ID: 1152267479

View in Genome Browser
Species Human (GRCh38)
Location 17:79304769-79304791
Sequence GAACCAAGAACAGAGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 325}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152267479_1152267484 -1 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267484 17:79304791-79304813 CCAACTCTAAGATTCTCGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1152267479_1152267488 16 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267488 17:79304808-79304830 GGAAGGTGCTGGTGGCTGTTGGG 0: 1
1: 0
2: 1
3: 41
4: 321
1152267479_1152267490 27 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267490 17:79304819-79304841 GTGGCTGTTGGGTTATATGAGGG 0: 1
1: 0
2: 1
3: 6
4: 139
1152267479_1152267487 15 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267487 17:79304807-79304829 CGGAAGGTGCTGGTGGCTGTTGG 0: 1
1: 0
2: 2
3: 26
4: 328
1152267479_1152267485 5 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1152267479_1152267486 8 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267486 17:79304800-79304822 AGATTCTCGGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1152267479_1152267489 26 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267489 17:79304818-79304840 GGTGGCTGTTGGGTTATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 134
1152267479_1152267482 -5 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267482 17:79304787-79304809 GGTTCCAACTCTAAGATTCTCGG 0: 1
1: 0
2: 2
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152267479 Original CRISPR GAACCAAGAACAGAGGCCCC GGG (reversed) Intronic
900784857 1:4642668-4642690 AAGCCAAGAAGAGAGGCCCAAGG + Intergenic
900806585 1:4771568-4771590 GAAGCAAGAATCGAGGCCCCCGG - Intronic
901182207 1:7349606-7349628 GAACCAAGGACAGAGGCCTCAGG - Intronic
902239770 1:15080788-15080810 GGGCTGAGAACAGAGGCCCCGGG + Intronic
902269437 1:15292732-15292754 AAGCCAAGAAGAGAGGCCTCAGG + Intronic
902716603 1:18277052-18277074 GTGACAAGAACACAGGCCCCTGG - Intronic
902991363 1:20189556-20189578 GATCCAAATACAGAGGCCCCAGG + Intronic
903147140 1:21381676-21381698 GAACCAAGCTCAGAGCCCTCGGG - Intergenic
904130791 1:28273832-28273854 GACCCATGAAGCGAGGCCCCTGG - Intronic
904998562 1:34650442-34650464 GAACAAAGAACAGAGGATCAAGG - Intergenic
905245044 1:36606864-36606886 GTACCCAGAAATGAGGCCCCTGG + Intergenic
906318561 1:44803226-44803248 GAACAGAGAAGAGAGGCTCCAGG - Intronic
907117152 1:51978978-51979000 GAAGGAAGAACAGAGACCACAGG - Intronic
907489254 1:54798461-54798483 GAACCAAAAACAGGGCCCCAGGG - Intronic
908024671 1:59938250-59938272 GGAGAAAGAACAGTGGCCCCAGG + Intergenic
910168593 1:84354066-84354088 AAACCAGGAACAGAAGCCACAGG + Intronic
911563101 1:99430597-99430619 GAACCAATGACTGAGGCCCAAGG - Intergenic
915496330 1:156285204-156285226 GATCCCAGAACTGAGGCCCCAGG + Exonic
915515822 1:156412097-156412119 GAACCAAGAACAGATGATCATGG + Intronic
917612460 1:176702533-176702555 GAACCATCAACAAAGGACCCAGG + Intronic
917787701 1:178476745-178476767 GACCCATCAACAAAGGCCCCGGG - Intronic
918142832 1:181733002-181733024 GATCCAAGAAGAGAGAGCCCAGG + Exonic
918257217 1:182759541-182759563 GAAGCAAGAAAAGAGACCCTGGG + Intergenic
918299130 1:183186283-183186305 GAACCACCAACCGAGGCGCCGGG + Exonic
919793671 1:201308461-201308483 CAAACAAGACCAGAGGCCCCTGG + Intronic
919990334 1:202704844-202704866 GAAGCAAGGAGGGAGGCCCCAGG - Intronic
921302462 1:213764282-213764304 AAGCCAAGAACAGTGGCCCAGGG + Intergenic
921717941 1:218437513-218437535 AACCCAAGAACAGAGGCAACAGG - Intronic
921952160 1:220941646-220941668 GAGCCAAGACCAGAAGCCTCGGG - Intergenic
923858001 1:237865082-237865104 GAGGCAGGAACAGAGGCCTCTGG - Intergenic
1063228937 10:4044763-4044785 GAACCAAGGAGAGAGACCTCAGG - Intergenic
1064729928 10:18319901-18319923 GACCCAAGAACAGAGAGGCCAGG + Intronic
1065641129 10:27783523-27783545 CAGCAAAGAACTGAGGCCCCCGG - Intergenic
1066457823 10:35586982-35587004 GAACCAAGGAGAGAGTCCTCGGG - Intergenic
1068587728 10:58818322-58818344 GCATAAAGAAAAGAGGCCCCAGG + Intronic
1068906500 10:62330469-62330491 AAACCAAGGAAAGAGGCCTCAGG + Intergenic
1068935908 10:62635603-62635625 GAAACAAGCACAGAGACCCAGGG - Intronic
1069681355 10:70287887-70287909 AAGCCAAGGACAGAGGCCTCAGG + Intergenic
1070502029 10:77081211-77081233 GAAACAGGAACAGAGAGCCCAGG - Intronic
1070599270 10:77854390-77854412 GCCCCATGAACACAGGCCCCAGG + Intronic
1072629272 10:97134391-97134413 CAACCAGGAACAATGGCCCCTGG + Intronic
1072881801 10:99235712-99235734 GAGCCAAGTAGAGAGCCCCCGGG + Exonic
1073084643 10:100880292-100880314 GAAGGCAGAACAGAGACCCCTGG + Intergenic
1074112572 10:110432971-110432993 AAGCCAAGAAGAGAGGCCTCAGG + Intergenic
1075139226 10:119816660-119816682 TGACCCAGAACAGAGGCTCCTGG + Intronic
1075425114 10:122336092-122336114 GGACCAAGAGCTGAGGCCCATGG - Intronic
1075673395 10:124279737-124279759 GAGGCAAGAACAAAGGCCCCTGG - Intergenic
1075820277 10:125302087-125302109 AAGCCAAGGATAGAGGCCCCAGG + Intergenic
1076412407 10:130261661-130261683 AAGCCAAGAAGAGAGGCCTCAGG - Intergenic
1079469774 11:20767103-20767125 GAACCAACAACAGACACACCAGG - Intronic
1079855446 11:25597358-25597380 GAACCAAGGACACAGTCCCTAGG + Intergenic
1080228139 11:29984027-29984049 AAACCAAAAATAGAGGCCCTGGG + Intergenic
1085527059 11:77170413-77170435 TTACAAAGACCAGAGGCCCCTGG + Intronic
1085776347 11:79370147-79370169 CAGCCAAGAATAGAGGCCCCAGG + Intronic
1085796785 11:79548630-79548652 ATGCCAAGAACAGAGGCACCCGG - Intergenic
1087796104 11:102455806-102455828 GCAGCAAGTACAGAGGCTCCGGG - Intronic
1088699550 11:112399898-112399920 GAACCAAGAACAAAGCCACCAGG - Intergenic
1089406313 11:118200571-118200593 CACCCAAGACCAGAGGCCTCAGG + Exonic
1090333335 11:125947597-125947619 GAACCAAAAAGAGAGGCTCCAGG + Intergenic
1090553864 11:127852722-127852744 GAACCAATGCCTGAGGCCCCAGG - Intergenic
1091792030 12:3277450-3277472 CCAGCCAGAACAGAGGCCCCTGG + Intronic
1093512344 12:19944467-19944489 GGACCAAGAACAGAGGACAGAGG + Intergenic
1094699473 12:32854885-32854907 GAAGCAAGAGCAAAGGCTCCAGG - Intronic
1097884604 12:64716442-64716464 TAATCAAGAACTGTGGCCCCAGG + Exonic
1101051007 12:100864178-100864200 GAACCAATCACAGTGGCCACAGG + Intronic
1101413479 12:104488913-104488935 AAGCCAAGAAGAGAGGCCTCAGG - Intronic
1103184998 12:118949067-118949089 GATCCAAGGACAAAGGACCCAGG + Intergenic
1103363384 12:120367170-120367192 GACCCAAGCAGAGAGGCCCAAGG + Intronic
1103948594 12:124540268-124540290 GAGCCAAGCACAGAGGGCCGAGG + Intronic
1108515395 13:51197027-51197049 GAAACAAGAAGAGAAGGCCCTGG + Intergenic
1108783220 13:53862802-53862824 AAGCCAAGAAAAGAGGCCTCAGG - Intergenic
1109507235 13:63319742-63319764 AAGCCAAGAAGAGAGGCCTCAGG - Intergenic
1112305275 13:98267771-98267793 GGCCCAGGATCAGAGGCCCCAGG - Intronic
1113033996 13:106028364-106028386 GAACCAAGGACAGAGGACTAAGG - Intergenic
1114592223 14:23876719-23876741 AAACCAAGCACACAAGCCCCAGG - Intergenic
1117211433 14:53504813-53504835 AAACCAAGGAGAGAGGCCTCAGG - Intergenic
1117751850 14:58931430-58931452 AAACCAAGAAAAGAAGCCCTTGG - Intergenic
1118993107 14:70813473-70813495 GAAAAAGGAACAGAGGCCTCTGG + Intergenic
1119716648 14:76864291-76864313 GAACAAAGAGCAAGGGCCCCAGG + Intronic
1120215540 14:81677980-81678002 GAACAAAGGACATAGGTCCCAGG - Intergenic
1121732729 14:96197759-96197781 GAGCCAAGAACAGGGCCCCAGGG + Intergenic
1122954147 14:105061997-105062019 AGATCAAGAACAGAGTCCCCTGG - Intronic
1123119273 14:105909328-105909350 TCACCAAGCACAGAGCCCCCAGG - Intergenic
1123941817 15:25220333-25220355 GGCCCAAGAACAGAGGGCCCAGG - Intergenic
1124358543 15:29017194-29017216 GAACCAAGGCCAGATGCACCCGG + Intronic
1124687885 15:31797963-31797985 CAACCAAGAAGAGAGGCCTCAGG - Intronic
1125668015 15:41447740-41447762 GAACCAAGTACAGAGGCCAGAGG - Intronic
1126249963 15:46555859-46555881 AAAGGCAGAACAGAGGCCCCAGG + Intergenic
1127441315 15:59011578-59011600 AAACCAAGAAGAGGGGCCTCAGG - Intronic
1128678477 15:69628998-69629020 GAAGCTAGAACATAGGTCCCTGG + Intergenic
1129253749 15:74322485-74322507 TAACCCAGGATAGAGGCCCCAGG + Intronic
1129741440 15:77991510-77991532 GAACCAAGGACGGATGGCCCAGG + Intronic
1129844223 15:78760897-78760919 GAACCAAGGACGGATGGCCCAGG - Intronic
1130257579 15:82332902-82332924 GAACCAAGGACAGATGGCCCAGG + Intergenic
1130597362 15:85257062-85257084 GAACCAAGGACGGATGGCCCAGG - Intergenic
1131158209 15:90087947-90087969 GAGCCAATCACAGAGGCCCTGGG - Intronic
1131550910 15:93356041-93356063 AAACCAAGGAGAGAGGCCTCAGG - Intergenic
1132380444 15:101362470-101362492 GAACAAAGAGCAGAGGACCCAGG + Intronic
1132625655 16:890295-890317 GAAGCAAGAAAAGGGGCTCCTGG + Intronic
1132900268 16:2250372-2250394 GAACCAAGTTCAGAGGCACCAGG + Intronic
1134036130 16:11032754-11032776 GCAGCATGTACAGAGGCCCCGGG + Intronic
1134198728 16:12180083-12180105 GAACAGAAAACAGAAGCCCCTGG - Intronic
1135936096 16:26781479-26781501 GAACCAATTACCGAGGCCCAGGG - Intergenic
1137760779 16:50938810-50938832 GACCCCAGAGCAGAGTCCCCAGG + Intergenic
1137874404 16:51981937-51981959 GAACCCAGAACAGAGGCATGTGG - Intergenic
1138103977 16:54277207-54277229 GAAATAGAAACAGAGGCCCCCGG + Intergenic
1138337664 16:56265957-56265979 GCAGCAAGAGCAAAGGCCCCGGG - Intronic
1140266156 16:73422960-73422982 CAGCCAAGGAGAGAGGCCCCAGG - Intergenic
1141491573 16:84377495-84377517 AAACCAAGCAGAGAGGCCTCCGG - Intronic
1143297205 17:5880312-5880334 GAAACAAGAACAGAAGCATCAGG - Intronic
1143551125 17:7631163-7631185 GAAGCAAAATCAGAGGCCCCTGG - Intronic
1146379950 17:32321091-32321113 GAACTACGAGCAGAGGCTCCAGG + Exonic
1146551628 17:33785236-33785258 AAGCCAAGAAGAGAGGCCCCAGG + Intronic
1146718237 17:35104148-35104170 GATCCATGACCAGAGGCCTCAGG - Intronic
1146920441 17:36706566-36706588 GAACCAGGAGCACAGACCCCTGG + Intergenic
1147555039 17:41473218-41473240 GAACCAGGAGCAGGGGCTCCAGG + Intergenic
1148540617 17:48477506-48477528 GAACCAAGAGCAGAGGCAGGAGG - Intergenic
1149219863 17:54404290-54404312 GGACCAAGCACAGAGGCAACAGG - Intergenic
1151367585 17:73627478-73627500 GAAACAGGCACAGAGGCCACAGG + Intronic
1151518136 17:74610294-74610316 GAACCAAGGACAGAGCCCTCGGG - Exonic
1151761206 17:76104173-76104195 GAAACAAGTACACAAGCCCCTGG - Intronic
1152038775 17:77890027-77890049 GAAGCAAGAAGAGAGGCACAGGG + Intergenic
1152267479 17:79304769-79304791 GAACCAAGAACAGAGGCCCCGGG - Intronic
1152283286 17:79397868-79397890 CAACCACAAACAGAGGCCCTGGG + Intronic
1152555208 17:81049682-81049704 AAACCAACAGCAGCGGCCCCAGG - Intronic
1153338448 18:3949089-3949111 GCACCAATAACACAGGGCCCTGG + Intronic
1153840314 18:9001457-9001479 AAGCCAAGGACAGAGGCCTCAGG + Intergenic
1154057015 18:11022504-11022526 CAGCCAAGGAGAGAGGCCCCAGG - Intronic
1154158729 18:11964060-11964082 TAGCCAAGACAAGAGGCCCCTGG + Intergenic
1154394549 18:13975043-13975065 AAACCAAGGAGAGAGGCCTCAGG + Intergenic
1155074635 18:22343755-22343777 GAACAAACATCAGGGGCCCCGGG - Intergenic
1155326539 18:24670596-24670618 AAACCAAGGAGAGAGGCCTCAGG + Intergenic
1155943053 18:31819113-31819135 ATACCAAGAAGAGAGGCTCCTGG + Intergenic
1155997671 18:32348227-32348249 GAACAAAGGACAGAGGACCAGGG + Intronic
1156762692 18:40612586-40612608 CAACCAAGAACAGAAGCATCAGG - Intergenic
1157151237 18:45220859-45220881 AAACCAAAAAGAGAGGCCTCAGG - Intronic
1158020336 18:52834006-52834028 TACCCAAGCACATAGGCCCCGGG - Intronic
1158518247 18:58148526-58148548 AAGCCAAGAACAGAGGCCTCGGG - Intronic
1159208617 18:65286266-65286288 GGATCAGGAACAGTGGCCCCAGG + Intergenic
1159305832 18:66640908-66640930 CAACCAAGGAGAGAGGCCTCAGG - Intergenic
1159866879 18:73716241-73716263 GAGCCAAGAAAAGAGGTCTCAGG - Intergenic
1160755746 19:756315-756337 GAACCAATTACAGAGGCCAGAGG + Intronic
1160755756 19:756382-756404 GAACCAATCACAGAGGCCAGTGG + Intronic
1161255898 19:3309395-3309417 GTACCAAGGACAGAAGGCCCAGG - Intergenic
1161560947 19:4972107-4972129 AAGCCAGGAACAGAGACCCCTGG - Intronic
1161788883 19:6346657-6346679 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
1163162791 19:15475580-15475602 GAGCCAAGAACAGCTGGCCCAGG - Exonic
1163355024 19:16804806-16804828 CAACAAAAAAAAGAGGCCCCAGG - Intronic
1163406545 19:17126420-17126442 GGATCCAGAACAGCGGCCCCTGG + Intronic
1164622601 19:29706047-29706069 AAGCCAAGCACCGAGGCCCCTGG + Intronic
1164955110 19:32376524-32376546 GACCCAACCACAGAGGCCCAGGG + Intronic
1165895053 19:39136422-39136444 GCAGCAAGAACAAAGGCCCCGGG - Intronic
1166388490 19:42395756-42395778 GATCAAAGAACAGAGGCCATGGG + Intergenic
1166986381 19:46662038-46662060 GAACGTAGAACAAAGGCCCCTGG - Intergenic
925104620 2:1280565-1280587 GCACCAAGGTCAGAGGCTCCTGG + Intronic
925121519 2:1422024-1422046 GAGCAATGAACAGAGCCCCCCGG - Intronic
925390035 2:3488288-3488310 GATCCCAGGATAGAGGCCCCAGG - Intergenic
925607549 2:5673784-5673806 GAGCCAAAAACAGAGGGGCCGGG + Intergenic
925851687 2:8088138-8088160 GAGCTAAGAACTGAGTCCCCAGG + Intergenic
926421759 2:12706920-12706942 AAGCGAAGAACAGAGGCCTCAGG + Intergenic
926438209 2:12859089-12859111 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
927460910 2:23297524-23297546 GAGCCAAGGAGAGAGGCCTCAGG - Intergenic
927529098 2:23777150-23777172 AAGCCAAGAAAAGAGGCCTCAGG + Intronic
929483292 2:42333403-42333425 GGACCAAGAAGAGCTGCCCCTGG + Intergenic
932440694 2:71732810-71732832 GACACAAGAGCAAAGGCCCCAGG - Intergenic
932739296 2:74279499-74279521 GAGCCCAGAACAGAGCCCCTAGG - Intronic
932801538 2:74746331-74746353 GAACCCAGGACAGAGGCCAAAGG - Intergenic
936030032 2:109063261-109063283 GAAGCAAGATCAAAAGCCCCAGG - Intergenic
936259740 2:110948570-110948592 CAAGCAGGAACAGAGGCCACAGG - Intronic
936517976 2:113193988-113194010 GAACAAAGAACCAAGGCTCCAGG - Intronic
936840815 2:116765948-116765970 GGACCAGGAAAAGAGGCCCCTGG - Intergenic
936853856 2:116933948-116933970 AAGCCAAGAAGAGAGGCCTCAGG + Intergenic
936975991 2:118223502-118223524 GAACCAAGAACACTGAACCCAGG + Intergenic
937983076 2:127626259-127626281 GAAGAAAGAAGAGAGGCACCCGG + Intronic
938152726 2:128901112-128901134 GGGCCAAGAAGAGAGGCCTCAGG + Intergenic
938158173 2:128959062-128959084 AAACCAAGGAGAGAGGCCTCAGG + Intergenic
938299718 2:130201371-130201393 AAACCAGGAAGAGAGGCCTCTGG - Intergenic
938456990 2:131473115-131473137 AAACCAGGAAGAGAGGCCTCTGG + Intronic
938831002 2:135050243-135050265 AAACCAAGGAGAGAGGCCTCAGG - Intergenic
939072901 2:137565095-137565117 AAACCAAGGAAAGAGGCCTCAGG + Intronic
940048433 2:149435150-149435172 AAGCCAAGAAGAGAGGCCTCAGG + Intronic
940605166 2:155914012-155914034 AAGCCAAGGACAGAGGCCTCAGG - Intergenic
944991071 2:205236489-205236511 GAGCCAAGGAGAGATGCCCCAGG + Intronic
945871712 2:215234030-215234052 GAAACAAGCACAAAGGGCCCAGG + Intergenic
946673858 2:222136173-222136195 AAAAGAAGAACAGAAGCCCCAGG - Intergenic
947378645 2:229523410-229523432 AAACCAAGGAGAGAGGCCTCAGG - Intronic
947399294 2:229715152-229715174 GCACCAAGGACAAGGGCCCCGGG - Intergenic
947622130 2:231597489-231597511 GAACCAATCACTGAGGCCACGGG + Intergenic
947654323 2:231813340-231813362 GAGCCAAGGAGAGAGGCCTCAGG - Intergenic
948307854 2:236963065-236963087 AAGCCAAGAAGAGAGGCCTCAGG - Intergenic
1168847873 20:957913-957935 GACCCAACAACAGAATCCCCTGG - Intergenic
1171823139 20:29873963-29873985 GATCCGAGACCAGCGGCCCCGGG + Intergenic
1172205531 20:33160376-33160398 GGACCAAGAACAGGTGCCCTGGG - Intergenic
1172938833 20:38640732-38640754 GCAGCAAGTGCAGAGGCCCCAGG - Intronic
1173172992 20:40742279-40742301 GGAACAGGAAGAGAGGCCCCTGG + Intergenic
1173285269 20:41665515-41665537 AAGCAAAGAACAGAGGGCCCAGG - Intergenic
1173437160 20:43043691-43043713 GAAACAGGCACAGAGACCCCAGG + Intronic
1174559237 20:51418071-51418093 GCACCCAGGACAGGGGCCCCAGG - Intronic
1174773494 20:53322878-53322900 GCACCAAACACAGAGGCTCCAGG - Intronic
1174990611 20:55505256-55505278 GACCTCAGAACAGAGGACCCGGG - Intergenic
1175535304 20:59706821-59706843 GAACCAAGAGCCCAGACCCCAGG - Intronic
1175930193 20:62490207-62490229 GATCCAAGAACATGGGCCCTGGG + Intergenic
1176376451 21:6089053-6089075 GAGCCAAGGAGAGAGGCCTCAGG + Intergenic
1177298115 21:19203435-19203457 TAGCCAAGAAGAGAGGCCTCAGG + Intergenic
1179132355 21:38649352-38649374 GGACCAAGCACAGAGGCACCTGG + Intronic
1179316210 21:40246544-40246566 GAAAAAAAAAAAGAGGCCCCAGG + Intronic
1179366001 21:40759130-40759152 GGACTAAGAGCAAAGGCCCCAGG - Intronic
1179484589 21:41701620-41701642 GAACCCAGAGCAGACACCCCAGG + Intergenic
1179747024 21:43449191-43449213 GAGCCAAGGAGAGAGGCCTCAGG - Intergenic
1181484057 22:23219461-23219483 GAACCAGGGACAGAGGCCAAGGG - Intronic
1182049222 22:27300305-27300327 GAGCCAAGATCGCAGGCCCCGGG + Intergenic
1183979336 22:41530594-41530616 GATCCCAGAGCAGAAGCCCCAGG + Intronic
1184403296 22:44286230-44286252 GGACCAAGAGCAGAGGCATCAGG + Intronic
1185078705 22:48697105-48697127 GATCCAAGAAGAGAGGAACCTGG + Intronic
950445220 3:13033405-13033427 AAGCCAAGAAGAGAGGCCTCAGG - Intronic
951755016 3:26081299-26081321 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
951954320 3:28238045-28238067 AAATCAAGAAGAGAGGCCTCAGG + Intergenic
952115665 3:30177733-30177755 AAACCAAGGAGAGAGGCCTCAGG - Intergenic
952830503 3:37560900-37560922 AAGCCAAGAAGAGAGGCCTCAGG - Intronic
953032419 3:39187303-39187325 GAAGGAAGAACAGGAGCCCCGGG - Exonic
953226522 3:41026593-41026615 GAGCCAAGAACTGAGCCCCTGGG + Intergenic
953796775 3:45992021-45992043 GAGCCAAGGAGAGAGGCCTCAGG + Intronic
954131976 3:48565500-48565522 GAGCCAAGAGCAGGGGCCTCAGG + Intronic
954626342 3:52023962-52023984 GAACTGAGAGCAGAGGCCCCAGG + Intergenic
955167795 3:56531540-56531562 AAGCCAAGAAGAGAGGCCTCAGG - Intergenic
955587759 3:60499726-60499748 GAAACAAGAACAAAGGCTCAGGG - Intronic
956689998 3:71867545-71867567 GAAACAAGAACAGAAAACCCAGG + Intergenic
957856115 3:85881054-85881076 TAGCAAAGAACAGAGGCCCAGGG - Intronic
959805389 3:110546260-110546282 AAGCCAAGAAGAGAGGCCTCAGG - Intergenic
959906548 3:111716967-111716989 AAGCCAAGGACAGAGGCCTCAGG + Intronic
961414372 3:126746529-126746551 GCCCCAAGAACAGAGGCTCTTGG - Intronic
965223216 3:165954132-165954154 GATCCAAGAACAGTGGTCCAGGG + Intergenic
965248441 3:166308226-166308248 AAGCCAAGAATAGAGGCCTCAGG - Intergenic
967202093 3:187080950-187080972 AAACCAACAAGAGAGGCCTCGGG - Intergenic
967468352 3:189834099-189834121 GAGACAAGACCAGAGGCGCCGGG + Intronic
967744822 3:193043458-193043480 AAGCCAAGGACAGAGGCCTCAGG - Intergenic
968816058 4:2822612-2822634 GAGCCAGGACCAGAGGCCCAGGG - Intronic
968875885 4:3267731-3267753 GAAGGAAGAGCAGAGGCCCCTGG - Intronic
969112560 4:4852827-4852849 GACCCAGGAGCAGTGGCCCCAGG - Intergenic
969840590 4:9878752-9878774 CAACCAAAAACAGAGTCCCAGGG - Intronic
970480747 4:16471220-16471242 AAGCCAAGGAAAGAGGCCCCAGG - Intergenic
972788469 4:42348489-42348511 AAGCCAAGGACAGAGGCCTCAGG + Intergenic
973547474 4:51996046-51996068 GAGCAAAGCAGAGAGGCCCCAGG - Exonic
975736251 4:77384092-77384114 GAATCTACAACAGAGGCCCATGG - Intronic
976358653 4:84151044-84151066 GACCCAAGGAGAGAGGCCTCAGG + Intergenic
978371796 4:108036540-108036562 GAACCAAGAGCAGTGACACCAGG - Intergenic
979565268 4:122147624-122147646 AAACCAAGGAGAGAGGCCTCAGG + Intergenic
980902467 4:138917950-138917972 AAGCCAAGAAGAGAGGCCTCAGG - Intergenic
983289292 4:165781546-165781568 GAAGCAAGAACAGAGCCTCAGGG - Intergenic
983337156 4:166411224-166411246 GCAACAAGCACAGAGGCCCTGGG + Intergenic
984090714 4:175371382-175371404 AAACCAAGAAGAGAGGCCTCAGG - Intergenic
984288294 4:177761684-177761706 GAAACACCAACAGACGCCCCGGG + Intronic
986250993 5:6058548-6058570 CTACCAAGAGCGGAGGCCCCAGG - Intergenic
986307239 5:6524890-6524912 GAAGCAAGCCCAGGGGCCCCTGG + Intergenic
987082416 5:14437579-14437601 AAGCCAAGAAGAGAGGCCTCAGG - Intronic
987299923 5:16588235-16588257 AAGCCAAGAAGAGAGGCCTCAGG - Intronic
987715719 5:21567225-21567247 AAGCCAAAAAGAGAGGCCCCAGG + Intergenic
987801898 5:22708922-22708944 GAATCAAGAACAGTGACCACAGG - Intronic
988329050 5:29811179-29811201 AAACCAAAAAGAGAGGCCTCAGG + Intergenic
989317689 5:40102097-40102119 GATCCATGAGCAGAGGCCCAAGG - Intergenic
992393800 5:76353672-76353694 CAAGCAAAAACAAAGGCCCCTGG - Intronic
993240013 5:85370313-85370335 AAGCCAAGAAGTGAGGCCCCAGG + Intergenic
993699104 5:91097267-91097289 GCACCTATAAAAGAGGCCCCAGG - Intronic
994801121 5:104377934-104377956 AAACCAAGAAAAGAGACCTCAGG + Intergenic
995275174 5:110269457-110269479 TAACAAAGAAGAGAGACCCCAGG - Intergenic
999178853 5:149654456-149654478 GAACAGAGCAGAGAGGCCCCTGG - Intergenic
1000030709 5:157398828-157398850 AAACCAAGAAGAGAGACCCTGGG - Intronic
1001288488 5:170440163-170440185 AAACCAAGGAGAGAGGCCTCAGG + Intronic
1001874106 5:175184514-175184536 GAAATAAGAACACAGGCCCAGGG + Intergenic
1002473663 5:179452168-179452190 GGACCCAGAACAGAAGCACCAGG + Intergenic
1003274562 6:4638338-4638360 AAGCCGAGGACAGAGGCCCCAGG - Intergenic
1003733411 6:8851192-8851214 AAGCCAAGAAGAGAGGCCTCAGG + Intergenic
1003756403 6:9125835-9125857 GACCTTATAACAGAGGCCCCAGG + Intergenic
1003773461 6:9334210-9334232 GTTCCAAGAACAGTGGCCACTGG + Intergenic
1004003007 6:11612888-11612910 AAACCAAGGAGAGAGGCCTCAGG + Intergenic
1004020512 6:11771870-11771892 AAGCCAAGGACAGAGGCCTCAGG + Intronic
1004078205 6:12364711-12364733 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
1004160899 6:13212020-13212042 AAGCCAAGAAGAGAGTCCCCAGG - Intronic
1004298956 6:14439818-14439840 AAACCAAGGAAAGAGGCCTCAGG - Intergenic
1004310323 6:14539878-14539900 AAGCCAAGGAGAGAGGCCCCGGG + Intergenic
1004470972 6:15928824-15928846 AAGCCAAGAAGAGAGGCCTCAGG + Intergenic
1004816216 6:19314164-19314186 AAGCCAAGAAGAGAGGCCACAGG - Intergenic
1005534047 6:26736656-26736678 GAGCCAAGGAGAGAGGCCTCAGG - Intergenic
1005534481 6:26742021-26742043 GAGCCAAGGAGAGAGGCCTCAGG + Intergenic
1005536748 6:26764998-26765020 GAGCCAAGGAGAGAGGCCTCAGG + Intergenic
1006164899 6:32058330-32058352 GAACCAGGCACAGAGGCCCCAGG - Intronic
1007377858 6:41468701-41468723 TAATCCAGAACAGAGTCCCCAGG - Intergenic
1007597208 6:43058772-43058794 ATACCAAGAACAGTGGCCTCAGG - Intronic
1007940955 6:45781046-45781068 CAACCAAGGACAGAGGTCACTGG + Intergenic
1008954423 6:57199296-57199318 GAACCATGAAGAGAGGCCTCAGG - Intronic
1009001005 6:57714824-57714846 AAGCCAAAAAGAGAGGCCCCAGG - Intergenic
1009007646 6:57807411-57807433 GAGCCAAGGAGAGAGGCCTCAGG + Intergenic
1010043648 6:71416954-71416976 CAACCAAGAACAGAGGTGCCTGG + Intergenic
1010149256 6:72711249-72711271 AAACCAAGCAGAGAGGCCTCAGG + Intronic
1010407522 6:75521614-75521636 GAACAGGCAACAGAGGCCCCTGG + Intergenic
1010831387 6:80534761-80534783 AAACCAAAGACAGAGGCCTCAGG - Intergenic
1011222033 6:85064683-85064705 AAACCAAGGAGAGAGGCCTCGGG + Intergenic
1014069993 6:117169596-117169618 CAACCATGAACAGAAGCCCAAGG + Intergenic
1018255328 6:161912654-161912676 GACCCAAGAACTGAGGCCCCAGG + Intronic
1018344064 6:162882416-162882438 CCACCAAGAACAGAGACCCAGGG + Intronic
1018778033 6:167036408-167036430 GAACTAGGAGCAGAGGCCCTGGG + Intronic
1019574129 7:1728101-1728123 GAGGCAAAAAGAGAGGCCCCTGG - Intronic
1020111319 7:5449525-5449547 GAACCATCTACTGAGGCCCCAGG - Intronic
1022497143 7:30860283-30860305 GAATCCACAGCAGAGGCCCCTGG - Intronic
1022691979 7:32665067-32665089 GAACCAGAGACAGAGGCTCCAGG + Intergenic
1022919644 7:34999620-34999642 GAACCAGAGACAGAGGCTCCAGG + Intronic
1023089185 7:36601806-36601828 GAACCAAGCACAGAGGGGCCAGG + Intronic
1024358438 7:48443116-48443138 AAACCAAGGAGAGAGGCCTCAGG + Intronic
1026004898 7:66592662-66592684 AAGCCAAGAAGAGAGGCCTCAGG - Intergenic
1027176755 7:75908916-75908938 GATCAAAAAACAAAGGCCCCAGG + Intronic
1029676218 7:102070835-102070857 CATCCAAGATCAGTGGCCCCTGG + Intronic
1030208335 7:106972426-106972448 GCTCCAAGAACAAAGACCCCCGG - Intergenic
1030814466 7:114018013-114018035 CAACCAAGAACAGCAGCCCTAGG - Intronic
1032319624 7:130874258-130874280 GAGCACAGAACACAGGCCCCAGG + Intergenic
1032955304 7:136963675-136963697 GAACCCAGGACTGAGACCCCTGG - Intronic
1033452188 7:141471905-141471927 GAACCAAGAACAAAGCCACTGGG + Exonic
1034397621 7:150839156-150839178 GCATCAGGAAGAGAGGCCCCAGG - Intronic
1034675842 7:152891943-152891965 AAGCCAAGAAGAGAGGCCCCGGG + Intergenic
1034934553 7:155190439-155190461 AAACCAGGAAGAGAGGCCTCAGG + Intergenic
1035528989 8:336618-336640 AAGCCAAGAAGAGAGGCCTCAGG + Intergenic
1037202671 8:16276737-16276759 AAATCAAGAAGAGAGGCCTCTGG - Intronic
1037664155 8:20953475-20953497 GAACCCAGAGAAGAGGGCCCAGG + Intergenic
1038486346 8:27937727-27937749 GAGCCAAGGAGAGAGGCCTCAGG - Intronic
1038496785 8:28008932-28008954 AAACCAAGGACAGAGGCCACAGG + Intergenic
1039175512 8:34799645-34799667 GAACCAAGGACAGAGGTCAGGGG + Intergenic
1039825195 8:41167344-41167366 AAACCAAGAAGAGAGGCCTCGGG + Intergenic
1039848019 8:41339951-41339973 GAAGCCAGGACTGAGGCCCCAGG + Intergenic
1040543144 8:48377188-48377210 GAAGCAAACCCAGAGGCCCCTGG + Intergenic
1041409135 8:57534248-57534270 GAGTGAGGAACAGAGGCCCCAGG + Intergenic
1041775861 8:61522389-61522411 GAGCCAAGAAAAGAGGCCTCAGG - Intronic
1041960671 8:63611996-63612018 GAACCAATAACCAAGGCCACGGG + Intergenic
1045479483 8:102580750-102580772 CAGCCAAGCAGAGAGGCCCCAGG - Intergenic
1045646946 8:104308485-104308507 AAGCCAAGAAGAGAGGCCTCAGG + Intergenic
1047172774 8:122510111-122510133 GAGCCAAGGAGAGAGGCCTCAGG + Intergenic
1048329691 8:133463379-133463401 GAACTTAGAACAGAGGGGCCGGG + Intronic
1049431699 8:142568332-142568354 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
1049498172 8:142946450-142946472 GTGCCAAGGACAGAGGCCCCAGG - Intergenic
1049542317 8:143214239-143214261 GACACAAGCACAGAGGCCCCAGG + Intergenic
1050464203 9:5904356-5904378 AAACAAAGAACAGAGGCAACAGG - Intronic
1056048259 9:82741501-82741523 AAGCCAAGAAGAGAGGCCTCAGG + Intergenic
1057062055 9:92013007-92013029 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
1061010300 9:127950692-127950714 GACCCAAGGACAGAGGCCCCGGG + Intronic
1061736621 9:132664996-132665018 GAGCCAAGAACAGAGCACCTTGG - Intronic
1062379411 9:136280087-136280109 CAACCAAGGCCAGAGGCCCACGG + Intergenic
1185700145 X:2225526-2225548 AAACCAAGGAGAGAGGCCTCAGG + Intronic
1185726241 X:2424183-2424205 AAACCAAGGAGAGAGGCCTCAGG + Intronic
1186022579 X:5272516-5272538 AAGCCAAGGAGAGAGGCCCCAGG + Intergenic
1186112158 X:6269960-6269982 AAGCCAAGGAGAGAGGCCCCAGG - Intergenic
1188277459 X:28217867-28217889 AAGCCAAGAAAAGAGGCCTCAGG - Intergenic
1190723483 X:53171166-53171188 AGACCAAAAACAGAGGCCCAAGG - Intergenic
1191939525 X:66463142-66463164 GGTCCATGAACATAGGCCCCAGG - Intergenic
1192175014 X:68879996-68880018 GGACCAGGGAAAGAGGCCCCTGG - Intergenic
1193878380 X:86892313-86892335 AAGCCAAGAAAAGAGGCCTCAGG - Intergenic
1195868631 X:109461907-109461929 GAACAAACAACAGAAGCCCAGGG + Intronic
1196170194 X:112579005-112579027 CAACCAACCACAGTGGCCCCTGG + Intergenic
1197077292 X:122367295-122367317 GAACCAAAAACAGAAACTCCAGG + Intergenic
1197548418 X:127856766-127856788 AAACCAAGAAGAGAGGCCTTAGG - Intergenic
1197976854 X:132175015-132175037 GAAGCAATAACAGAAGCCCTTGG + Intergenic
1199731827 X:150641189-150641211 GAAGGAAGAAAAGAGGCCCAAGG + Intronic
1199775843 X:151011153-151011175 AAACCAAGGAGAAAGGCCCCAGG + Intergenic
1202281514 Y:23195663-23195685 AATCCAAGAACAGAGTCCCGGGG + Intronic
1202284377 Y:23222856-23222878 AATCCAAGAACAGAGTCCCGGGG - Intronic
1202433186 Y:24810048-24810070 AATCCAAGAACAGAGTCCCGGGG + Intronic
1202436051 Y:24837242-24837264 AATCCAAGAACAGAGTCCCGGGG - Intronic