ID: 1152267480

View in Genome Browser
Species Human (GRCh38)
Location 17:79304770-79304792
Sequence GGAACCAAGAACAGAGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 309}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152267480_1152267486 7 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267486 17:79304800-79304822 AGATTCTCGGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1152267480_1152267482 -6 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267482 17:79304787-79304809 GGTTCCAACTCTAAGATTCTCGG 0: 1
1: 0
2: 2
3: 15
4: 147
1152267480_1152267487 14 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267487 17:79304807-79304829 CGGAAGGTGCTGGTGGCTGTTGG 0: 1
1: 0
2: 2
3: 26
4: 328
1152267480_1152267488 15 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267488 17:79304808-79304830 GGAAGGTGCTGGTGGCTGTTGGG 0: 1
1: 0
2: 1
3: 41
4: 321
1152267480_1152267490 26 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267490 17:79304819-79304841 GTGGCTGTTGGGTTATATGAGGG 0: 1
1: 0
2: 1
3: 6
4: 139
1152267480_1152267489 25 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267489 17:79304818-79304840 GGTGGCTGTTGGGTTATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 134
1152267480_1152267485 4 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1152267480_1152267484 -2 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267484 17:79304791-79304813 CCAACTCTAAGATTCTCGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152267480 Original CRISPR GGAACCAAGAACAGAGGCCC CGG (reversed) Intronic
900211946 1:1460518-1460540 CGGGGCAAGAACAGAGGCCCAGG + Intronic
900467097 1:2831150-2831172 GGACCCAAGGGCAGAAGCCCGGG - Intergenic
900491571 1:2951901-2951923 GGAAACAAGATCTGTGGCCCTGG + Intergenic
900887253 1:5423724-5423746 GGCAGCAAGGTCAGAGGCCCTGG + Intergenic
901917337 1:12509969-12509991 ACAACCAAGAACAAAGCCCCGGG + Exonic
902230477 1:15024209-15024231 GAAACCAGGAACACGGGCCCTGG + Intronic
902392238 1:16113343-16113365 GACTCCAAGAAGAGAGGCCCAGG - Intergenic
902575616 1:17375360-17375382 GGTGCCAGGAACAGAGCCCCAGG - Intronic
902716567 1:18276815-18276837 GGAGCCAAGGAGAGAGCCCCTGG - Intronic
902991302 1:20189166-20189188 GGAGCAAAGGACAGAGGACCAGG - Intronic
903024143 1:20415201-20415223 GGAAGCAGGTACAAAGGCCCTGG + Intergenic
903529107 1:24016435-24016457 GGAATGAAGAACCGAGGCCTAGG - Intergenic
904041351 1:27586889-27586911 GGGACCCAGAAGAGAGGACCAGG - Intronic
904080511 1:27869526-27869548 GGAGCCAAGGACAGATCCCCAGG + Intergenic
904472241 1:30743044-30743066 GGAATCATCAACACAGGCCCAGG + Intronic
906110363 1:43318303-43318325 GGAACTCAGGAGAGAGGCCCAGG + Intronic
907489255 1:54798462-54798484 TGAACCAAAAACAGGGCCCCAGG - Intronic
907559791 1:55377981-55378003 GTGAGCAGGAACAGAGGCCCAGG + Intergenic
907628941 1:56060732-56060754 GCCACTAAGAACATAGGCCCTGG - Intergenic
910543123 1:88383731-88383753 GAAAGCAAGAACAGAACCCCAGG - Intergenic
910841634 1:91567272-91567294 GGCACCAATAACAGAAGCCCCGG + Intergenic
912755425 1:112321216-112321238 GGAGCCAAGGGCAGAGGTCCTGG - Intergenic
913161599 1:116150574-116150596 GGAAACAGGTACTGAGGCCCTGG - Intergenic
914880534 1:151543038-151543060 GGAAACACCAACAGAGTCCCAGG - Intronic
916895433 1:169157457-169157479 GGTAACAAGGGCAGAGGCCCTGG - Intronic
917334667 1:173915049-173915071 TGAACCAAGTACAGGGGCCCGGG + Intronic
918257216 1:182759540-182759562 AGAAGCAAGAAAAGAGACCCTGG + Intergenic
918749373 1:188252966-188252988 GAAACCAAAAACAGAGTGCCAGG + Intergenic
921096957 1:211895023-211895045 GGCACTAAGAACAGAGGGACTGG - Intergenic
921302461 1:213764281-213764303 AAAGCCAAGAACAGTGGCCCAGG + Intergenic
922235562 1:223720012-223720034 AGCACCAGGAACAGAGGCCATGG + Intronic
924215838 1:241821385-241821407 GGAAGAAAGCACAGAGGCACAGG + Intergenic
1062923042 10:1294312-1294334 GTGTGCAAGAACAGAGGCCCAGG + Intronic
1063662005 10:8041253-8041275 GGGACCAAGAACTGTAGCCCGGG - Intergenic
1063933102 10:11049489-11049511 GGAATGAAGATCAGAGGTCCCGG - Intronic
1064078242 10:12287316-12287338 GGAAACAAGACCATAGGACCTGG - Intergenic
1064145498 10:12823411-12823433 GGAGCAGAGCACAGAGGCCCAGG + Intronic
1065318495 10:24487030-24487052 GGAAGCAAAAACAGTGGACCAGG - Intronic
1065366697 10:24944150-24944172 GGAAAGAAGATCAGAGGCCGGGG - Intronic
1066000621 10:31101544-31101566 GGAAACAAGGAAAGAAGCCCTGG - Intergenic
1068869459 10:61927944-61927966 GGCTCCATTAACAGAGGCCCTGG + Intronic
1068935909 10:62635604-62635626 GGAAACAAGCACAGAGACCCAGG - Intronic
1070680362 10:78444809-78444831 GGAGCCAAGGAGAGAGGCCTTGG - Intergenic
1070953833 10:80451908-80451930 GGAACTCAGAAGAGAGGCCAGGG - Intergenic
1073114476 10:101083542-101083564 AGAACCCAGAACAAAGGGCCAGG + Intergenic
1073206677 10:101773106-101773128 GGCCCTAAGAACAGAGGCTCAGG - Intronic
1074552756 10:114460228-114460250 GAGACCAAGTACAGAGGCCCTGG - Intronic
1075092331 10:119450818-119450840 GATGCCAGGAACAGAGGCCCTGG - Intronic
1075169326 10:120098467-120098489 GGAAGGCAGAACAGAGGCTCTGG + Intergenic
1075548290 10:123372856-123372878 GGCACCAAGGACAGACCCCCAGG + Intergenic
1076500836 10:130934725-130934747 AGAAGCCAAAACAGAGGCCCTGG + Intergenic
1077101769 11:825662-825684 GAAACCAAGCACAGGGGACCTGG + Intergenic
1077660215 11:4061258-4061280 AGAACCAACAAGAGGGGCCCTGG + Intronic
1077775850 11:5270663-5270685 GCAAGCAAGAAGAGAGCCCCAGG - Intronic
1080228138 11:29984026-29984048 CAAACCAAAAATAGAGGCCCTGG + Intergenic
1081861992 11:46338609-46338631 GGAAACAAGAACTGAGGCATCGG + Intronic
1083194790 11:61079421-61079443 GGAAACAAGAACTGAGGGGCAGG + Intergenic
1084462753 11:69305219-69305241 GGGTGCAAGAACAGAGGCCTGGG + Intronic
1084705763 11:70815265-70815287 GGAAGGAAGAACACAGGCCAAGG + Intronic
1086169767 11:83822700-83822722 GGAACCAGGCTCAGAGGCCAAGG - Intronic
1089580705 11:119480445-119480467 GGGACCAAGGAGAGAGCCCCAGG - Intergenic
1090190933 11:124767502-124767524 GGACCCAGGAAAAGAGGGCCGGG - Exonic
1090736992 11:129618724-129618746 GGTACCAAGAACAGAGGAGACGG - Intergenic
1090795676 11:130133903-130133925 GGAACCAAGGACAGGTGCACTGG + Intronic
1091177930 11:133578938-133578960 CGTAGCAAGAACCGAGGCCCTGG + Intergenic
1091824223 12:3498443-3498465 GGAAGCAAGAAAAGACGTCCTGG - Intronic
1092711549 12:11343078-11343100 GGAGGCAAGAACTGAGGCTCTGG - Intergenic
1093997042 12:25654081-25654103 GGAAACAAGAACTGTGGCTCTGG + Intergenic
1095582326 12:43814466-43814488 GCAGCCCAGAACAGAGGGCCAGG - Intergenic
1096217164 12:49804054-49804076 GGAACAAGGAAGAGAAGCCCCGG + Exonic
1096541603 12:52310771-52310793 GTAGGGAAGAACAGAGGCCCTGG - Intergenic
1099810827 12:87580129-87580151 GGAACCATGAAAGGAGGCTCTGG + Intergenic
1103633309 12:122280976-122280998 GGAACAGAAAACTGAGGCCCAGG + Intronic
1110182763 13:72636914-72636936 GGAAAGAAGAACTGAGTCCCGGG - Intergenic
1110478689 13:75948143-75948165 GAAACCAAGATCTGAGGGCCAGG + Intergenic
1112428945 13:99332679-99332701 GGAACAAAGAGCATATGCCCGGG - Intronic
1113783741 13:112991050-112991072 GGACCCAGGTACAGAGCCCCAGG - Intronic
1114194541 14:20465656-20465678 AGAGCAAAGAACTGAGGCCCAGG - Intergenic
1114385775 14:22252719-22252741 AGAAACAAGTACAGAGGGCCAGG - Intergenic
1114547801 14:23514988-23515010 GGAAACAAGCACAGAGGGACAGG + Intergenic
1117815531 14:59593734-59593756 AGGACCAAGAGCAGAGCCCCTGG - Intergenic
1118311120 14:64693897-64693919 GGAACCGAGATCAGAAGACCAGG - Intergenic
1118765397 14:68906320-68906342 GGAACCAAGAATAGAGGAGAAGG - Intronic
1119404142 14:74386187-74386209 GGAGGCAAGAAGAGAGGTCCTGG + Intergenic
1121184863 14:91958037-91958059 GGTGCAAAGTACAGAGGCCCCGG + Intergenic
1121510603 14:94510064-94510086 GGTACCCAGACCACAGGCCCAGG - Intronic
1121732728 14:96197758-96197780 TGAGCCAAGAACAGGGCCCCAGG + Intergenic
1122117957 14:99536990-99537012 GGGACCCAGAACACAGGCCGGGG + Intronic
1122544168 14:102513106-102513128 GGCTGCAAGCACAGAGGCCCCGG + Intergenic
1124143578 15:27099373-27099395 GGAACCAAGGAGAGAGGCCTCGG - Intronic
1124167826 15:27343858-27343880 GGGAGCAAGAACAGAGGACTTGG + Intronic
1128241746 15:66106014-66106036 GGAACCAAGGGCAGAAGCCAGGG - Intronic
1128269347 15:66294302-66294324 GAAACCAAGGACTGGGGCCCAGG - Intronic
1128594128 15:68929257-68929279 GGAAGCAAGACTAGAGGCGCCGG - Intronic
1128724326 15:69976561-69976583 AGAACCATGGACAGAGGCACAGG - Intergenic
1129253256 15:74320103-74320125 GGAACCAGGAGCAGAGACCTGGG + Intronic
1129320811 15:74773652-74773674 GAAAGCAGGAAAAGAGGCCCTGG - Intergenic
1129321090 15:74775439-74775461 GGCAACAGGAGCAGAGGCCCTGG - Intergenic
1130327875 15:82896102-82896124 GGGACCAAGAACAGGGTCTCTGG + Intronic
1130821074 15:87496192-87496214 GGGACCGAGAGGAGAGGCCCTGG - Intergenic
1131158210 15:90087948-90087970 TGAGCCAATCACAGAGGCCCTGG - Intronic
1132609044 16:805962-805984 GGACCTAAGACCAGATGCCCAGG - Intronic
1132632334 16:924897-924919 GGAAACAAGTATTGAGGCCCAGG + Intronic
1133424622 16:5677148-5677170 GTAACCAACATCAGAGGCCTGGG - Intergenic
1134066249 16:11230299-11230321 GGAGCCCAGAGCAGAGGCTCAGG - Intergenic
1134482646 16:14632661-14632683 GGATACAAGAACAGCCGCCCAGG + Intronic
1134763913 16:16739117-16739139 GGAGCCAAGAGCATAGGCTCTGG + Intergenic
1134982141 16:18620046-18620068 GGAGCCAAGAGCATAGGCTCTGG - Intergenic
1135112067 16:19698080-19698102 GAAACCCAGAACAGAGACGCCGG - Intronic
1135936097 16:26781480-26781502 TGAACCAATTACCGAGGCCCAGG - Intergenic
1136227672 16:28869896-28869918 GGAACTCAGAACAGAGGGTCAGG - Intronic
1138091731 16:54180230-54180252 TGAACCAATAACCGTGGCCCGGG - Intergenic
1138205518 16:55121656-55121678 GGAACCCAGAACTAAGGCCAGGG + Intergenic
1141613669 16:85198138-85198160 GGAAGGAAGATCAGAAGCCCTGG + Intergenic
1141658570 16:85429422-85429444 GGAACCAAGGACGGGGGCTCTGG + Intergenic
1143861953 17:9897510-9897532 GGAGCCATGACCAGTGGCCCAGG - Exonic
1145722283 17:27084060-27084082 GGAACCAAGAAATGGGGACCAGG + Intergenic
1147134002 17:38424986-38425008 GCAACAAACAACAGAGGCTCTGG - Intergenic
1150267064 17:63838523-63838545 GGAGGCAAGGATAGAGGCCCAGG + Intronic
1150452165 17:65278369-65278391 GGGGCAAAGAACAGAGTCCCCGG - Intergenic
1151099015 17:71533929-71533951 AGAACCAGGAGCAGAGCCCCAGG - Intergenic
1151244006 17:72780299-72780321 CAAACCAAGAAGAGAGGCCAGGG - Intronic
1151518137 17:74610295-74610317 AGAACCAAGGACAGAGCCCTCGG - Exonic
1151656735 17:75499680-75499702 GGACCCACGAGCAGAGGCACTGG - Exonic
1152038774 17:77890026-77890048 GGAAGCAAGAAGAGAGGCACAGG + Intergenic
1152267480 17:79304770-79304792 GGAACCAAGAACAGAGGCCCCGG - Intronic
1152283285 17:79397867-79397889 ACAACCACAAACAGAGGCCCTGG + Intronic
1152528463 17:80902990-80903012 GGAACGCAGATCAGAGGCCTGGG + Intronic
1154388257 18:13914752-13914774 GTTACCTAGAAAAGAGGCCCAGG - Intronic
1155997670 18:32348226-32348248 AGAACAAAGGACAGAGGACCAGG + Intronic
1156638899 18:39066034-39066056 AGAACCAAGAAGAGAGCGCCTGG - Intergenic
1157831503 18:50860776-50860798 TGAACCCAGGACAGAGACCCAGG - Intergenic
1158020337 18:52834007-52834029 GTACCCAAGCACATAGGCCCCGG - Intronic
1158518248 18:58148527-58148549 CAAGCCAAGAACAGAGGCCTCGG - Intronic
1158679683 18:59556093-59556115 GGAAGGAGGAACAGAGGTCCTGG - Intronic
1159150455 18:64516841-64516863 GGAAACAAGAAGAGACGCTCTGG - Intergenic
1160579878 18:79877651-79877673 TGAATTGAGAACAGAGGCCCAGG + Intronic
1160999089 19:1900293-1900315 GGAAAAAAGTACAGAGGCCGAGG - Intergenic
1161129009 19:2577229-2577251 GGTACCCTGAACAGAGGCCCTGG - Intronic
1162112075 19:8404735-8404757 GGAGCCAAGAGCAGTGGCCAGGG + Intronic
1163578122 19:18122532-18122554 ATAACCAAGAACAGAGACACAGG - Intronic
1163833669 19:19560359-19560381 GGCACCAAGAACCAGGGCCCTGG - Intergenic
1163900590 19:20096264-20096286 GGAGCAAAGAACAGAGGACAGGG + Intronic
1164669920 19:30066718-30066740 AGAAGCAAGTGCAGAGGCCCTGG + Intergenic
1164955109 19:32376523-32376545 GGACCCAACCACAGAGGCCCAGG + Intronic
1165895054 19:39136423-39136445 GGCAGCAAGAACAAAGGCCCCGG - Intronic
1166048935 19:40246778-40246800 GGAATCAGGAGCACAGGCCCTGG + Intronic
1166385303 19:42377260-42377282 GGAAGCAAAGGCAGAGGCCCTGG + Exonic
1166388489 19:42395755-42395777 AGATCAAAGAACAGAGGCCATGG + Intergenic
1167106976 19:47436102-47436124 AGAGCCAAGCACAGAAGCCCTGG - Intronic
1167197219 19:48038524-48038546 GGCACTAAGAATAGAGGCCCTGG + Intronic
1167290886 19:48624688-48624710 GGACCCAGGGACAGAGACCCAGG + Intronic
1168098450 19:54128509-54128531 GGAAACGAGAATAGAGGCCGGGG - Intronic
1168356682 19:55704475-55704497 GGAGCCAAGGAGAGAGGCCTTGG + Intronic
925839196 2:7975066-7975088 GTGACCAAGAGCAGGGGCCCAGG - Intergenic
925844140 2:8020465-8020487 GGCACAAAGACCAGAGGCCCGGG + Intergenic
925926055 2:8671464-8671486 GGAACCAAGAGCTCAGGCTCAGG + Intergenic
926783850 2:16500543-16500565 AGAAGCAAGGACAAAGGCCCTGG - Intergenic
927687225 2:25179463-25179485 GGCACCAAGAACAGCTGCCTAGG - Intergenic
928125824 2:28615119-28615141 GGAGCCAGGAACACAGTCCCAGG + Intronic
928401520 2:30982018-30982040 AGAACCAGGCACAGAGGGCCTGG - Intronic
928482428 2:31696144-31696166 GGAACCAGGAGCTCAGGCCCAGG + Intergenic
929901146 2:46004912-46004934 GGAACCAGGGACAGAGGCAAGGG - Intronic
930608147 2:53513644-53513666 GGAACCAGGAACACAGGCAGAGG - Intergenic
930625507 2:53692382-53692404 GGAAACAAGAAAAGAGGGCTTGG + Intronic
932467335 2:71932368-71932390 GGAACCAAGCACGGTGGCCTGGG - Intergenic
933950371 2:87323709-87323731 AGAACCGAGAAGAGAAGCCCGGG + Intergenic
934926399 2:98384723-98384745 GAAACCATGGACAGAGGTCCTGG + Intronic
936095728 2:109529064-109529086 GGAAACAAGCCCAGAGGCCATGG + Intergenic
936329407 2:111534864-111534886 AGAACCGAGAAGAGAAGCCCGGG - Intergenic
936787421 2:116110794-116110816 GGAAGCTAGAAAAGAGGCACAGG - Intergenic
937271939 2:120658566-120658588 GGAAATTAGAACAGAGGCCCTGG + Intergenic
937808709 2:126175572-126175594 GGAGCCAAGAAGAGAAGTCCCGG + Intergenic
939232398 2:139446461-139446483 GGAAACAGTAACAGTGGCCCAGG + Intergenic
943282957 2:185961258-185961280 GGAAAAAAGAACAGAGCCTCAGG + Intergenic
944682557 2:202090630-202090652 GGCACCAAAAACAGATGCCTCGG - Intronic
947531137 2:230909245-230909267 GGAAGGAAGAAGACAGGCCCAGG - Exonic
948042263 2:234911821-234911843 GGAAACAAGGACAAAGGCCAAGG + Intergenic
948364463 2:237445845-237445867 GCCACAAAGAACAGAGCCCCAGG + Intergenic
948845552 2:240681292-240681314 GCCACCCAGGACAGAGGCCCGGG + Intronic
948848301 2:240693438-240693460 GCCACCCAGGACAGAGGCCCGGG - Intronic
949032367 2:241803109-241803131 GGTGCCCAGAACAGAGGCCAAGG - Intronic
1169026515 20:2376164-2376186 GGAGCCAAGCACAGATGCCTGGG - Intergenic
1171232300 20:23497273-23497295 GGAACCCCGAACAGAGGGACCGG - Intergenic
1171823138 20:29873962-29873984 GGATCCGAGACCAGCGGCCCCGG + Intergenic
1172183342 20:33016783-33016805 GGAAGAAAGAACAGAGGCCGTGG - Intronic
1172205532 20:33160377-33160399 TGGACCAAGAACAGGTGCCCTGG - Intergenic
1172230860 20:33334580-33334602 GGAACCAAGAAGAGAGGCAGGGG + Intergenic
1173706750 20:45115610-45115632 GGACCCAAGAGGAGAGGCCAGGG - Intergenic
1173874055 20:46358656-46358678 GGAACCATCAGCAGAGCCCCAGG + Intronic
1173898595 20:46569837-46569859 GACACCAAGAAGAGAGGACCTGG - Intronic
1174883046 20:54302101-54302123 GGTACCCAGGACAGAGGGCCTGG + Intergenic
1175327166 20:58137835-58137857 GGAACCATGGACATAGGCACTGG - Intergenic
1175930192 20:62490206-62490228 AGATCCAAGAACATGGGCCCTGG + Intergenic
1176200531 20:63858357-63858379 GGAACCAGGATCAGAGCCCCTGG - Intergenic
1179765770 21:43571963-43571985 GGAACCACCAACAGATCCCCTGG + Intronic
1179880470 21:44291441-44291463 GCAAAGCAGAACAGAGGCCCAGG + Intronic
1180139719 21:45886123-45886145 GGTACCAAGGACAGAGGACATGG + Intronic
1181484058 22:23219462-23219484 AGAACCAGGGACAGAGGCCAAGG - Intronic
1182052996 22:27327617-27327639 AGAACCAAGAAGAGTGTCCCAGG + Intergenic
1183377861 22:37475559-37475581 GGAGACAGGAACAGAGTCCCAGG + Intronic
1184105317 22:42364061-42364083 GGGACCAAGACCAGTGGGCCAGG - Intergenic
1184236501 22:43186075-43186097 AGAGCCAAGAACAGGGACCCGGG - Intronic
1184390696 22:44201485-44201507 GGAACCAAGTCCAGAGCACCTGG - Intronic
1184687998 22:46105035-46105057 GGAAGCAAGCTCAGAGGCTCAGG - Intronic
1185378944 22:50497873-50497895 AGAACCACGGGCAGAGGCCCTGG - Intergenic
950478825 3:13232260-13232282 GGAAACAAGAACATGGGCCAAGG + Intergenic
950644151 3:14367252-14367274 GGAAGCAAGAGCAAAGGCCATGG + Intergenic
953226521 3:41026592-41026614 AGAGCCAAGAACTGAGCCCCTGG + Intergenic
953584261 3:44185522-44185544 GGAAGCAAGTACAAAAGCCCTGG - Intergenic
953864169 3:46569751-46569773 GGAACCAAGAACATATGCTAGGG + Intronic
955587760 3:60499727-60499749 GGAAACAAGAACAAAGGCTCAGG - Intronic
955997080 3:64688249-64688271 GGGACCAGGAACAGCTGCCCCGG - Intergenic
956249566 3:67221498-67221520 GCAACCAGGAACAAAGGGCCGGG + Intergenic
956612572 3:71139224-71139246 TGAGCCCAGAACAGAGGACCAGG - Intronic
957856116 3:85881055-85881077 ATAGCAAAGAACAGAGGCCCAGG - Intronic
958621958 3:96573711-96573733 GGGACCCTGAACAGAGGCACCGG - Intergenic
959000297 3:100956528-100956550 ACTACAAAGAACAGAGGCCCTGG + Intronic
960112901 3:113862845-113862867 GGAACCCCGAACAGAGGGACCGG - Intronic
961093310 3:124134044-124134066 GGAACCAAAAAGAGAGCCCATGG + Intronic
964099248 3:152968897-152968919 AGGACCAAGAACTGAGCCCCAGG - Intergenic
964484762 3:157175896-157175918 GAAGACAAGAAAAGAGGCCCTGG - Intergenic
965223215 3:165954131-165954153 GGATCCAAGAACAGTGGTCCAGG + Intergenic
965751383 3:171978216-171978238 ACAACCAAGTACAGTGGCCCTGG - Intergenic
967468351 3:189834098-189834120 GGAGACAAGACCAGAGGCGCCGG + Intronic
968040965 3:195588972-195588994 GGAGCCAAGAAAAGAGGCAGGGG + Intergenic
968488260 4:875537-875559 GGAACCAAGAGCACAGAGCCTGG + Intronic
968816059 4:2822613-2822635 AGAGCCAGGACCAGAGGCCCAGG - Intronic
969318505 4:6396201-6396223 GGCATCAAGAGCACAGGCCCTGG - Intronic
969491352 4:7500886-7500908 GAAACCCAGGACAGAGCCCCAGG + Intronic
969840591 4:9878753-9878775 CCAACCAAAAACAGAGTCCCAGG - Intronic
971612314 4:28741539-28741561 GGAACCCAGAAAAGAAGCCAGGG - Intergenic
972890204 4:43548822-43548844 GGAGGAAAGAATAGAGGCCCTGG + Intergenic
973810046 4:54560695-54560717 GGAACAAACAACAGTGGCCATGG - Intergenic
976521971 4:86039254-86039276 GGAAACAAGAAAAGATGCACTGG + Intronic
983289293 4:165781547-165781569 AGAAGCAAGAACAGAGCCTCAGG - Intergenic
983337155 4:166411223-166411245 TGCAACAAGCACAGAGGCCCTGG + Intergenic
983488085 4:168354873-168354895 GCAAGCAAGAACAGAGGAGCAGG - Intergenic
983648238 4:170013641-170013663 GGAACCAAGAAAACAATCCCAGG - Intronic
987330322 5:16851224-16851246 GGAACAAATAACAGAGTCTCCGG - Intronic
988512595 5:31878287-31878309 GGGACCAAGAAAAAAGCCCCTGG - Intronic
989151761 5:38306951-38306973 AGAACCAAGAACCAAGGCCCTGG + Intronic
990558383 5:56959392-56959414 GGAATGGAGAACAGAGGCACTGG - Intronic
990709926 5:58569081-58569103 TGAACCAAGAGCAGAGGTCATGG + Intergenic
995992635 5:118261331-118261353 GCAAGCATAAACAGAGGCCCAGG - Intergenic
996579343 5:125013402-125013424 GGACCCAAGAACAGAGTTCTGGG - Intergenic
997787934 5:136730468-136730490 GACACCATGAAGAGAGGCCCAGG + Intergenic
998204404 5:140148675-140148697 GGAAGCAAGGAGAGATGCCCGGG - Intergenic
999737598 5:154524216-154524238 GGAACAAAGAAAAGAGGCACTGG + Intergenic
1000030710 5:157398829-157398851 CAAACCAAGAAGAGAGACCCTGG - Intronic
1001293850 5:170485280-170485302 AGGCCCAAGACCAGAGGCCCAGG - Intronic
1001856118 5:175012356-175012378 GGAACCAAGAAGAGATGATCAGG - Intergenic
1001874105 5:175184513-175184535 AGAAATAAGAACACAGGCCCAGG + Intergenic
1003279241 6:4677534-4677556 GGAAGCAAGATCAGAGGAACTGG - Intergenic
1004427095 6:15513852-15513874 GAAACCAAGAACAGAGCCAAAGG - Intronic
1004471372 6:15932453-15932475 GGAACCCTGAACAGAGGGACTGG - Intergenic
1005298180 6:24446793-24446815 GGAACCATGAACACAGGGGCAGG - Intronic
1006163138 6:32049543-32049565 AGAACCCAGCACTGAGGCCCCGG - Intronic
1006163779 6:32052943-32052965 AGAACCCAGCACGGAGGCCCCGG - Intronic
1006164392 6:32056124-32056146 GGAACTCAGCACTGAGGCCCCGG - Intronic
1007100150 6:39240486-39240508 GGAAGCCAGAACTGAGACCCAGG + Intergenic
1007429548 6:41768790-41768812 GGATCCAGGAAATGAGGCCCAGG + Intergenic
1007640811 6:43338057-43338079 GAAACCAAAAACAGAAGCACTGG - Exonic
1007734484 6:43972156-43972178 GAAAACAAAAACAGAGACCCAGG + Intergenic
1008475254 6:51929265-51929287 GGAATCATGCAGAGAGGCCCTGG + Intronic
1008505671 6:52227276-52227298 GGAACAAAGAGCGGAGGCACTGG + Intergenic
1010705631 6:79105824-79105846 GGAAACATGGAAAGAGGCCCTGG + Intergenic
1012620912 6:101342923-101342945 GAAATCAAGCACTGAGGCCCAGG - Intergenic
1014520571 6:122437857-122437879 GCACCCAAGAACAGAGGATCAGG + Intergenic
1015564992 6:134560450-134560472 GAAACCAAGCCCAGAGGCCTAGG + Intergenic
1016528919 6:145036726-145036748 GGAACCAAGTACAGACACCAAGG - Intergenic
1018259586 6:161956233-161956255 GGAATCAAGAGCACAGGCCCTGG - Intronic
1018277633 6:162149854-162149876 TGAAGCAAGAACAGGGGGCCAGG + Intronic
1018344062 6:162882415-162882437 TCCACCAAGAACAGAGACCCAGG + Intronic
1018778032 6:167036407-167036429 TGAACTAGGAGCAGAGGCCCTGG + Intronic
1019500976 7:1364610-1364632 GGACCCAGAAACTGAGGCCCAGG - Intergenic
1020472076 7:8549159-8549181 TGAACCAAGAACCCAGACCCTGG + Intronic
1021590077 7:22251480-22251502 GGAACCAAGGACAAAGGAGCTGG + Intronic
1021680782 7:23129154-23129176 GCAACCATGGACAGAGGCCCAGG - Intronic
1022156286 7:27664424-27664446 GAAACCAGGAAGAGAGGCACAGG - Intergenic
1022508588 7:30921719-30921741 GGTACCAAGACCAGAGGCAAGGG - Intronic
1023764720 7:43499946-43499968 AGAACCAAGAACAGTCTCCCAGG - Intronic
1028162076 7:87497467-87497489 GGCAGCCAGAACAGAAGCCCAGG + Intergenic
1029513630 7:101012559-101012581 GGAACCCAGAAGCCAGGCCCAGG + Intronic
1032005650 7:128300270-128300292 AGAACCCAGAACAGAGCCTCTGG - Exonic
1033452187 7:141471904-141471926 AGAACCAAGAACAAAGCCACTGG + Exonic
1033615395 7:143009519-143009541 GGAACAAGGAACAGAGGCAGGGG - Intergenic
1034675841 7:152891942-152891964 CAAGCCAAGAAGAGAGGCCCCGG + Intergenic
1034676519 7:152896255-152896277 GGACCCCAGCACAGAGGCTCAGG + Intergenic
1037928146 8:22861158-22861180 GGAATCAAAACCTGAGGCCCTGG - Intronic
1038513062 8:28158706-28158728 TTAACCAAGGACAGAGCCCCAGG + Intronic
1038588535 8:28813355-28813377 GGAGGAAAGAACAGAGGCTCTGG + Intronic
1039175511 8:34799644-34799666 GGAACCAAGGACAGAGGTCAGGG + Intergenic
1039825194 8:41167343-41167365 CAAACCAAGAAGAGAGGCCTCGG + Intergenic
1046857720 8:119052939-119052961 GGAACCAAGAAGAGAGGGGAAGG + Intronic
1049214899 8:141403014-141403036 GGACGGAAGAACAGCGGCCCTGG - Intronic
1049697794 8:143992091-143992113 GGACCCAGGCACAGAGGCTCAGG - Intronic
1050595759 9:7203171-7203193 GGACCCAAGCACTGAGGCACAGG + Intergenic
1052280120 9:26723548-26723570 GGAACAAAGAACAGAGGCTAAGG - Intergenic
1052327676 9:27233040-27233062 GGAACCAAGAATGGAAGCACAGG - Intergenic
1053527519 9:38845100-38845122 GGAGCCCAGAGCAGAGCCCCGGG + Intergenic
1053539310 9:38957577-38957599 GGAACAGAGGACTGAGGCCCAGG + Intergenic
1053893991 9:42725409-42725431 GGGACAAAAACCAGAGGCCCGGG - Intergenic
1054199744 9:62069529-62069551 GGAGCCCAGAGCAGAGCCCCGGG + Intergenic
1054626829 9:67406341-67406363 GGAACAGAGGACTGAGGCCCAGG - Intergenic
1054638611 9:67518828-67518850 GGAGCCCAGAGCAGAGCCCCGGG - Intergenic
1055692722 9:78850872-78850894 GAAAACATGAACAGAGGCTCAGG - Intergenic
1055915562 9:81396801-81396823 GGAACCACGTACAGAGGTACAGG + Intergenic
1056581657 9:87891060-87891082 GGAACCCAGCACAGGGGACCTGG - Intergenic
1057296976 9:93852045-93852067 GGAAGCCAGAACACAGTCCCAGG - Intergenic
1057569955 9:96197063-96197085 GGAACCAAGAAGCCAGGCCCAGG + Intergenic
1058721794 9:107770866-107770888 GGGATTAAGACCAGAGGCCCTGG + Intergenic
1059214587 9:112548953-112548975 GGAACTAAGGAGAGAGGCCTTGG + Intronic
1059434863 9:114270021-114270043 GACAGCAAGAACAGAGTCCCTGG - Intronic
1060431550 9:123555194-123555216 GGAACTCAGAAGAGAGCCCCGGG - Intronic
1060816905 9:126639723-126639745 GGGACCAAGGGGAGAGGCCCAGG + Intronic
1061010299 9:127950691-127950713 GGACCCAAGGACAGAGGCCCCGG + Intronic
1061675375 9:132212604-132212626 GGAACCAACAACAGAGCCGTGGG - Intronic
1061816356 9:133199734-133199756 GGAGCCAGGGACGGAGGCCCAGG + Intergenic
1185939258 X:4296887-4296909 GGATCCAAGAACATAGGGCGTGG + Intergenic
1186403033 X:9277184-9277206 AGAAGCAAGAAGAGAGGCCCGGG - Intergenic
1192968266 X:76202840-76202862 GGAAGCAATAAAAAAGGCCCTGG - Intergenic
1193600681 X:83505829-83505851 GGTACCAGGAGCAGAGGCCATGG + Intergenic
1195868630 X:109461906-109461928 GGAACAAACAACAGAAGCCCAGG + Intronic
1196830655 X:119773055-119773077 GGAAAAAAGAAAAGATGCCCGGG - Intergenic
1198603290 X:138308572-138308594 GTAATCAAGAAAAGAGGCCTAGG + Intergenic
1199728727 X:150609560-150609582 TGAACCAAGTACAGATACCCAGG - Intronic
1200013535 X:153140129-153140151 GGAACCTAGAACACAGGGGCAGG + Intergenic
1200026066 X:153259789-153259811 GGAACCTAGAACACAGGGGCAGG - Intergenic
1200062806 X:153491141-153491163 GGAAACAAGAACTGGGCCCCGGG - Intronic
1200310054 X:155069307-155069329 ATTACCAAGAACACAGGCCCAGG + Intronic
1201343466 Y:12958023-12958045 GGCACAAAGATCACAGGCCCTGG - Intergenic
1201955641 Y:19619483-19619505 GGAACAAAGTTCACAGGCCCTGG - Intergenic
1202281513 Y:23195662-23195684 TAATCCAAGAACAGAGTCCCGGG + Intronic
1202284378 Y:23222857-23222879 TAATCCAAGAACAGAGTCCCGGG - Intronic
1202433185 Y:24810047-24810069 TAATCCAAGAACAGAGTCCCGGG + Intronic
1202436052 Y:24837243-24837265 TAATCCAAGAACAGAGTCCCGGG - Intronic