ID: 1152267481

View in Genome Browser
Species Human (GRCh38)
Location 17:79304776-79304798
Sequence AGAGTTGGAACCAAGAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 269}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152267481_1152267491 28 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267491 17:79304827-79304849 TGGGTTATATGAGGGAGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 189
1152267481_1152267489 19 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267489 17:79304818-79304840 GGTGGCTGTTGGGTTATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 134
1152267481_1152267486 1 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267486 17:79304800-79304822 AGATTCTCGGAAGGTGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
1152267481_1152267487 8 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267487 17:79304807-79304829 CGGAAGGTGCTGGTGGCTGTTGG 0: 1
1: 0
2: 2
3: 26
4: 328
1152267481_1152267488 9 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267488 17:79304808-79304830 GGAAGGTGCTGGTGGCTGTTGGG 0: 1
1: 0
2: 1
3: 41
4: 321
1152267481_1152267485 -2 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1152267481_1152267490 20 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267490 17:79304819-79304841 GTGGCTGTTGGGTTATATGAGGG 0: 1
1: 0
2: 1
3: 6
4: 139
1152267481_1152267484 -8 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267484 17:79304791-79304813 CCAACTCTAAGATTCTCGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152267481 Original CRISPR AGAGTTGGAACCAAGAACAG AGG (reversed) Intronic
902739642 1:18427038-18427060 AGACTTGGAGCCTAGGACAGAGG - Intergenic
904306307 1:29592442-29592464 AGAGTTGGAACCCAGTGGAGGGG + Intergenic
904905829 1:33896618-33896640 AGGACTGGAACCAAGAAGAGGGG + Intronic
905027025 1:34857676-34857698 AGAATTGGAACCAAAGAGAGAGG - Intronic
905321992 1:37124438-37124460 AGGGCTGGAGCCAAGAGCAGTGG - Intergenic
905980042 1:42216866-42216888 AGAGATGAAACTAAAAACAGAGG + Intronic
906007840 1:42493287-42493309 AGAGTTAGAATCAACAAAAGTGG + Intronic
906120855 1:43389657-43389679 AGAGTTGGGACTGAGAAGAGAGG - Intronic
906891473 1:49720440-49720462 GGAGATGGAACCAAGGACACAGG - Intronic
907372284 1:54011283-54011305 AGAGTTGGAACCAATCAGGGAGG + Intronic
908153718 1:61330524-61330546 AGAGGTGGACACAAGAAAAGGGG + Intronic
908837182 1:68239666-68239688 AGAGTTGAACACATGAACAGAGG - Intergenic
910716699 1:90239236-90239258 AAAGGAGGAACAAAGAACAGAGG - Intergenic
911610062 1:99950820-99950842 AAATTTAGAACAAAGAACAGTGG - Intergenic
912798877 1:112708592-112708614 GGAGTAGGAATTAAGAACAGGGG - Intronic
913683116 1:121206066-121206088 AGAGTAGGAGGAAAGAACAGAGG + Intronic
914034957 1:143993691-143993713 AGAGTAGGAGGAAAGAACAGAGG + Intergenic
915021816 1:152786592-152786614 AGAGCTGGAGCCATGGACAGGGG + Intronic
915122242 1:153636768-153636790 TGAGATGCAACTAAGAACAGAGG - Intronic
915936252 1:160091856-160091878 AGTGATGGTACCAAGGACAGTGG + Exonic
916484497 1:165246419-165246441 AGAGTTGAAAGCGATAACAGAGG + Intronic
916732779 1:167581295-167581317 AAATTTAGAACAAAGAACAGCGG + Intergenic
918564400 1:185910964-185910986 ATAGTTGGAACTTAGAAAAGAGG - Intronic
919040489 1:192381716-192381738 ACATTTAGAACCTAGAACAGTGG + Intergenic
920470425 1:206224576-206224598 AGAGTAGGAGGAAAGAACAGAGG + Intronic
921048804 1:211496218-211496240 AGAGTGGGCACCATGCACAGGGG - Intergenic
921615039 1:217256667-217256689 AGAGTGGGAGCTAAGTACAGTGG + Intergenic
922007413 1:221545891-221545913 AGAGTTGGAAACAATATCATGGG - Intergenic
922614968 1:226956062-226956084 AGAGTGGGAACCAGGGAGAGTGG - Intronic
922615034 1:226956348-226956370 AGAGTGGGAACCAGGGAGAGTGG - Intronic
923733077 1:236572429-236572451 AGAGTTGGCACCAATATCTGAGG + Exonic
923858002 1:237865089-237865111 AGTGTTGGAGGCAGGAACAGAGG - Intergenic
924062389 1:240188512-240188534 AGAGTTGGGCCCAATAACAGCGG + Intronic
1063383051 10:5598059-5598081 AGAGGTAGAAACAACAACAGAGG + Intergenic
1067706462 10:48610061-48610083 AGAGCTGAAGCCAGGAACAGTGG - Intronic
1068414820 10:56706629-56706651 AGAGTTGGAAGCTATAAAAGTGG - Intergenic
1068991001 10:63150521-63150543 AGAGTTGGAGCCAGGCGCAGTGG - Intronic
1069336198 10:67354005-67354027 AGAATTGGGACCAAGAATGGAGG - Intronic
1069643032 10:69968547-69968569 AGAGATGGAGACAGGAACAGGGG - Intergenic
1070360222 10:75681197-75681219 AGAGCTGAAACCAAGAAGAGAGG + Intronic
1070948036 10:80408990-80409012 ATTGTTGGGACAAAGAACAGAGG + Intronic
1070959514 10:80488796-80488818 AGGATTGGAACCAAGGACAGGGG - Intronic
1071116880 10:82232343-82232365 AGACTTGGAACAAAAAATAGTGG + Intronic
1071267692 10:83978898-83978920 AGAGTTTGAACTTAGACCAGGGG + Intergenic
1071495496 10:86164956-86164978 AGAGATGGAGCAAAGAACAGTGG + Intronic
1071984453 10:91036577-91036599 AGAGTTGGAACTAAAAGAAGAGG + Intergenic
1074203308 10:111258736-111258758 AGAATAGGAACTAACAACAGTGG - Intergenic
1076069121 10:127472047-127472069 AGAATTAGAACCTAGAAAAGAGG + Intergenic
1076177066 10:128376442-128376464 AGAGTGAGAACCAAGCAAAGGGG + Intergenic
1076501777 10:130942963-130942985 AGAGTTGGGACCCACAAAAGAGG - Intergenic
1080051932 11:27866855-27866877 AGGGTTTGTACAAAGAACAGAGG - Intergenic
1080322172 11:31023092-31023114 AGAGTTGGTCCCAAGAATCGAGG + Intronic
1080333527 11:31170272-31170294 TGACTTGGACCCAAGAAGAGTGG - Intronic
1080333909 11:31174482-31174504 AGTATGGGAACCATGAACAGTGG + Intronic
1085502388 11:77035741-77035763 AGTGTGGCATCCAAGAACAGAGG + Intronic
1085958138 11:81426473-81426495 TGAGTGGGAACAAGGAACAGTGG + Intergenic
1085978559 11:81693507-81693529 AGAGAAGGAAGCAAGAAAAGAGG + Intergenic
1088403931 11:109451031-109451053 AGGGTTGGAACCAAGAGCCCTGG - Intergenic
1089378701 11:118012712-118012734 AGTGCTGGAATCAAGTACAGAGG + Intergenic
1090736993 11:129618730-129618752 AGGGCTGGTACCAAGAACAGAGG - Intergenic
1090851833 11:130577659-130577681 AGATTTAGAACTAAGAATAGAGG - Intergenic
1091748057 12:3005146-3005168 AGAGGTGGAATCTAAAACAGTGG + Intronic
1092989396 12:13880419-13880441 AGAGATGCAACCAAAAACAATGG + Intronic
1095910105 12:47417431-47417453 AAAGTTGAGAACAAGAACAGTGG - Intergenic
1096102049 12:48975730-48975752 AATGTTGGAACAAAGCACAGTGG + Intergenic
1096404704 12:51335142-51335164 AGAGATGGAACTAAGAGCACAGG - Intronic
1097695248 12:62768802-62768824 GGAGGTGGAACAAAGAACACTGG + Intronic
1097746234 12:63306545-63306567 AGAGCTGGAAACAACAACAAAGG - Intergenic
1103147375 12:118607249-118607271 AGAATTGGAACCGAGAACCCAGG + Intergenic
1104004107 12:124880127-124880149 AGCGTGGGTACCAAGAACACTGG + Intronic
1104706501 12:130951414-130951436 AAATTTAGAACAAAGAACAGTGG - Intergenic
1106053743 13:26218510-26218532 AGAGATGGAACGAATTACAGAGG - Exonic
1106438691 13:29746071-29746093 ATAGCTGAAACCAAGCACAGTGG + Intergenic
1108280982 13:48861555-48861577 AAAGATGGAACCCAGAACAATGG - Intergenic
1108391637 13:49952944-49952966 GGAGTTGGAGCCAGGAACTGTGG + Intergenic
1108524900 13:51278346-51278368 AGAGATGGAACCACCACCAGGGG + Intronic
1110143769 13:72164848-72164870 AGAGATGGGACCAAGGCCAGTGG + Intergenic
1111353519 13:87064916-87064938 CAACTTGGAACCAAGACCAGTGG - Intergenic
1112287617 13:98118093-98118115 AAATTTAGAACAAAGAACAGTGG + Intergenic
1112408998 13:99146185-99146207 AAATTTGGAGCCAAGAACACTGG - Intergenic
1113459901 13:110474412-110474434 AGGGTTGGGACCCAGGACAGGGG + Intronic
1116233261 14:42245664-42245686 AGATGTGGAACCTAGAACAAAGG + Intergenic
1120163664 14:81171261-81171283 AGTGTTGGAAGCATTAACAGAGG + Intergenic
1120291486 14:82577493-82577515 AGAAATGGATCCAAGAACACAGG - Intergenic
1120465702 14:84854556-84854578 AGAGGTGGAAGAAAGAAGAGTGG + Intergenic
1121877403 14:97465939-97465961 ACAGATGGAACCATCAACAGAGG - Intergenic
1202900074 14_GL000194v1_random:30301-30323 ATAGATGGAGCCAAGAACGGTGG - Intergenic
1124860049 15:33430538-33430560 AAATTTAGAACAAAGAACAGTGG + Intronic
1125051441 15:35302386-35302408 AGTGCTGGAGGCAAGAACAGTGG - Intronic
1128212271 15:65910977-65910999 AGAGTGGGAAACAAGAAGTGAGG - Intronic
1128233143 15:66049265-66049287 AGAGTTGGAACCTAGAATACAGG - Intronic
1128578468 15:68792054-68792076 AGGGTTAGAACCAAGTACAGAGG - Intronic
1129634707 15:77302956-77302978 AGAGTTGGTAAAAAGATCAGTGG - Intronic
1130329072 15:82906269-82906291 AAAATTGGAACAAAGAACACGGG + Intronic
1133305022 16:4803041-4803063 AGGGTTGGAACCACGACCAATGG - Intergenic
1136500074 16:30665584-30665606 AGAGCTGGCACCAAGCACAAAGG - Intronic
1136661329 16:31765771-31765793 AGGGTTGCAACCAAGATCTGGGG - Intronic
1136735618 16:32463822-32463844 ACAGATGGAGCCAAGCACAGTGG - Intergenic
1137623296 16:49891160-49891182 GGAGTTCAAGCCAAGAACAGTGG + Intergenic
1138342750 16:56301413-56301435 AGAGCTGGAAGCAAGAGCTGGGG - Intronic
1138872752 16:60911823-60911845 AAAGTTGGAATCAACACCAGTGG + Intergenic
1139157506 16:64461463-64461485 AGAGTTGGAAAAATGAGCAGGGG - Intergenic
1141895952 16:86958912-86958934 AGAGTTGGAACCAAGGCTAGGGG - Intergenic
1203017460 16_KI270728v1_random:365747-365769 ACAGATGGAGCCAAGCACAGTGG + Intergenic
1203035795 16_KI270728v1_random:638905-638927 ACAGATGGAGCCAAGCACAGTGG + Intergenic
1143278428 17:5731781-5731803 AGAATTGGAAGATAGAACAGAGG + Intergenic
1144061748 17:11589163-11589185 AAATTTAGAACAAAGAACAGTGG - Intergenic
1144141413 17:12352357-12352379 AGAGCTGGAGCCTAGAAGAGGGG - Intergenic
1145899406 17:28480444-28480466 AGAGGTGGGGCCCAGAACAGAGG - Intronic
1145912293 17:28549717-28549739 AGGAAGGGAACCAAGAACAGTGG + Intronic
1146806436 17:35868615-35868637 AGAAATGGAGCCAAGAGCAGGGG - Intronic
1147655553 17:42088641-42088663 AGAGTCGAGACCAAGAACTGGGG - Intergenic
1148087546 17:45003468-45003490 AGGCTTGGAACCAGGAAGAGAGG - Intergenic
1148215659 17:45832900-45832922 AAAGTTGGAAGCAAGCACCGGGG - Intronic
1148736640 17:49868852-49868874 AGACAGAGAACCAAGAACAGAGG - Intergenic
1149003295 17:51778914-51778936 AGAGTTGGACCCAGGAACTCAGG + Intronic
1150651699 17:67014586-67014608 AGAGTTGGGAACAAGCCCAGAGG + Intronic
1151083952 17:71359937-71359959 AGAATGAGAACCAAGAAAAGGGG + Intergenic
1152267481 17:79304776-79304798 AGAGTTGGAACCAAGAACAGAGG - Intronic
1152565694 17:81099390-81099412 AGAGCTGGAGCCCAGGACAGTGG - Intronic
1155263465 18:24067907-24067929 AGAGTAGGAACCAGGAAACGAGG - Intronic
1156845563 18:41661864-41661886 AGAGTTGAAACCAAGGACAGAGG - Intergenic
1157751585 18:50183573-50183595 AGAGATGGAGCCAGGAAAAGTGG + Intronic
1158238952 18:55354806-55354828 AGAGTTGGAAACTGGAAGAGGGG + Intronic
1159087165 18:63806574-63806596 TGAGTTGGAAAGAAGAACATAGG + Intergenic
1164433730 19:28210071-28210093 AAAGTTGGTCCCAAGAACTGTGG + Intergenic
1165595620 19:37009558-37009580 AGACATGCAAACAAGAACAGGGG - Intronic
1167733324 19:51275190-51275212 AGATTTGGAACCAAGAAATTTGG - Intergenic
1167847474 19:52176401-52176423 AGAGTTTAAAAAAAGAACAGTGG - Intergenic
927469367 2:23360978-23361000 AGGGTGGGAGCAAAGAACAGAGG + Intergenic
927732666 2:25488382-25488404 AGAGTAGGAAACAAGATCTGAGG + Intronic
928640225 2:33290357-33290379 AGGGTTGGAAGCTAGAACTGTGG + Intronic
929901148 2:46004918-46004940 ACACTTGGAACCAGGGACAGAGG - Intronic
930068773 2:47348420-47348442 AAACTTGGAAACAAGAAAAGAGG + Intronic
930354418 2:50299752-50299774 AGGACTGGAACCAAGATCAGCGG - Intronic
931067229 2:58600329-58600351 AAAATTAGAAGCAAGAACAGAGG + Intergenic
931091502 2:58891549-58891571 AGACATGGATCCAAGTACAGAGG - Intergenic
932804953 2:74775635-74775657 AGAGTTGGGGCCAGGCACAGGGG + Intergenic
935867642 2:107408298-107408320 AGAGAAGGAACAAAGCACAGAGG - Intergenic
937502393 2:122493884-122493906 AGAGTTGGGTCCAAGCGCAGAGG - Intergenic
938175928 2:129128727-129128749 AGAGTTGGGACCAGCAGCAGTGG - Intergenic
938717950 2:134038216-134038238 AAAGTAGGAACAAAGAACAAGGG + Intergenic
938760548 2:134421833-134421855 AGAGGTGGAAACAAAATCAGGGG + Intronic
938776298 2:134544340-134544362 AGATTTGGAAACGAGAAGAGTGG - Intronic
939558713 2:143708608-143708630 AGAGTTGGAACTAAGACCAGGGG - Intronic
939660784 2:144887043-144887065 AGAGTTGGAGCCAAGGCCATGGG - Intergenic
941366283 2:164615454-164615476 AGAGTTGTAACTAACAACACTGG + Intronic
942572271 2:177326367-177326389 AGAGTAAGAGGCAAGAACAGGGG + Intronic
944027150 2:195184357-195184379 AGACTTTGAGCCAAGAATAGTGG + Intergenic
944130693 2:196344791-196344813 AGAGTTGGAATAAAGAAGACGGG + Intronic
947283134 2:228478818-228478840 AGAGCTGGAACCACTAATAGCGG - Intergenic
947509057 2:230734209-230734231 AAAGCTGGAACCAAGAATACAGG + Intronic
947522666 2:230860535-230860557 AGTGATGGAAACCAGAACAGTGG + Intergenic
1169324689 20:4665631-4665653 AGAGATCAACCCAAGAACAGAGG + Intergenic
1169696115 20:8388589-8388611 ATAGTTGGAACCAAGAATAAGGG - Intronic
1170353958 20:15471787-15471809 AGAGTTGGAATCCATAACAAAGG - Intronic
1170965755 20:21069648-21069670 AGAATTGGAACCCAGAGCAGGGG + Intergenic
1173162543 20:40663451-40663473 ACAGTTGGACCCAGGGACAGCGG - Intergenic
1173358165 20:42314761-42314783 AGAGTGTGAATCAAGAACAATGG + Intronic
1173365141 20:42378331-42378353 AGAATTGAAGCCAAGAAGAGAGG - Intronic
1173808279 20:45940433-45940455 AGAGTTGCAACCAGGGCCAGCGG - Intronic
1174567656 20:51478353-51478375 AGAGTTGGTATCAAGAAGAAAGG + Intronic
1175286708 20:57841436-57841458 AGAGTTTGAACCAATGACTGGGG - Intergenic
1175621353 20:60450201-60450223 AGAGTAGGAACTAACATCAGTGG + Intergenic
1176619447 21:9045079-9045101 ATAGATGGAGCCAAGAACGGTGG - Intergenic
1177007572 21:15692797-15692819 AAATTTAGAACAAAGAACAGAGG + Intergenic
1177086138 21:16707010-16707032 TGAGTTAGAAGCAAGAACACTGG - Intergenic
1179399831 21:41073686-41073708 AGAGATGGAATGAAGAACACAGG + Intergenic
1181124853 22:20696055-20696077 AGAGATGGAAGCCAGGACAGGGG + Intergenic
1184555298 22:45229543-45229565 ACAGGTGGCACCAAGAACAAGGG + Intronic
1184882557 22:47319308-47319330 AGAAAAGGAACCCAGAACAGGGG - Intergenic
1203274566 22_KI270734v1_random:78805-78827 AGAGATGGAAGCCAGGACAGGGG + Intergenic
949134036 3:540963-540985 AGAGAGGGAACAAAGAAGAGAGG - Intergenic
949520904 3:4853198-4853220 AAATTTAGAACAAAGAACAGTGG - Intronic
949941600 3:9159073-9159095 CGAGTTGGAACCTGGAACAGAGG - Intronic
951352222 3:21619984-21620006 ATGGTTGGGACCCAGAACAGAGG - Intronic
952053444 3:29414418-29414440 TAAGTTGGAACCAAAAACAAAGG + Intronic
952762930 3:36931415-36931437 ATATTTGCAACCAAGTACAGTGG + Intronic
953009531 3:39011436-39011458 AAATTTAGAACAAAGAACAGTGG + Intergenic
953509047 3:43516862-43516884 AGAGTAGGAAGGAAGCACAGGGG + Intronic
954327653 3:49872369-49872391 AGAGTTTGGAACAAGAGCAGAGG + Intergenic
954447427 3:50554144-50554166 GAAGTTGGTACCAAGAACTGTGG + Intergenic
955029671 3:55204098-55204120 ACAGCTGGAAACAAGAGCAGGGG + Intergenic
956946243 3:74226727-74226749 AGAGTTGCAATCAAGGACTGGGG + Intergenic
959634966 3:108555597-108555619 AAACTTAGAACAAAGAACAGTGG - Intronic
960020242 3:112942549-112942571 AAAATAGGAACAAAGAACAGAGG + Intronic
960422888 3:117469887-117469909 AGAGTTGCAACCTAGAACCAAGG + Intergenic
962671038 3:137708914-137708936 AAATTTGGAAGTAAGAACAGGGG + Intergenic
963470159 3:145730392-145730414 TCAGTTGGATCCAAGAAAAGAGG - Intergenic
963604499 3:147403262-147403284 ACTGTTGGAACCAAGAGGAGAGG + Intronic
963684981 3:148421852-148421874 AGAGGTGAAAACAATAACAGTGG + Intergenic
964317556 3:155460327-155460349 ACAGTTGGCACCAATACCAGGGG + Intronic
964448993 3:156791849-156791871 AAATTTAGAACAAAGAACAGAGG - Intergenic
968597825 4:1494538-1494560 AGGGGTGGAACCATGGACAGTGG - Intergenic
968978070 4:3832113-3832135 AGAGTTGGGAACAATGACAGCGG + Intergenic
969234023 4:5852636-5852658 AGAGTTGCATCCAATATCAGTGG - Intronic
969786780 4:9464505-9464527 AGAGTTGCAAACTAGAACGGTGG + Intergenic
970960119 4:21861765-21861787 ATAGTTGGAAGAAAGAACAATGG - Intronic
972521533 4:39861863-39861885 GGAGTTGGAACTGAAAACAGTGG - Intronic
972734152 4:41823958-41823980 AGACTTGGCACCAAGAACATAGG - Intergenic
973221494 4:47731993-47732015 AGAGGTGTAAGCAAGGACAGTGG + Intronic
973749777 4:54003099-54003121 ATAGTTGGAAAAAAGAATAGGGG - Intronic
975331321 4:73117602-73117624 AGAGGTAGAATAAAGAACAGCGG + Intronic
976103618 4:81592952-81592974 ACAGTTTTAACCCAGAACAGAGG + Intronic
976530927 4:86151103-86151125 GGAGATGGAATCAAGAACACAGG + Intronic
976893499 4:90079513-90079535 AGAGGTGGAACAAAGAGCAGAGG + Intergenic
978461619 4:108960865-108960887 TGAGATGGAAGCAAGCACAGTGG - Intronic
980210476 4:129781275-129781297 AGAGTTTGAACAGAGTACAGAGG + Intergenic
980916321 4:139036380-139036402 TGAGTTGGAGCCAGGCACAGTGG - Intronic
981968133 4:150631878-150631900 AGATGTGGAACTAAGAAGAGAGG + Intronic
983830393 4:172319973-172319995 ACAGATGCAACCAAGAACACAGG + Intronic
986772653 5:10987928-10987950 AGAATTGGGACTAAGAATAGAGG - Intronic
987781833 5:22447725-22447747 AGAGTTGGAAACTACAACATGGG - Intronic
988401620 5:30768575-30768597 AGAGTTGGAACCTATCACAGTGG - Intergenic
989997115 5:50849148-50849170 AGAGTTGGAGCCATTCACAGTGG - Intergenic
990538878 5:56752350-56752372 AGACTTGGAACCAGGAAAACTGG + Intergenic
991007892 5:61848378-61848400 AGAATAGGAACAAAGAACAAGGG + Intergenic
991998150 5:72408694-72408716 AGAGTAGAAACCAAGAAAAGTGG + Intergenic
995597605 5:113764590-113764612 AAATTTAGAACAAAGAACAGTGG - Intergenic
995637804 5:114214981-114215003 TTATTTGGAACCAAGATCAGAGG + Intergenic
995994089 5:118278808-118278830 ACATTTGGAATAAAGAACAGAGG - Intergenic
996108325 5:119533749-119533771 GTAGTTGGAACCAAGAACGTTGG + Intronic
997205591 5:132047233-132047255 AGAGTAGGGACCACGAACTGGGG + Intergenic
998562931 5:143188263-143188285 ACAATAGGAACCAAGATCAGTGG + Intronic
999508429 5:152222467-152222489 GGACTTGGATCCAAGAACACTGG + Intergenic
1000507245 5:162136511-162136533 AAAGTTGGAATGAAGAAAAGGGG + Intronic
1001538334 5:172516268-172516290 AAAGTAGGAACAAAGAACAAGGG + Intergenic
1001564062 5:172688209-172688231 AGAGGTGGAGCCCAGAACTGGGG - Exonic
1001657865 5:173366896-173366918 AGAGTTGGAAACAAAAATATGGG - Intergenic
1003282608 6:4707001-4707023 AGAGTTGGAAGATAAAACAGAGG + Intronic
1003555644 6:7137324-7137346 AGGGTTGGAATCCAGAAAAGAGG + Intronic
1004225280 6:13779204-13779226 AAATTTAGAACAAAGAACAGTGG + Intergenic
1005222554 6:23603719-23603741 ACAATAGGAACCAAGAACAAAGG + Intergenic
1006040787 6:31252892-31252914 AAATTTAGAACAAAGAACAGTGG + Intergenic
1007041529 6:38726767-38726789 AGAGATGGAACAAGGAACAAGGG + Intronic
1009537335 6:64905379-64905401 TGAGTAGGAATAAAGAACAGGGG - Intronic
1012589567 6:100963824-100963846 AGATTTGGAAACTAGAATAGGGG + Intergenic
1012607670 6:101177990-101178012 AGAGATGGAGCCATAAACAGGGG + Intergenic
1013697553 6:112721830-112721852 TGCGTTGGAAACAAGAAGAGCGG + Intergenic
1014086321 6:117349627-117349649 AAAGTAGGAACAAAGAACAAGGG - Intronic
1014995274 6:128135329-128135351 AGGGCTGGACCCAAGAGCAGTGG + Intronic
1015024032 6:128511394-128511416 ATGGTTGGAAACAAGATCAGTGG + Intronic
1015255072 6:131169990-131170012 AGGGATGGAAGCAAGAAGAGAGG - Intronic
1015943775 6:138478435-138478457 AGAGTTGGAATAAATGACAGTGG - Intronic
1016553459 6:145308900-145308922 AGATTTAGAACAAAGAACAGTGG - Intergenic
1018326419 6:162674745-162674767 AGAGTGGGAAGAAAGAATAGAGG + Intronic
1019091791 6:169541988-169542010 AGAGTTTGAAGCAGGAGCAGTGG - Intronic
1024562694 7:50657790-50657812 AGACTTGGCACCAACAGCAGAGG + Intronic
1024744026 7:52386956-52386978 TGACTTAGATCCAAGAACAGGGG - Intergenic
1026212949 7:68323120-68323142 AAATTTAGAACCAAGAGCAGGGG + Intergenic
1026860126 7:73780911-73780933 AGAGATTGAACCAAGTGCAGTGG + Intergenic
1028053120 7:86208874-86208896 AGCCTGGGAACCATGAACAGTGG - Intergenic
1028323202 7:89488298-89488320 AGAGTTGAAATCAATAACAGTGG - Intergenic
1032285378 7:130535449-130535471 AGAGTAGGAACCAAGGAATGTGG + Intronic
1037117161 8:15240580-15240602 AGAGTGGGAACCAAGCAAAAGGG - Intergenic
1037610990 8:20476166-20476188 AGAGTTTGGACCAGGCACAGTGG - Intergenic
1037824017 8:22150007-22150029 ACAGCTGAAATCAAGAACAGAGG - Intronic
1038698904 8:29831166-29831188 AGAGTTTGATTCAAGGACAGTGG + Intergenic
1038704966 8:29884901-29884923 AGATTTTGAACCAAGAACTGTGG - Intergenic
1039381593 8:37090782-37090804 AAGGTAGGAACCAAGAATAGAGG + Intergenic
1039851414 8:41368807-41368829 AGAGTTGGCCCCCAGAAAAGGGG + Intergenic
1040919185 8:52598103-52598125 AAATTTAGAACGAAGAACAGTGG - Intergenic
1042449064 8:68923269-68923291 AAATTTAGAACCAAGAACGGCGG - Intergenic
1043052330 8:75399190-75399212 AGGGATGGAATCAAGAACACAGG + Intergenic
1044744167 8:95356113-95356135 AGATAGGGAAGCAAGAACAGAGG + Intergenic
1048631016 8:136242514-136242536 AGAGTTAGATCCCAGAGCAGTGG + Intergenic
1048707798 8:137173558-137173580 AGAGTTGGACCCAAAAAGAAAGG + Intergenic
1049964043 9:762460-762482 AGTGTTGCAACCAAGAGCTGAGG + Intergenic
1050353898 9:4764961-4764983 AGACTTGGGACCAGGCACAGTGG - Intergenic
1050505537 9:6344977-6344999 AAAGTTGGAACCAGGCATAGTGG + Intergenic
1051676912 9:19567755-19567777 AGTGTTGGAATCAACAACAATGG + Intronic
1052280121 9:26723554-26723576 ATGATTGGAACAAAGAACAGAGG - Intergenic
1056858999 9:90162277-90162299 AGAGTTGGACCCATGAACTCTGG - Intergenic
1056970071 9:91194227-91194249 AGAGTTGGAATCAAGGACTTCGG + Intergenic
1058077579 9:100667012-100667034 AGAGTGGGCACCAAGAGCAAGGG - Intergenic
1058862964 9:109135348-109135370 ACATTTGGAACAAAGAACAAAGG + Exonic
1059565462 9:115379783-115379805 AGGGTTGGAGCCAAGCCCAGGGG + Intronic
1059997320 9:119924820-119924842 AGAGTAGAAATCAAGAACAGTGG + Intergenic
1060539649 9:124420873-124420895 AGAGTTAGCATCAAGACCAGGGG + Intergenic
1061526244 9:131165913-131165935 AGAGATGGAAACAAGAATAGGGG + Intronic
1062336264 9:136070745-136070767 AAAATTGAAAACAAGAACAGAGG + Intronic
1186018152 X:5222801-5222823 AGATTTGGAACAAAACACAGAGG + Intergenic
1186570398 X:10709173-10709195 AGAGTTGGAAGTCAGAACATTGG - Intronic
1186780365 X:12905941-12905963 AAAGGTGTAACCAAGAGCAGAGG - Intergenic
1188529708 X:31126173-31126195 AGCGTAGGAACCAAGAAAAAAGG + Intronic
1189275447 X:39781943-39781965 AGACTTGGAGCCAGGCACAGTGG - Intergenic
1189885435 X:45539477-45539499 AGAATTGGAATAAAGAACAAAGG + Intergenic
1193024585 X:76831753-76831775 GGAGTTAGAACCAAAACCAGTGG + Intergenic
1194495608 X:94613571-94613593 AGAGCTAGAGCCTAGAACAGAGG + Intergenic
1198049134 X:132931585-132931607 GGAGTTGGAGGCAAGGACAGGGG - Intronic
1199444959 X:147911421-147911443 AGACTTTGAACTAGGAACAGTGG - Intergenic
1201153112 Y:11105067-11105089 ATAGATGGAGCCAAGAACGGTGG - Intergenic