGTAGAAGAGG + Intronic
956214277 3:66832242-66832264 CTTTGTGTGGGGGGGGGAGTGGG + Intergenic
956594333 3:70949500-70949522 CATGGAGTGGGGAGTAGAGTGGG + Intergenic
958581587 3:96032466-96032488 CTTTGTGTGTGGGGGAGAGTAGG + Intergenic
959403632 3:105933685-105933707 CATTAAATGGGTGGTTGAGTTGG + Intergenic
959661944 3:108878897-108878919 GATTGAGTGAGGGGCAGAATAGG + Intergenic
961290891 3:125845873-125845895 CTTTCAGTGGGGGGTGGGGTGGG - Intergenic
962446751 3:135472690-135472712 CATTTGGTGGGGGGTGGAGTGGG + Intergenic
963269248 3:143269236-143269258 CATTGAGTTGGGGATAGGATGGG - Intronic
963662893 3:148150978-148151000 CATTGAGTGGAAGGTTGAATTGG - Intergenic
965051555 3:163655564-163655586 CATTCAGTGGATGGTAGAGTAGG + Intergenic
967446987 3:189578280-189578302 CCTTGAGTGGGGGCTGGAGCAGG + Intergenic
968622484 4:1610216-1610238 CGTTGAGTGGGGTGTAGGGAGGG - Intergenic
970352151 4:15213124-15213146 CATTCAGTGGGTGGGAAAGTTGG + Intergenic
970603833 4:17661084-17661106 TATTGAGTGGGTTGTAGAGCTGG - Intronic
974959185 4:68676960-68676982 CATTGAGTGGCAGATAGAGCAGG - Intergenic
975317621 4:72972972-72972994 CCTTGAGTGTGGGCTGGAGTAGG - Intergenic
977991675 4:103450664-103450686 TATTGAATGGGGGGCAGACTGGG - Intergenic
978299825 4:107255246-107255268 CAATGACTGGGGGGTAGAAGTGG + Intronic
979239252 4:118433979-118434001 CATTGGGTGGGGGGTGGAGTGGG - Intergenic
982435455 4:155379565-155379587 CATCTAGTGGGGTGGAGAGTGGG - Intergenic
983114488 4:163796036-163796058 CATTGAGTAGGCGGAAGAGGAGG + Intronic
984525252 4:180850427-180850449 CATTGACTGGGGAGTGGATTAGG - Intergenic
987398198 5:17445730-17445752 GATTGAGTGGGGGATGCAGTTGG + Intergenic
988916317 5:35897236-35897258 AATTGAGAAGTGGGTAGAGTTGG - Intergenic
990011779 5:51007845-51007867 CATTGAGAGGAGGGTAGAGATGG + Intergenic
993484203 5:88462492-88462514 CAGTGAGTAAGGGGAAGAGTGGG + Intergenic
993876910 5:93318414-93318436 GATTGAGTGGGACTTAGAGTGGG - Intergenic
994342142 5:98642826-98642848 CACTGATTGGGGGGTAGGATGGG + Intergenic
995230201 5:109752589-109752611 GATAGAATGGGGGGTACAGTGGG + Intronic
995769027 5:115650167-115650189 AATTCAGTGGGGGAAAGAGTAGG + Intergenic
995827571 5:116317671-116317693 CATTTAGTGCTGGGTAGAGGTGG + Intronic
997781926 5:136667728-136667750 CATGGGGTGGGGGATAAAGTTGG - Intergenic
998323612 5:141257828-141257850 CATGGGGTGGGGGGCAGGGTGGG - Intergenic
999418451 5:151419980-151420002 TATTGAGTGTGGGGGAGAGCAGG + Intergenic
999943335 5:156568436-156568458 CTTTCAATGGGGGGAAGAGTAGG - Intronic
1000354104 5:160376915-160376937 CATTGAATGAGGGTCAGAGTTGG + Intergenic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1001550713 5:172600570-172600592 CATTGAGTGGGAGGCACAGAGGG + Intergenic
1002739496 5:181424565-181424587 CATTGGGTGGGGGGTGGAGTGGG - Intergenic
1003112941 6:3264234-3264256 CTGTGAGTGTGGCGTAGAGTGGG + Exonic
1004449402 6:15730887-15730909 CATGAAGTGGGGGGTTGAGGAGG + Intergenic
1008404815 6:51107167-51107189 GGTTGAGTTGGGGGTGGAGTGGG + Intergenic
1008489068 6:52066524-52066546 CATTCAGTGTGGGAAAGAGTGGG - Intronic
1009428166 6:63537565-63537587 CATTGAGTGAGGGTTAGTTTTGG - Intronic
1009506390 6:64485556-64485578 CATTGAGTGGGTGTTAGGTTTGG - Intronic
1013084147 6:106841188-106841210 CAGTCACTGGGGGCTAGAGTCGG - Intergenic
1013685955 6:112583285-112583307 GATTGAGTGGGTGGGAGATTGGG - Intergenic
1014900170 6:126953591-126953613 CTTAGAGTGGGGGAAAGAGTTGG + Intergenic
1016103794 6:140136666-140136688 CAATGAGTGGAGGATAAAGTGGG + Intergenic
1016391283 6:143578474-143578496 CATTGACTGTGGGGAAGAATGGG + Intronic
1017905462 6:158755025-158755047 GATTGAATGTGGGGCAGAGTCGG + Intronic
1019244612 6:170700136-170700158 CATTGGGTGGGGGGTGGAGTGGG - Intergenic
1019788171 7:2992877-2992899 TTTTGTGTGGGGGGTAGAGATGG + Intronic
1022664771 7:32400303-32400325 CCTTGAGTTGGAGGCAGAGTTGG - Intergenic
1029702480 7:102256497-102256519 GATTGACTGGGGGGCAGAGGGGG + Exonic
1035503514 8:108040-108062 CATTGGGTGGGGGGTGGAGTGGG + Intergenic
1038053570 8:23836611-23836633 CATAGTGGGAGGGGTAGAGTAGG + Intergenic
1038488072 8:27950437-27950459 CATTAGGTGGGGATTAGAGTTGG - Intronic
1039880852 8:41624671-41624693 TATTGACTGGGGGAGAGAGTGGG - Exonic
1041201540 8:55454840-55454862 CACTGAGTGGGAGGAAGAGGAGG - Intronic
1042027886 8:64443311-64443333 CATAGAGTGAGGGAGAGAGTGGG + Intergenic
1042072351 8:64949689-64949711 CTTTGAGTGAAGGGTAGAGCTGG + Intergenic
1043540725 8:81259279-81259301 CAGTGGTTGGGGTGTAGAGTAGG + Intergenic
1046442146 8:114271035-114271057 CATTAACTGTGGGGTATAGTTGG - Intergenic
1049218711 8:141419129-141419151 CCTTCAGTGGGGGGTAGTGTGGG + Intronic
1055733389 9:79302549-79302571 CTCTGAGTTGGGGGTAGAGTTGG + Intergenic
1057717162 9:97503797-97503819 CTCTGAGTGGGTGGCAGAGTTGG - Intronic
1057853982 9:98588622-98588644 CAGTGAGTGAGGGGCAGAGTTGG + Intronic
1059872671 9:118595409-118595431 CATGGAATGGGGAGAAGAGTTGG - Intergenic
1060200005 9:121646675-121646697 CATTGTGTGGGGCCTAGTGTGGG + Intronic
1060707368 9:125816292-125816314 CATTGAGAAGGGGGAAGAGCCGG - Intronic
1060828627 9:126700397-126700419 CATTCAGATGGGGGCAGAGTGGG - Exonic
1061384843 9:130283415-130283437 CACTGAGTGGGGGGTGGGTTGGG - Intergenic
1061454153 9:130684950-130684972 CATTCAGTGAGTGGCAGAGTGGG + Intergenic
1061597856 9:131643937-131643959 CCTTGAGTGGGGGCTTCAGTGGG - Intronic
1062533301 9:137010952-137010974 CAGTGAGTGGGGGGCGGGGTGGG - Exonic
1203604802 Un_KI270748v1:49366-49388 CATTGGGTGGGGGGTGGAGTGGG - Intergenic
1189181717 X:39010880-39010902 CATTTGGTGGAGGGTAGAGAAGG + Intergenic
1189399547 X:40654249-40654271 CTATGATTGGGTGGTAGAGTAGG + Intronic
1189979547 X:46495419-46495441 CTTTGAGTGGGGCCTAGAGCAGG + Intronic
1190381731 X:49845686-49845708 CATTGAAGGGAGTGTAGAGTTGG + Intergenic
1195646010 X:107231329-107231351 CATTGAGGGAGGGGAAGTGTGGG + Intronic
1197220141 X:123904460-123904482 CAGGGAGTTGGGGGTAGAGTGGG - Intronic
1198942652 X:141974694-141974716 GAGTGAGTGAGGGGTATAGTAGG + Intergenic
1202386993 Y:24335762-24335784 CATTGGGTGGGGGGTGGAGTGGG - Intergenic
1202483793 Y:25334366-25334388 CATTGGGTGGGGGGTGGAGTGGG + Intergenic